Navigation Links
transferase in Medical News

Genes May Boost Harm to Kids From Secondhand Smoke

... and susceptibility to environmental insults," she said. "We looked at a class of genes known to be involved in antioxidant defense, the glutathione-s transferase (GST) genes. Overall, we found that variation in several of the GST genes was important. This was particularly true for children of mothers who had sm...

Targeted Anticancer Drugs - In Vitro Assessment and Non-Invasive Imaging of Patient and Tumor Status Will Determine Clinical and Commercial Success

...ial cell adhesion molecule (EpCam); estrogen receptor-alpha (Er-alpha); eukaryotic translation initiation factor 4E (EIF4E); exonuclease III; farnesyl transferase (FTase); fibroblast growth factor 2 (FGF-2); FGFr; focal adhesion kinase (FAK); folate receptor (FOLr); FOLr1; galectin 3 (GAL3) receptor; gastrin 17 ...
transferase in Biological News

In just 5 years, gene discovery to clinical trial of potential treatment

...t pinpointed HGPS' genetic mutation in 2003. Just two years later, NHGRI scientists identified the class of experimental cancer drugs, called farnesyl transferase inhibitors (FTIs), that can prevent the cell damage caused by the gene mutation and thus might provide an effective therapy against the disease; o ...

HATS off to combat asthma

...leagues Prof Peter Fischer and Prof David Heery will explore histone acetyl transferase (HAT) inhibitors in asthma and COPD. This study will investigate a bank of ...y the balance between two competing groups of enzymes called histone acetyl transferase (HATs) and histone deacetylases (HDACs). In asthma and COPD sufferers the b...

ASPB announces Summer Undergraduate Research Fellowship 2007 recipients

...cium on the Growth of Various Mutant Plants Mentor: Dr. Catherine Chan Tazley Hotz, East Tennessee State University Project: Salicylic acid-methyl transferase required for plant innate immunity Mentor: Dr. Dhirendra Kumar Janelle Johnson, San Francisco State University Project: WAKL4 Cis-Acting Elements ...

Scientists discover way to block growth of prostate cancer cells

...e Comprehensive Cancer Center, Madison, WI, USA. He and his collaborators at the centre found that levels of a key enzyme, spermidine/spermine acetyl transferase (SSAT), which starts oxidation of polyamines, rose markedly when prostate cancer cells were treated with androgen. Polyamines are small molecules pro...

A new molecule discovered in the battle between plants and disease

...gnaling pathway. Constitutively overexpressing the proAtPep1 gene in Arabidopsis induced a constitutive activation of PDF1.2, PR-1, and tyrosine amino transferase (TAT3) genes, but not the expression of LOX2 or VSP2 genes. The transgenic plants were more resistant toward the oomycete root pathogen Pythium irregu...
transferase in Biological Technology

Study Finds Noninvasive Blood Test for Liver Fibrosis May Alleviate Need for Liver Biopsies for Some Patients with Chronic Hepatitis C

... assessments of hyaluronic acid (HA), a biomarker specific to liver fibrosis, with assessments of the nonspecific biomarkers bilirubin, gamma-glutamyl transferase (GGT), alpha2 macroglobulin (A2M), and age and gender. Previous studies of Hepascore in populations in France and Australia have showed it is r...

VIA Pharmaceuticals' DGAT1 Inhibitors Featured in American Diabetes Association Poster Presentation

...velopment of compounds for the treatment of cardiovascular and metabolic disease, announced today that preclinical data related to diacylglycerol acyl transferase - 1 (DGAT1) inhibitors will be presented in a poster presentation at the 69th Scientific Sessions of the American Diabetes Association June 6, 2009 in...

Detection of Morphine and Morphine-Glucuronide in Saliva or Urine with a Rapid and Simple Method Without Derivatization on the Varian 500-MS

...d Discussion The structures of morphine and one of its metabolites are shown in Figure 1. Glucuronidation (catalyzed by uridine-glucuronic transferase or UGTs) is a Phase II metabolism reaction which involves the addition of glucuronic acid from uridine-diphosphoglucuronide to the xenobiotic being me...

Transgenic Zebrafish by Electroporation

... 79 , 6777-6781, 1982). This plasmid uses the Rous sarcoma virus (RSV) promoter to effectively drive expression of chloramphenicol acetyl transferase (CAT) in numerous eukaryotic cell types. Methods Fish Maintenance and Egg Collection Zebraf...

In Situ Cell Death Detection Kit

...duces strand breaks ("nicks") into the high-molecular-weight DNA. These processes can be identified by labeling the free 3-OH termini with terminal transferase (TdT), which attaches labeled nucleotides to all 3OH-ends (TUNEL reaction; TdT-mediated dUTP nick end labeling). This labeling is more sensitive...

Housekeeping Genes: Universal Positive Controls in siRNA Knockdown Experiments

.... Results siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cel...

