Navigation Links
transferase in Medical News

Genes May Boost Harm to Kids From Secondhand Smoke

... and susceptibility to environmental insults," she said. "We looked at a class of genes known to be involved in antioxidant defense, the glutathione-s transferase (GST) genes. Overall, we found that variation in several of the GST genes was important. This was particularly true for children of mothers who had sm...

Targeted Anticancer Drugs - In Vitro Assessment and Non-Invasive Imaging of Patient and Tumor Status Will Determine Clinical and Commercial Success

...ial cell adhesion molecule (EpCam); estrogen receptor-alpha (Er-alpha); eukaryotic translation initiation factor 4E (EIF4E); exonuclease III; farnesyl transferase (FTase); fibroblast growth factor 2 (FGF-2); FGFr; focal adhesion kinase (FAK); folate receptor (FOLr); FOLr1; galectin 3 (GAL3) receptor; gastrin 17 ...
transferase in Biological News

In just 5 years, gene discovery to clinical trial of potential treatment

...t pinpointed HGPS' genetic mutation in 2003. Just two years later, NHGRI scientists identified the class of experimental cancer drugs, called farnesyl transferase inhibitors (FTIs), that can prevent the cell damage caused by the gene mutation and thus might provide an effective therapy against the disease; o ...

HATS off to combat asthma

...leagues Prof Peter Fischer and Prof David Heery will explore histone acetyl transferase (HAT) inhibitors in asthma and COPD. This study will investigate a bank of ...y the balance between two competing groups of enzymes called histone acetyl transferase (HATs) and histone deacetylases (HDACs). In asthma and COPD sufferers the b...

ASPB announces Summer Undergraduate Research Fellowship 2007 recipients

...cium on the Growth of Various Mutant Plants Mentor: Dr. Catherine Chan Tazley Hotz, East Tennessee State University Project: Salicylic acid-methyl transferase required for plant innate immunity Mentor: Dr. Dhirendra Kumar Janelle Johnson, San Francisco State University Project: WAKL4 Cis-Acting Elements ...

Scientists discover way to block growth of prostate cancer cells

...e Comprehensive Cancer Center, Madison, WI, USA. He and his collaborators at the centre found that levels of a key enzyme, spermidine/spermine acetyl transferase (SSAT), which starts oxidation of polyamines, rose markedly when prostate cancer cells were treated with androgen. Polyamines are small molecules pro...

A new molecule discovered in the battle between plants and disease

...gnaling pathway. Constitutively overexpressing the proAtPep1 gene in Arabidopsis induced a constitutive activation of PDF1.2, PR-1, and tyrosine amino transferase (TAT3) genes, but not the expression of LOX2 or VSP2 genes. The transgenic plants were more resistant toward the oomycete root pathogen Pythium irregu...
transferase in Biological Technology

Study Finds Noninvasive Blood Test for Liver Fibrosis May Alleviate Need for Liver Biopsies for Some Patients with Chronic Hepatitis C

... assessments of hyaluronic acid (HA), a biomarker specific to liver fibrosis, with assessments of the nonspecific biomarkers bilirubin, gamma-glutamyl transferase (GGT), alpha2 macroglobulin (A2M), and age and gender. Previous studies of Hepascore in populations in France and Australia have showed it is r...

VIA Pharmaceuticals' DGAT1 Inhibitors Featured in American Diabetes Association Poster Presentation

...velopment of compounds for the treatment of cardiovascular and metabolic disease, announced today that preclinical data related to diacylglycerol acyl transferase - 1 (DGAT1) inhibitors will be presented in a poster presentation at the 69th Scientific Sessions of the American Diabetes Association June 6, 2009 in...

Detection of Morphine and Morphine-Glucuronide in Saliva or Urine with a Rapid and Simple Method Without Derivatization on the Varian 500-MS

...d Discussion The structures of morphine and one of its metabolites are shown in Figure 1. Glucuronidation (catalyzed by uridine-glucuronic transferase or UGTs) is a Phase II metabolism reaction which involves the addition of glucuronic acid from uridine-diphosphoglucuronide to the xenobiotic being me...

