transferase
Navigation Links
transferase in Medical News
Genes May Boost Harm to Kids From Secondhand Smoke
... and susceptibility to environmental insults," she said. "We looked at a class of genes known to be involved in antioxidant defense, the glutathione-s transferase (GST) genes. Overall, we found that variation in several of the GST genes was important. This was particularly true for children of mothers who had sm......ial cell adhesion molecule (EpCam); estrogen receptor-alpha (Er-alpha); eukaryotic translation initiation factor 4E (EIF4E); exonuclease III; farnesyl transferase (FTase); fibroblast growth factor 2 (FGF-2); FGFr; focal adhesion kinase (FAK); folate receptor (FOLr); FOLr1; galectin 3 (GAL3) receptor; gastrin 17 ...
transferase in Biological News
In just 5 years, gene discovery to clinical trial of potential treatment
...t pinpointed HGPS' genetic mutation in 2003. Just two years later, NHGRI scientists identified the class of experimental cancer drugs, called farnesyl transferase inhibitors (FTIs), that can prevent the cell damage caused by the gene mutation and thus might provide an effective therapy against the disease; o ......leagues Prof Peter Fischer and Prof David Heery will explore histone acetyl transferase (HAT) inhibitors in asthma and COPD. This study will investigate a bank of ...y the balance between two competing groups of enzymes called histone acetyl transferase (HATs) and histone deacetylases (HDACs). In asthma and COPD sufferers the b...
ASPB announces Summer Undergraduate Research Fellowship 2007 recipients
...cium on the Growth of Various Mutant Plants Mentor: Dr. Catherine Chan Tazley Hotz, East Tennessee State University Project: Salicylic acid-methyl transferase required for plant innate immunity Mentor: Dr. Dhirendra Kumar Janelle Johnson, San Francisco State University Project: WAKL4 Cis-Acting Elements ...Scientists discover way to block growth of prostate cancer cells
...e Comprehensive Cancer Center, Madison, WI, USA. He and his collaborators at the centre found that levels of a key enzyme, spermidine/spermine acetyl transferase (SSAT), which starts oxidation of polyamines, rose markedly when prostate cancer cells were treated with androgen. Polyamines are small molecules pro...A new molecule discovered in the battle between plants and disease
...gnaling pathway. Constitutively overexpressing the proAtPep1 gene in Arabidopsis induced a constitutive activation of PDF1.2, PR-1, and tyrosine amino transferase (TAT3) genes, but not the expression of LOX2 or VSP2 genes. The transgenic plants were more resistant toward the oomycete root pathogen Pythium irregu...transferase in Biological Technology
... assessments of hyaluronic acid (HA), a biomarker specific to liver fibrosis, with assessments of the nonspecific biomarkers bilirubin, gamma-glutamyl transferase (GGT), alpha2 macroglobulin (A2M), and age and gender.
Previous studies of Hepascore in populations in France and Australia have showed it is r...
...d Discussion The structures of morphine and one of its metabolites are shown in Figure 1. Glucuronidation (catalyzed by uridine-glucuronic transferase or UGTs) is a Phase II metabolism reaction which involves the addition of glucuronic acid from uridine-diphosphoglucuronide to the xenobiotic being me...
VIA Pharmaceuticals' DGAT1 Inhibitors Featured in American Diabetes Association Poster Presentation
...velopment of compounds for the treatment of cardiovascular and metabolic disease, announced today that preclinical data related to diacylglycerol acyl transferase - 1 (DGAT1) inhibitors will be presented in a poster presentation at the 69th Scientific Sessions of the American Diabetes Association June 6, 2009 in......d Discussion The structures of morphine and one of its metabolites are shown in Figure 1. Glucuronidation (catalyzed by uridine-glucuronic transferase or UGTs) is a Phase II metabolism reaction which involves the addition of glucuronic acid from uridine-diphosphoglucuronide to the xenobiotic being me...