High-Fidelity PCR with a Novel Polymerase Mixture

... date. Pfu DNA polymerase also lacks terminal transferase activity and produces only blunt-ended ...annot be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures 2...annot be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures 2...

Brilliant Core Reagent Kits for QPCR and QRT-PCR

...sed the sensitivity of the Brilliant two-step QRT-PCR kit to detect a low-abundance target by amplifying and detecting hypoxanthine phosphoribosyl transferase (HPRT) mRNA from human brain total RNA. For the real-time analysis of the RT-PCR amplification, we used the primers and linear hydrolysis probe fr...
transferase in Biological Products

Mouse Anti-Human gamma Glutamyl Transferase (gammaGT) Monoclonal Antibody, Unconjugated from AnaSpec

Description: Anti-gamma Glutamyl Transferase (gammaGT) Host: mouse monoclonal Species Reactivity: human Applications: WB, IP, FC Storage: 4C...
Company:AnaSpec

Rabbit Anti-Human Glutathione S Transferase alpha Polyclonal Antibody, Unconjugated from Abcam

Description: Rabbit polyclonal to Glutathione S Transferase alpha ( Abpromise for all tested applications). Antigen: Full length protein: Human Glutathione S Transferase alpha. Entrez GeneID: 2938 Swiss Protein ID: P08263...
Company:Abcam

Terminal deoxynucleotidyl transferase (TdT) Immunofluorescence Assay Kit from AbD Serotec

Description: Terminal deoxynucleotidyl transferase (TdT) is an intracellular marker normally present at high levels in cortical thymocytes and minor subpopulation of bone marrow prelymphocytes. Elevated levels of the enzyme and increased numbers of TdT cells are found to be associated with some lymphoblastic le...
Company:AbD Serotec

Flp-In pcDNA5/FRT Complete Kit from Invitrogen

Description:...of the protein of interest. This homogeneous expression is demonstrated in Figure 3. In this experiment the coding sequence for chloramphenicol-acetyl transferase (CAT) was subcloned into pcDNA5/FRT and transfected into Flp-In-293 cells. Western blot analysis of individual hygromycin-resistant clones clearly sho...
Company:Invitrogen

Flp-In pcDNA5/FRT Core Kit from Invitrogen

Description:...nterest. This homogeneous expression is demonstrated in Figure 3 (click link below). In this experiment the coding sequence for chloramphenicol-acetyl transferase (CAT) was subcloned into pcDNA5/FRT and transfected into Flp-In-293 cells. Western blot analysis of individual hygromycin-resistant clones clearly sho...
Company:Invitrogen

Anisomycin from Sigma-Aldrich

Description:... Antibiotic isolated fromStreptomyces griseolusthat inhibits protein synthesis. Acts by inhibiting peptidyl transferase activity in eukaryote ribosomes. Reported to induce apoptosis in a variety of cells including promyelocytic leukemia cells, Jurkat cells, ventricular ...
Company:Sigma-Aldrich

Flow Cytometry Kit for Apoptosis from Sigma-Aldrich

Description:...ith bromodeoxyuridine triphosphate (Br-dUTP). Br-dUTP is enzymatically attached to the 3-hydroxyl sites of double- or single-stranded DNA by terminal transferase (TdT). Non-apoptotic cells do not incorporate Br-dUTP due to the lack of available 3-hydroxyl sites. BRAND: SIGMA Adequate for: 60 cel...
Company:Sigma-Aldrich

ApoDIRECT DNA Fragmentation Assay Kit from MBL International

Description:...onveniently detecting DNA fragmentation by fluorescence microscopy or flow cytometry. The TUNEL-based detection kit utilizes terminal deoxynucleotidyl transferase (TdT) to catalyze incorporation of fluorescein-12-dUTP at the free 3-hydroxyl ends of the fragmented DNA. The fluorescein-labeled DNA can then be obse...
Company:MBL International

Apo-BrdU Apoptosis Detection Kit from eBioscience

Description:...ers for processing individual steps in the assay; terminal deoxynucleotidyl transferase enzyme (TdT), bromodeoxyuridine triphosphate (Br-dUTP), and fluorescein lab...ne triphosphate nucleotides (Br-dUTP). The enzyme terminal deoxynucleotidyl transferase (TdT) catalyzes a template independent addition of deoxyribonucleoside trip...
Company:eBioscience

APO-DIRECT™ Kit from BD Biosciences Pharmingen

Description:...cells for assessing reagent performance; washing, reaction and rinsing buffers for processing individual steps in the assay; terminal deoxynucleotidyl transferase enzyme (TdT); fluorescein labeled deoxyuridine triphosphate (FITC-dUTP) and propidium iodide (PI)/RNase solution for staining total DNA....
Company:BD Biosciences Pharmingen

More>>

transferase in Biological Dictionary

Peptidyl transferase

The Peptidyl transferase is an aminoacyltransferase (EC 2.3.2.12) as well as the primary enzymatic function of the ribosome which forms peptide links between adjacent amino acids using tRNAs during the translation process of protein biosynthesis. Aspects of the topic peptidyl - tran...