Transgenic Zebrafish by Electroporation

... 79 , 6777-6781, 1982). This plasmid uses the Rous sarcoma virus (RSV) promoter to effectively drive expression of chloramphenicol acetyl transferase (CAT) in numerous eukaryotic cell types. Methods Fish Maintenance and Egg Collection Zebraf...

In Situ Cell Death Detection Kit

...duces strand breaks ("nicks") into the high-molecular-weight DNA. These processes can be identified by labeling the free 3-OH termini with terminal transferase (TdT), which attaches labeled nucleotides to all 3OH-ends (TUNEL reaction; TdT-mediated dUTP nick end labeling). This labeling is more sensitive...

Housekeeping Genes: Universal Positive Controls in siRNA Knockdown Experiments

.... Results siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cel...

High-Fidelity PCR with a Novel Polymerase Mixture

... date. Pfu DNA polymerase also lacks terminal transferase activity and produces only blunt-ended ...annot be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures 2...annot be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures 2...

Brilliant Core Reagent Kits for QPCR and QRT-PCR

...sed the sensitivity of the Brilliant two-step QRT-PCR kit to detect a low-abundance target by amplifying and detecting hypoxanthine phosphoribosyl transferase (HPRT) mRNA from human brain total RNA. For the real-time analysis of the RT-PCR amplification, we used the primers and linear hydrolysis probe fr...
transferase in Biological Products

Mouse Anti-Human gamma Glutamyl Transferase (gammaGT) Monoclonal Antibody, Unconjugated from AnaSpec

Description: Anti-gamma Glutamyl Transferase (gammaGT) Host: mouse monoclonal Species Reactivity: human Applications: WB, IP, FC Storage: 4C...
Company:AnaSpec

Rabbit Anti-Human Glutathione S Transferase alpha Polyclonal Antibody, Unconjugated from Abcam

Description: Rabbit polyclonal to Glutathione S Transferase alpha ( Abpromise for all tested applications). Antigen: Full length protein: Human Glutathione S Transferase alpha. Entrez GeneID: 2938 Swiss Protein ID: P08263...
Company:Abcam

Terminal deoxynucleotidyl transferase (TdT) Immunofluorescence Assay Kit from AbD Serotec

Description: Terminal deoxynucleotidyl transferase (TdT) is an intracellular marker normally present at high levels in cortical thymocytes and minor subpopulation of bone marrow prelymphocytes. Elevated levels of the enzyme and increased numbers of TdT cells are found to be associated with some lymphoblastic le...
Company:AbD Serotec

Flp-In pcDNA5/FRT Complete Kit from Invitrogen

Description:...of the protein of interest. This homogeneous expression is demonstrated in Figure 3. In this experiment the coding sequence for chloramphenicol-acetyl transferase (CAT) was subcloned into pcDNA5/FRT and transfected into Flp-In-293 cells. Western blot analysis of individual hygromycin-resistant clones clearly sho...
Company:Invitrogen

Flp-In pcDNA5/FRT Core Kit from Invitrogen

Description:...nterest. This homogeneous expression is demonstrated in Figure 3 (click link below). In this experiment the coding sequence for chloramphenicol-acetyl transferase (CAT) was subcloned into pcDNA5/FRT and transfected into Flp-In-293 cells. Western blot analysis of individual hygromycin-resistant clones clearly sho...
Company:Invitrogen

Anisomycin from Sigma-Aldrich

Description:... Antibiotic isolated fromStreptomyces griseolusthat inhibits protein synthesis. Acts by inhibiting peptidyl transferase activity in eukaryote ribosomes. Reported to induce apoptosis in a variety of cells including promyelocytic leukemia cells, Jurkat cells, ventricular ...
Company:Sigma-Aldrich

Flow Cytometry Kit for Apoptosis from Sigma-Aldrich

Description:...ith bromodeoxyuridine triphosphate (Br-dUTP). Br-dUTP is enzymatically attached to the 3-hydroxyl sites of double- or single-stranded DNA by terminal transferase (TdT). Non-apoptotic cells do not incorporate Br-dUTP due to the lack of available 3-hydroxyl sites. BRAND: SIGMA Adequate for: 60 cel...
Company:Sigma-Aldrich

