Genes May Boost Harm to Kids From Secondhand Smoke
... and susceptibility to environmental insults," she said. "We looked at a class of genes known to be involved in antioxidant defense, the glutathione-s transferase (GST) genes. Overall, we found that variation in several of the GST genes was important. This was particularly true for children of mothers who had sm...In just 5 years, gene discovery to clinical trial of potential treatment
...t pinpointed HGPS' genetic mutation in 2003. Just two years later, NHGRI scientists identified the class of experimental cancer drugs, called farnesyl transferase inhibitors (FTIs), that can prevent the cell damage caused by the gene mutation and thus might provide an effective therapy against the disease; o ...ASPB announces Summer Undergraduate Research Fellowship 2007 recipients
...cium on the Growth of Various Mutant Plants Mentor: Dr. Catherine Chan Tazley Hotz, East Tennessee State University Project: Salicylic acid-methyl transferase required for plant innate immunity Mentor: Dr. Dhirendra Kumar Janelle Johnson, San Francisco State University Project: WAKL4 Cis-Acting Elements ...Scientists discover way to block growth of prostate cancer cells
...e Comprehensive Cancer Center, Madison, WI, USA. He and his collaborators at the centre found that levels of a key enzyme, spermidine/spermine acetyl transferase (SSAT), which starts oxidation of polyamines, rose markedly when prostate cancer cells were treated with androgen. Polyamines are small molecules pro...A new molecule discovered in the battle between plants and disease
...gnaling pathway. Constitutively overexpressing the proAtPep1 gene in Arabidopsis induced a constitutive activation of PDF1.2, PR-1, and tyrosine amino transferase (TAT3) genes, but not the expression of LOX2 or VSP2 genes. The transgenic plants were more resistant toward the oomycete root pathogen Pythium irregu...VIA Pharmaceuticals' DGAT1 Inhibitors Featured in American Diabetes Association Poster Presentation
...velopment of compounds for the treatment of cardiovascular and metabolic disease, announced today that preclinical data related to diacylglycerol acyl transferase - 1 (DGAT1) inhibitors will be presented in a poster presentation at the 69th Scientific Sessions of the American Diabetes Association June 6, 2009 in...Transgenic Zebrafish by Electroporation
... 79 , 6777-6781, 1982). This plasmid uses the Rous sarcoma virus (RSV) promoter to effectively drive expression of chloramphenicol acetyl transferase (CAT) in numerous eukaryotic cell types. Methods Fish Maintenance and Egg Collection Zebraf...In Situ Cell Death Detection Kit
...duces strand breaks ("nicks") into the high-molecular-weight DNA. These processes can be identified by labeling the free 3-OH termini with terminal transferase (TdT), which attaches labeled nucleotides to all 3OH-ends (TUNEL reaction; TdT-mediated dUTP nick end labeling). This labeling is more sensitive...Housekeeping Genes: Universal Positive Controls in siRNA Knockdown Experiments
.... Results siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cel...High-Fidelity PCR with a Novel Polymerase Mixture
... date. Pfu DNA polymerase also lacks terminal transferase activity and produces only blunt-ended ...annot be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures 2...annot be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures 2...Brilliant Core Reagent Kits for QPCR and QRT-PCR
...sed the sensitivity of the Brilliant two-step QRT-PCR kit to detect a low-abundance target by amplifying and detecting hypoxanthine phosphoribosyl transferase (HPRT) mRNA from human brain total RNA. For the real-time analysis of the RT-PCR amplification, we used the primers and linear hydrolysis probe fr...Mouse Anti-Human gamma Glutamyl Transferase (gammaGT) Monoclonal Antibody, Unconjugated from AnaSpec
Description: Anti-gamma Glutamyl Transferase (gammaGT) Host: mouse monoclonal Species Reactivity: human Applications: WB, IP, FC Storage: 4C...Rabbit Anti-Human Glutathione S Transferase alpha Polyclonal Antibody, Unconjugated from Abcam
Description: Rabbit polyclonal to Glutathione S Transferase alpha ( Abpromise for all tested applications). Antigen: Full length protein: Human Glutathione S Transferase alpha. Entrez GeneID: 2938 Swiss Protein ID: P08263...Terminal deoxynucleotidyl transferase (TdT) Immunofluorescence Assay Kit from AbD Serotec
Description: Terminal deoxynucleotidyl transferase (TdT) is an intracellular marker normally present at high levels in cortical thymocytes and minor subpopulation of bone marrow prelymphocytes. Elevated levels of the enzyme and increased numbers of TdT cells are found to be associated with some lymphoblastic le...Flp-In pcDNA5/FRT Complete Kit from Invitrogen
Description:...of the protein of interest. This homogeneous expression is demonstrated in Figure 3. In this experiment the coding sequence for chloramphenicol-acetyl transferase (CAT) was subcloned into pcDNA5/FRT and transfected into Flp-In-293 cells. Western blot analysis of individual hygromycin-resistant clones clearly sho...Flp-In pcDNA5/FRT Core Kit from Invitrogen
Description:...nterest. This homogeneous expression is demonstrated in Figure 3 (click link below). In this experiment the coding sequence for chloramphenicol-acetyl transferase (CAT) was subcloned into pcDNA5/FRT and transfected into Flp-In-293 cells. Western blot analysis of individual hygromycin-resistant clones clearly sho...Flow Cytometry Kit for Apoptosis from Sigma-Aldrich
Description:...ith bromodeoxyuridine triphosphate (Br-dUTP). Br-dUTP is enzymatically attached to the 3-hydroxyl sites of double- or single-stranded DNA by terminal transferase (TdT). Non-apoptotic cells do not incorporate Br-dUTP due to the lack of available 3-hydroxyl sites. BRAND: SIGMA Adequate for: 60 cel...ApoDIRECT DNA Fragmentation Assay Kit from MBL International
Description:...onveniently detecting DNA fragmentation by fluorescence microscopy or flow cytometry. The TUNEL-based detection kit utilizes terminal deoxynucleotidyl transferase (TdT) to catalyze incorporation of fluorescein-12-dUTP at the free 3-hydroxyl ends of the fragmented DNA. The fluorescein-labeled DNA can then be obse...Apo-BrdU Apoptosis Detection Kit from eBioscience
Description:...ers for processing individual steps in the assay; terminal deoxynucleotidyl transferase enzyme (TdT), bromodeoxyuridine triphosphate (Br-dUTP), and fluorescein lab...ne triphosphate nucleotides (Br-dUTP). The enzyme terminal deoxynucleotidyl transferase (TdT) catalyzes a template independent addition of deoxyribonucleoside trip...APO-DIRECT™ Kit from BD Biosciences Pharmingen
Description:...cells for assessing reagent performance; washing, reaction and rinsing buffers for processing individual steps in the assay; terminal deoxynucleotidyl transferase enzyme (TdT); fluorescein labeled deoxyuridine triphosphate (FITC-dUTP) and propidium iodide (PI)/RNase solution for staining total DNA....