Telomere

...observed for eukaryotic ... ... on why this elongation is necessary see Telomere shortening. ... Identification of a specific telomere terminal transferase activity in Tetrahymena extracts" ... Telomere length and progression of diabetic nephropathy in patients with type 1 diabetes. ... Telomere dy...

Deoxyribonucleotide

...ibonucleotide Transferase-Mediated dUTP ... Terminal deoxyribonucleotide transferase (TdT)-mediated dUTP nick end labeling ... deoxyribonucleotide explan...l can ... Processes and reagent kits employing terminal deoxynucleotide transferase are provided for terminally chemically ... labeled deoxyribonucleotide in...

Cloning vector

... is called "molecular cloning ", because multiple copies of ... TA Cloning Technology: TA cloning is brought about by the terminal transferase activity of certain type of DNA polymerase such as the Taq polymerase ... and cancer research tools: multigenic vectors , plasmid vectors ,...

CAT assay

...... A direct assay for chloramphenicol acetyl transferase ( CAT ) has been presented ... Promega, " CAT Enz...AT assay . CAT assay . Chloramphenicol Acetyl transferase ( CAT ) is a bacterial enzyme which inactivates ...ids, and ... Assay for chloramphenicol acetyl transferase in amoebal lysates ... Spot solution onto a 20x20c...
Other Tags
(Date:8/21/2014)... 21, 2014 The Rottenstein Law Group ... 25 years of experience advocating for plaintiffs with claims ... medical devices, announces the launch of its new website, ... who believe they have been harmed by prescription drugs ... about the severe adverse side effects suffered by women ...
(Date:8/21/2014)... TX (PRWEB) August 21, 2014 Sometimes you have ... , In his new book “From Zero to a Hundred: Finding ... officer, shares his story of surviving a broken family, a childhood ... brings affirmation of who you were created to be,” Roy said. ... which is why I know my purpose today of helping others ...
(Date:8/21/2014)... Teen substance abuse is long been a ... rising numbers of young adults falling victim to a drug ... difference in the community, the new Troubled Teens Boca Raton ... seeking to overcome something like teenage alcohol abuse . ... find the best teen recovery facility to focus on achieving ...
(Date:8/21/2014)... 2014 CQIIP, Continuous Quality Immunization ... Disease Control and Prevention and the Department of ... with the immunization standards and are administered in ... Recommendations on Immunizations. , ACC chose to adopt ... in place to protect patients, improve efficiency, and ...
(Date:8/21/2014)... Phoenix, AZ (PRWEB) August 21, 2014 ... Foundation have donated $10,000 to support ovarian cancer research, ... , Cundiff, who is also the kicker for the ... Kicking Cancer Event was matched by Colleen’s Dream Foundation ... Goodheart, MD, an Assistant Professor in the Division of ...
Breaking Medicine News(10 mins):Health News:Rottenstein Law Group LLP Announces Launch of WeHelpWomen.com 2Health News:Zero to a Hundred: True Story of Escaping Death to Meet Life 2Health News:New Helpline Provides Hope for Troubled Teens in Boca Raton 2Health News:ACC Health Raises the Bar Again by Completing the CQIIP Certification Program 2Health News:Drake University’s Phi Gamma Delta (FIJI) and Colleen’s Dream Foundation Donate $10,000 to the University of Iowa’s Holden Cancer Center to Fight Ovarian Cancer 2Health News:Drake University’s Phi Gamma Delta (FIJI) and Colleen’s Dream Foundation Donate $10,000 to the University of Iowa’s Holden Cancer Center to Fight Ovarian Cancer 3
(Date:8/19/2014)... engineers have devised a new implantable tissue scaffold coated ... a few weeks. When applied to bone injuries or ... form new bone that looks and behaves just like ... could offer a dramatic improvement over the current standard ... another part of the patient,s body a painful ...
(Date:8/19/2014)... neonatal abstinence syndrome (NAS) secondary to in-utero opioid ... withdrawal than others, but the underlying reasons are ... genes are turned on or off) changes have ... Boston University School of Medicine (BUSM) and Boston ... kind study to identify some of these epigenetic ...
(Date:8/19/2014)... of today,s crocodiles colonised the seas during warm phases ... new Anglo-French study which establishes a link between marine ... a period of more than 140 million years. ... the Universit de Lyon, France and formerly from the ... Nature Communications ., Today, crocodiles are ,cold-blooded, animals ...
Breaking Biology News(10 mins):Engineering new bone growth 2Engineering new bone growth 3In-utero methadone, Subutex exposure could alter gene expression, cause severe Neonatal Abstience Syndrome 2Evolution of marine crocodilians constrained by ocean temperatures 2
Other Contents