Transgenic Zebrafish by Electroporation
... 79 , 6777-6781, 1982). This plasmid uses the Rous sarcoma virus (RSV) promoter to effectively drive expression of chloramphenicol acetyl transferase (CAT) in numerous eukaryotic cell types. Methods Fish Maintenance and Egg Collection Zebraf...In Situ Cell Death Detection Kit
...duces strand breaks ("nicks") into the high-molecular-weight DNA. These processes can be identified by labeling the free 3-OH termini with terminal transferase (TdT), which attaches labeled nucleotides to all 3OH-ends (TUNEL reaction; TdT-mediated dUTP nick end labeling). This labeling is more sensitive...Housekeeping Genes: Universal Positive Controls in siRNA Knockdown Experiments
.... Results siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cel...High-Fidelity PCR with a Novel Polymerase Mixture
... date. Pfu DNA polymerase also lacks terminal transferase activity and produces only blunt-ended ...annot be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures 2...annot be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures 2...Brilliant Core Reagent Kits for QPCR and QRT-PCR
...sed the sensitivity of the Brilliant two-step QRT-PCR kit to detect a low-abundance target by amplifying and detecting hypoxanthine phosphoribosyl transferase (HPRT) mRNA from human brain total RNA. For the real-time analysis of the RT-PCR amplification, we used the primers and linear hydrolysis probe fr...transferase in Biological Products
Mouse Anti-Human gamma Glutamyl Transferase (gammaGT) Monoclonal Antibody, Unconjugated from AnaSpec
Description: Anti-gamma Glutamyl Transferase (gammaGT) Host: mouse monoclonal Species Reactivity: human Applications: WB, IP, FC Storage: 4C...Company:AnaSpec
Rabbit Anti-Human Glutathione S Transferase alpha Polyclonal Antibody, Unconjugated from Abcam
Description: Rabbit polyclonal to Glutathione S Transferase alpha ( Abpromise for all tested applications). Antigen: Full length protein: Human Glutathione S Transferase alpha. Entrez GeneID: 2938 Swiss Protein ID: P08263...Company:Abcam
Terminal deoxynucleotidyl transferase (TdT) Immunofluorescence Assay Kit from AbD Serotec
Description: Terminal deoxynucleotidyl transferase (TdT) is an intracellular marker normally present at high levels in cortical thymocytes and minor subpopulation of bone marrow prelymphocytes. Elevated levels of the enzyme and increased numbers of TdT cells are found to be associated with some lymphoblastic le...Company:AbD Serotec
Flp-In pcDNA5/FRT Complete Kit from Invitrogen
Description:...of the protein of interest. This homogeneous expression is demonstrated in Figure 3. In this experiment the coding sequence for chloramphenicol-acetyl transferase (CAT) was subcloned into pcDNA5/FRT and transfected into Flp-In-293 cells. Western blot analysis of individual hygromycin-resistant clones clearly sho...Company:Invitrogen
Flp-In pcDNA5/FRT Core Kit from Invitrogen
Description:...nterest. This homogeneous expression is demonstrated in Figure 3 (click link below). In this experiment the coding sequence for chloramphenicol-acetyl transferase (CAT) was subcloned into pcDNA5/FRT and transfected into Flp-In-293 cells. Western blot analysis of individual hygromycin-resistant clones clearly sho...Company:Invitrogen
Description:... Antibiotic isolated fromStreptomyces griseolusthat inhibits protein synthesis. Acts by inhibiting peptidyl transferase activity in eukaryote ribosomes. Reported to induce apoptosis in a variety of cells including promyelocytic leukemia cells, Jurkat cells, ventricular ...
