Navigation Links
tTG in Medical News

How to confirm the causes of iron deficiency anemia in young women

...t-positive. The serological results were confirmed by gastroscopy in 100% of those with positive H. pylori antibodies, in 50% of those with positive ttg and in 81.5% of test-negative patients. Sensitivity and specificity were 84.8% and 100% for H. pylori infection, and 80% and 92.8% for tTG, respecti...

Tutogen Medical, Inc. to Report First Quarter Fiscal 2008 Financial Results

... ALACHUA, Fla., Jan. 29 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, will report financial resu...
tTG in Medical Technology

Non-Invasive Diagnostic Tests for Celiac Disease

...tions known to be associated with the disease are targeted. Tests for ttg autoantibodies are easier to perform and less subjective and time-consuming...ictive value of anti-gliadin antibody (AGA) testing is not as strong as the ttg autoantibody tests, they still populate reference laboratory menus and are ...
tTG in Medical Products

ImmuLisa Anti-hu tTG IgA ELISA

Description: An enzyme-linked immuno-sorbent assay for the detectionand quantitation of anti-tissue Transglutaminase in serum of patients with Celiac Disease and Dermatitis Herpetiformis....
Company:IMMCO Diagnostics

Anti-Human (Umana) Eu-tTG IgA Assay

Description:... The IgA in vitro diagnostic enzyme immunoassay is intended for the qualitative detection of anti-human ttg IgA antibodies in human serum as an aid in the diagnosis of CD....
Company:Scimedx Corporation

Anti-Human (Umana) Eu-tTG IgG Assay

Description:... The IgG in vitro diagnostic immunoassay is for the determination of anti-human ttg IgG antibodies in serum, and aids in the diagnosis of CD in patients with total serum IgA deficiency....
Company:Scimedx Corporation
tTG in Biological Technology

Tutogen Medical, Inc. Reports First Quarter Fiscal 2008 Financial Results

... ALACHUA, Fla., Feb. 6 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, today announced financial ...

Tutogen Medical, Inc. Reports Year-End Fiscal 2007 Financial Results

... ALACHUA, Fla., Dec. 10 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, today announced financial ...

Tutogen Medical, Inc. to Report Fourth Quarter and Fiscal Year 2007 Financial Results

... ALACHUA, Fla., Dec. 7 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, will report financial resu...

Tutogen Medical, Inc. and Zimmer Holdings, Inc. Announce Agreement for International Distribution of Biological Products

... ALACHUA, Fla. and WARSAW, Ind., Sept. 4 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, and Zimmer Holdings, Inc. ...

Tutogen Medical, Inc. to Present at the Roth Capital Partners 2007 New York Conference

... ALACHUA, Fla., Aug. 29 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, announced today that Guy L...

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

...tions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germ...

Using the TripleMaster PCR System for Robust Amplification of GC-Rich DNA Templates

...CT GAG 3' Human melanocortin-1 receptor gene (MC1R) 760 bp 63% 5' CTG GTG AGC ttg GTG GAG A 3' 5' GGC TGT GGA AGG CGT AGA T 3' Table 2: Fi...
Other Tags
(Date:7/12/2014)... As reported in this July 1st article ... the June 25th, 2014 Supreme Court ruling in Riley v ... It was also met with both cheers and jeers when ... seen from an individual privacy perspective, or a law enforcement ... now precedent which will require law enforcement officials to obtain ...
(Date:7/12/2014)... July 12, 2014 Praeclarus Press ... Simple as a valuable new resource for women in ... of American women work away from their children. Today’s ... the benefits of breastfeeding, but often feel unsupported when ... their babies. With its evidence-based insights, and written by ...
(Date:7/12/2014)... Palm Beach, FL (PRWEB) July 12, 2014 ... variety of high-quality peptides that are used solely in ... To honor two successful years in business, Maxim Peptide, ... LLC, has just launched a new and updated website ... the research blog section has been updated with fascinating ...
(Date:7/11/2014)... 2014 Recently, DressyQuinceanera.com, a well-known wedding ... Dama dresses to its online category. Furthermore, the ... at deeply discounted rates, up to 62% off. , ... equally excellent in terms of quality and style. All ... discounts are also offered for the company’s other items: ...
(Date:7/11/2014)... (PRWEB) July 11, 2014 As ... filed against Johnson & Johnson’s Ethicon Inc. unit ... LLP notes that the Texas Attorney General’s Office ... marketing of surgical mesh products used to treat ... to a report from kens5.com, the probe began ...
Breaking Medicine News(10 mins):Health News:Mobile Device Forensics Guidelines Play Key Role in Supreme Court’s Smartphone Evidence Warrant Decision 2Health News:Mobile Device Forensics Guidelines Play Key Role in Supreme Court’s Smartphone Evidence Warrant Decision 3Health News:Mobile Device Forensics Guidelines Play Key Role in Supreme Court’s Smartphone Evidence Warrant Decision 4Health News:Mobile Device Forensics Guidelines Play Key Role in Supreme Court’s Smartphone Evidence Warrant Decision 5Health News:Praeclarus Press Announces the Release of Working and Breastfeeding Made Simple by Nancy Mohrbacher, A Much Needed Resource For Today's Working Mothers 2Health News:Maxim Peptide Celebrates Second Anniversary Online with an Updated Website and Special Deals Section 2Health News:DressyQuinceanera.com: Beautiful Quinceanera Dama Dresses At Low Prices 2Health News:Transvaginal Mesh Lawsuit News: Bernstein Liebhard LLP Notes Report of Texas Probe into Ethicon Pelvic Mesh Marketing 2Health News:Transvaginal Mesh Lawsuit News: Bernstein Liebhard LLP Notes Report of Texas Probe into Ethicon Pelvic Mesh Marketing 3Health News:Transvaginal Mesh Lawsuit News: Bernstein Liebhard LLP Notes Report of Texas Probe into Ethicon Pelvic Mesh Marketing 4
(Date:7/10/2014)... , July 3, 2014 Research ... addition of the "Global Gesture Recognition & ... - Forecasts to 2020" report to their ... Global Gesture Recognition & Touch-Less Sensing Market ... around for a while, but the companies were ...
(Date:7/10/2014)... New York , July 7, 2014 ... by Transparency Market Research "Electronic Access Control Systems Market ... 2014 - 2019," the global Electronic Access Control systems ... and is expected to grow at a CAGR of ... value of USD 31,187.8 million in 2019. ...
(Date:7/10/2014)... -- Acuity Market Intelligence today released forecasts from "The Global ... global market for National Electronic ID (eID) programs will generate ... time, the number of National eID cards in circulation will ... , with its vast population, will dominate the market ... Europe trails a distant second at ...
Breaking Biology News(10 mins):Global Gesture Recognition & Touch-Less Sensing (2D, 3D, Ultrasonic, IR, Capacitive) Market - Forecasts to 2020 2Electronic Access Control Systems Market is Expected to Reach USD 31.2 Billion Globally in 2019: Transparency Market Research 2Electronic Access Control Systems Market is Expected to Reach USD 31.2 Billion Globally in 2019: Transparency Market Research 3Electronic Access Control Systems Market is Expected to Reach USD 31.2 Billion Globally in 2019: Transparency Market Research 4Electronic Access Control Systems Market is Expected to Reach USD 31.2 Billion Globally in 2019: Transparency Market Research 5National Electronic ID Programs Generate $54 Billion Between 2013 and 2018 with 3.5 Billion National eID Card Holders Worldwide 2
Other Contents