ApoDIRECT DNA Fragmentation Assay Kit from MBL International

Description:...onveniently detecting DNA fragmentation by fluorescence microscopy or flow cytometry. The TUNEL-based detection kit utilizes terminal deoxynucleotidyl transferase (TdT) to catalyze incorporation of fluorescein-12-dUTP at the free 3-hydroxyl ends of the fragmented DNA. The fluorescein-labeled DNA can then be obse...
Company:MBL International

Apo-BrdU Apoptosis Detection Kit from eBioscience

Description:...ers for processing individual steps in the assay; terminal deoxynucleotidyl transferase enzyme (TdT), bromodeoxyuridine triphosphate (Br-dUTP), and fluorescein lab...ne triphosphate nucleotides (Br-dUTP). The enzyme terminal deoxynucleotidyl transferase (TdT) catalyzes a template independent addition of deoxyribonucleoside trip...
Company:eBioscience

APO-DIRECT™ Kit from BD Biosciences Pharmingen

Description:...cells for assessing reagent performance; washing, reaction and rinsing buffers for processing individual steps in the assay; terminal deoxynucleotidyl transferase enzyme (TdT); fluorescein labeled deoxyuridine triphosphate (FITC-dUTP) and propidium iodide (PI)/RNase solution for staining total DNA....
Company:BD Biosciences Pharmingen

More>>

transferase in Biological Dictionary

Peptidyl transferase

The Peptidyl transferase is an aminoacyltransferase (EC 2.3.2.12) as well as the primary enzymatic function of the ribosome which forms peptide links between adjacent amino acids using tRNAs during the translation process of protein biosynthesis. Aspects of the topic peptidyl - tran...

Telomere

...observed for eukaryotic ... ... on why this elongation is necessary see Telomere shortening. ... Identification of a specific telomere terminal transferase activity in Tetrahymena extracts" ... Telomere length and progression of diabetic nephropathy in patients with type 1 diabetes. ... Telomere dy...

Deoxyribonucleotide

...ibonucleotide Transferase-Mediated dUTP ... Terminal deoxyribonucleotide transferase (TdT)-mediated dUTP nick end labeling ... deoxyribonucleotide explan...l can ... Processes and reagent kits employing terminal deoxynucleotide transferase are provided for terminally chemically ... labeled deoxyribonucleotide in...

Cloning vector

... is called "molecular cloning ", because multiple copies of ... TA Cloning Technology: TA cloning is brought about by the terminal transferase activity of certain type of DNA polymerase such as the Taq polymerase ... and cancer research tools: multigenic vectors , plasmid vectors ,...