Company:Sigma-Aldrich
Flow Cytometry Kit for Apoptosis from Sigma-Aldrich
Description:...ith bromodeoxyuridine triphosphate (Br-dUTP). Br-dUTP is enzymatically attached to the 3-hydroxyl sites of double- or single-stranded DNA by terminal transferase (TdT). Non-apoptotic cells do not incorporate Br-dUTP due to the lack of available 3-hydroxyl sites. BRAND: SIGMA Adequate for: 60 cel...Company:Sigma-Aldrich
ApoDIRECT DNA Fragmentation Assay Kit from MBL International
Description:...onveniently detecting DNA fragmentation by fluorescence microscopy or flow cytometry. The TUNEL-based detection kit utilizes terminal deoxynucleotidyl transferase (TdT) to catalyze incorporation of fluorescein-12-dUTP at the free 3-hydroxyl ends of the fragmented DNA. The fluorescein-labeled DNA can then be obse...Company:MBL International
Apo-BrdU Apoptosis Detection Kit from eBioscience
Description:...ers for processing individual steps in the assay; terminal deoxynucleotidyl transferase enzyme (TdT), bromodeoxyuridine triphosphate (Br-dUTP), and fluorescein lab...ne triphosphate nucleotides (Br-dUTP). The enzyme terminal deoxynucleotidyl transferase (TdT) catalyzes a template independent addition of deoxyribonucleoside trip...Company:eBioscience
APO-DIRECT™ Kit from BD Biosciences Pharmingen
Description:...cells for assessing reagent performance; washing, reaction and rinsing buffers for processing individual steps in the assay; terminal deoxynucleotidyl transferase enzyme (TdT); fluorescein labeled deoxyuridine triphosphate (FITC-dUTP) and propidium iodide (PI)/RNase solution for staining total DNA....Company:BD Biosciences Pharmingen
transferase in Biological Dictionary
The Peptidyl transferase is an aminoacyltransferase (EC 2.3.2.12) as well as the primary enzymatic function of the ribosome which forms peptide links between adjacent amino acids using tRNAs during the translation process of protein biosynthesis. Aspects of the topic peptidyl - tran...
...observed for eukaryotic ... ... on why this elongation is necessary see Telomere shortening. ... Identification of a specific telomere terminal transferase activity in Tetrahymena extracts" ... Telomere length and progression of diabetic nephropathy in patients with type 1 diabetes. ... Telomere dy...
...ibonucleotide Transferase-Mediated dUTP ... Terminal deoxyribonucleotide transferase (TdT)-mediated dUTP nick end labeling ... deoxyribonucleotide explan...l can ... Processes and reagent kits employing terminal deoxynucleotide transferase are provided for terminally chemically ... labeled deoxyribonucleotide in...
... is called "molecular cloning ", because multiple copies of ... TA Cloning Technology: TA cloning is brought about by the terminal transferase activity of certain type of DNA polymerase such as the Taq polymerase ... and cancer research tools: multigenic vectors , plasmid vectors ,...
...... A direct assay for chloramphenicol acetyl transferase ( CAT ) has been presented ... Promega, " CAT Enz...AT assay . CAT assay . Chloramphenicol Acetyl transferase ( CAT ) is a bacterial enzyme which inactivates ...ids, and ... Assay for chloramphenicol acetyl transferase in amoebal lysates ... Spot solution onto a 20x20c...
...observed for eukaryotic ... ... on why this elongation is necessary see Telomere shortening. ... Identification of a specific telomere terminal transferase activity in Tetrahymena extracts" ... Telomere length and progression of diabetic nephropathy in patients with type 1 diabetes. ... Telomere dy...
...ibonucleotide Transferase-Mediated dUTP ... Terminal deoxyribonucleotide transferase (TdT)-mediated dUTP nick end labeling ... deoxyribonucleotide explan...l can ... Processes and reagent kits employing terminal deoxynucleotide transferase are provided for terminally chemically ... labeled deoxyribonucleotide in...
... is called "molecular cloning ", because multiple copies of ... TA Cloning Technology: TA cloning is brought about by the terminal transferase activity of certain type of DNA polymerase such as the Taq polymerase ... and cancer research tools: multigenic vectors , plasmid vectors ,...
...... A direct assay for chloramphenicol acetyl transferase ( CAT ) has been presented ... Promega, " CAT Enz...AT assay . CAT assay . Chloramphenicol Acetyl transferase ( CAT ) is a bacterial enzyme which inactivates ...ids, and ... Assay for chloramphenicol acetyl transferase in amoebal lysates ... Spot solution onto a 20x20c...