CAT assay

...... A direct assay for chloramphenicol acetyl transferase ( CAT ) has been presented ... Promega, " CAT Enz...AT assay . CAT assay . Chloramphenicol Acetyl transferase ( CAT ) is a bacterial enzyme which inactivates ...ids, and ... Assay for chloramphenicol acetyl transferase in amoebal lysates ... Spot solution onto a 20x20c...
Other Tags
(Date:7/26/2014)... European security and surveillance radar market under defense aviation ... is expected to reach $1800 million by 2019 at ... that influence a country’s expenditure on radars. It provides ... The report also throws light on the leading competitors ... of the companies, it focuses on their financial position, ...
(Date:7/26/2014)... Recently, iFitDress.com, a popular supplier of ... unveiled its new range of high quality party outfits. ... brand new items; they are now provided at discounted ... is one of the leading suppliers in the international ... wholesale party dresses have flattering looks and ...
(Date:7/26/2014)... 26, 2014 As reported by ... changing based on 3 factors: smaller spaces, multi-generational access, ... bathroom trend of 2014 lists, including this article ... Amerec , a leading manufacturer of steam bath ... largely due to smaller spaces and an effort to ...
(Date:7/26/2014)... July 26, 2014 “Healthy teeth are important, ... those pearly whites shining,” says Community Health Center of Snohomish ... ." , They believe that an integration of medical and ... and well. Because of this, they encourage regular cleanings and ... dentist . , “Children and adults will find ...
(Date:7/26/2014)... OH (PRWEB) July 26, 2014 The U.S. ... guidelines list that includes a new medication guide for AndroGel ... a serious side-effect of taking the topical low testosterone medication, ... that AbbVie Inc., the makers of the low testosterone theapy ... symptoms of pain, swelling or redness as signs of a ...
Breaking Medicine News(10 mins):Health News:Europe Security and Surveillance Radar Market is Expected to Reach $1800 million in 2019 - New Report by MicroMarket Monitor 2Health News:Europe Security and Surveillance Radar Market is Expected to Reach $1800 million in 2019 - New Report by MicroMarket Monitor 3Health News:Europe Security and Surveillance Radar Market is Expected to Reach $1800 million in 2019 - New Report by MicroMarket Monitor 4Health News:Europe Security and Surveillance Radar Market is Expected to Reach $1800 million in 2019 - New Report by MicroMarket Monitor 5Health News:High Quality Wholesale Party Dresses Online at iFitDress.com 2Health News:Amerec Finds Bathroom Design Trends Change Based on Water Consumption and Other Factors 2Health News:Common Dental Care Questions Answered by Community Health Center of Snohomish County in Recent Article 2Health News:FDA Updates AndroGel Risks to Include Blood Clots In Legs and Lungs as Testosterone Treatment Lawsuits Move Forward 2Health News:FDA Updates AndroGel Risks to Include Blood Clots In Legs and Lungs as Testosterone Treatment Lawsuits Move Forward 3Health News:FDA Updates AndroGel Risks to Include Blood Clots In Legs and Lungs as Testosterone Treatment Lawsuits Move Forward 4Health News:FDA Updates AndroGel Risks to Include Blood Clots In Legs and Lungs as Testosterone Treatment Lawsuits Move Forward 5
(Date:7/25/2014)... the age girls reach puberty is influenced by ,imprinted genes,a ... contributes the gene. This is the first evidence that ... and details of this study were published today in the ... known as menarche, is a marker for the timing of ... of menses varies between girls, is an inherited trait, and ...
(Date:7/25/2014)... CORAL SPRINGS, Florida , July 25, 2014 /PRNewswire/ ... influential as more consumers are turning to digital technology ... NXT-ID, Inc. (OTCBB: NXTD), Google Inc. (NASDAQ: ... Visa Inc. (NYSE: V ), Apple Inc. ... FTNT) NXT-ID, Inc., (OTCQB: NXTD) a biometric ...
(Date:7/24/2014)... July 24, 2014 /PRNewswire-iReach/ -- The Geneva Healthcare Suite, ... devices, has cut emergency room wait times by an ... (UCSD) Medical Center, according to a recent study published ... Departments are using the suite to access data from ... defibrillators. "Using Geneva,s technology platform we have ...
Breaking Biology News(10 mins):Could age of first period influence development of diseases in older women? 2Consumer Needs for Identity Theft Security Grows with Popularity of Latest Smart Technology Products - Biometrically Secure Digital Wallet to Replace Credit Card Dependency 2Consumer Needs for Identity Theft Security Grows with Popularity of Latest Smart Technology Products - Biometrically Secure Digital Wallet to Replace Credit Card Dependency 3Consumer Needs for Identity Theft Security Grows with Popularity of Latest Smart Technology Products - Biometrically Secure Digital Wallet to Replace Credit Card Dependency 4Consumer Needs for Identity Theft Security Grows with Popularity of Latest Smart Technology Products - Biometrically Secure Digital Wallet to Replace Credit Card Dependency 5Consumer Needs for Identity Theft Security Grows with Popularity of Latest Smart Technology Products - Biometrically Secure Digital Wallet to Replace Credit Card Dependency 6UC San Diego Medical Center Cuts Average ER Wait Time by 92 Minutes using the Geneva Healthcare Suite 2UC San Diego Medical Center Cuts Average ER Wait Time by 92 Minutes using the Geneva Healthcare Suite 3
Other Contents