Other TagssnacksstoredOther Contentscrossovercrossovercrossovercrossovercrossoverchromosomalchromosomalchromosomalchromosomalchromosomalchromosomaltomographytomographytomographytomographytomographytomographytomographyaxialaxialaxialcomputedcomputedcomputedcomputedcomputedcomputedcultureculturecultureculturecultureculturecultureculturecultureculturecytoplasmcytoplasmcytoplasmcytoplasmcytoplasmcytoplasmcytoskeletoncytoskeletoncytoskeletoncytoskeleton
MelonsBiocompatiblesworthwhileunfamiliaritysnacksFuneralstoreddeceasedineffectuallollipopsConsidereduntouchedZevalinamiable
(Date:12/5/2009)Wind Turbines are popping up in the most unusual places, and to do everything from growing mushrooms, making wine to keeping prisoners in jail! , (PRWEB) December 5, 2009 -- W
(Date:12/4/2009)SAN FRANCISCO, Dec. 4 Medithrive, Inc. has won the Patient,s Choice Award as the favorite dispensary in the SF Bay Area by popular vote conducted by the online website, www.weedmaps.com. Despite on
(Date:12/4/2009)KANSAS CITY, Mo., Dec. 4 The large, two-day free health clinic sponsored by the National Association of Free Clinics (NAFC) in Kansas City on Wednesday and Thursday is not just for the sick but also
(Date:12/4/2009)WASHINGTON, Dec. 4 In response to the U.S. Justice Department Drug Enforcement Agency,s (DEA) classification of boldione, desoxymethyltestosterone, and 19-nor-4,9(10)-androstadienedione as "anabolic
(Date:12/4/2009)Case Western Reserve University researchers, from the School of Medicine,s Department of Nutrition, discovered two new metabolic pathways by which products of lipid peroxidation and some drugs of abus
Breaking Medicine News(10 mins):Health News:Distributor Announces New Applications for Wind Turbines 2Health News:Distributor Announces New Applications for Wind Turbines 3Health News:Free Health Clinic Event Is Not Just for the Sick 2Health News:Natural Products Association Issues Statement on DEA's Steroid Classification Action 2Health News:Case Western Reserve researchers' new pathway discovery published as 'Paper of the Week' 2[0] Distributor Announces New Applications for Wind Turbines [0] Medithrive Voted #1 Medicinal Marijuana Dispensary in Bay Area[0] Free Health Clinic Event Is Not Just for the Sick[0] Natural Products Association Issues Statement on DEA's Steroid Classification Action[0] Case Western Reserve researchers' new pathway discovery published as 'Paper of the Week'
(Date:12/3/2009)Grand Rapids, Mich. (Dec. 3, 2009) Van Andel Research Institute (VARI) researchers have determined precisely how the plant hormone abscisic acid (ABA) works at the molecular level to help plants re
(Date:12/3/2009)Forest dwellers must be included in the design of the upcoming forest deal at Copenhagen in order to avoid a humanitarian crisis, according to a scientist at the University of Leeds. , Writing today
(Date:12/3/2009)UPTON, NY A team of scientists from the U.S. Department of Energy,s (DOE) Brookhaven National Laboratory, Harvard University, and the Indian Institute of Science has made a major step in understandin
Breaking Biology News(10 mins):VAI researchers find long awaited key to creating drought resistant crops 2VAI researchers find long awaited key to creating drought resistant crops 3Forest deal at Copenhagen must avoid creating 'carbon refugees' 2Grooving down the helix 2Grooving down the helix 3Vion Pharmaceuticals Engages Merriman Curhan Ford to Evaluate Strategic Alternatives 5403 1Vion Pharmaceuticals Engages Merriman Curhan Ford to Evaluate Strategic Alternatives 5403 2Vion Pharmaceuticals Engages Merriman Curhan Ford to Evaluate Strategic Alternatives 5403 3News brief 3A Effects of aspirin and folic acid on inflammation markers for colorectal adenomas 59312 1Drop in Certain Visual Skills May Precede Alzheimers 59310 1Drop in Certain Visual Skills May Precede Alzheimers 59310 2| Copyright © 2003-2009 Bio-Medicine. All rights reserved. ABOUT | CONTACT US | DISCLAIMER | PRIVACY POLICY | TERMS AND CONDITIONS |  |