Navigation Links
tTG in Medical News

How to confirm the causes of iron deficiency anemia in young women

...t-positive. The serological results were confirmed by gastroscopy in 100% of those with positive H. pylori antibodies, in 50% of those with positive ttg and in 81.5% of test-negative patients. Sensitivity and specificity were 84.8% and 100% for H. pylori infection, and 80% and 92.8% for tTG, respecti...

Tutogen Medical, Inc. to Report First Quarter Fiscal 2008 Financial Results

... ALACHUA, Fla., Jan. 29 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, will report financial resu...
tTG in Medical Technology

Non-Invasive Diagnostic Tests for Celiac Disease

...tions known to be associated with the disease are targeted. Tests for ttg autoantibodies are easier to perform and less subjective and time-consuming...ictive value of anti-gliadin antibody (AGA) testing is not as strong as the ttg autoantibody tests, they still populate reference laboratory menus and are ...
tTG in Medical Products

ImmuLisa Anti-hu tTG IgA ELISA

Description: An enzyme-linked immuno-sorbent assay for the detectionand quantitation of anti-tissue Transglutaminase in serum of patients with Celiac Disease and Dermatitis Herpetiformis....
Company:IMMCO Diagnostics

Anti-Human (Umana) Eu-tTG IgA Assay

Description:... The IgA in vitro diagnostic enzyme immunoassay is intended for the qualitative detection of anti-human ttg IgA antibodies in human serum as an aid in the diagnosis of CD....
Company:Scimedx Corporation

Anti-Human (Umana) Eu-tTG IgG Assay

Description:... The IgG in vitro diagnostic immunoassay is for the determination of anti-human ttg IgG antibodies in serum, and aids in the diagnosis of CD in patients with total serum IgA deficiency....
Company:Scimedx Corporation
tTG in Biological Technology

Tutogen Medical, Inc. Reports First Quarter Fiscal 2008 Financial Results

... ALACHUA, Fla., Feb. 6 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, today announced financial ...

Tutogen Medical, Inc. Reports Year-End Fiscal 2007 Financial Results

... ALACHUA, Fla., Dec. 10 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, today announced financial ...

Tutogen Medical, Inc. to Report Fourth Quarter and Fiscal Year 2007 Financial Results

... ALACHUA, Fla., Dec. 7 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, will report financial resu...

Tutogen Medical, Inc. and Zimmer Holdings, Inc. Announce Agreement for International Distribution of Biological Products

... ALACHUA, Fla. and WARSAW, Ind., Sept. 4 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, and Zimmer Holdings, Inc. ...

Tutogen Medical, Inc. to Present at the Roth Capital Partners 2007 New York Conference

... ALACHUA, Fla., Aug. 29 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, announced today that Guy L...

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

...tions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germ...

Using the TripleMaster PCR System for Robust Amplification of GC-Rich DNA Templates

...CT GAG 3' Human melanocortin-1 receptor gene (MC1R) 760 bp 63% 5' CTG GTG AGC ttg GTG GAG A 3' 5' GGC TGT GGA AGG CGT AGA T 3' Table 2: Fi...
Other Tags
(Date:7/24/2014)... appears to increase the risk for head and neck cancer ... with DM, but the risk of HNC in patients with ... cancer is the sixth most common type of cancer. It ... an estimated 650,000 new cancer cases and 350,000 cancer deaths ... Insurance Research Database to examine the risk of HNC in ...
(Date:7/24/2014)... This year the Walk to End Alzheimer’s ... National Life, will be held on Saturday, September 20 in ... Fun Run at 7:50 am, the untimed 5k Run at ... “The Walk to End Alzheimer’s unites the entire community in ... against this devastating disease, “stated Linda Mitchell, CEO and president ...
(Date:7/24/2014)... two or more equally positive outcomes experience paradoxical ... activity in different regions of the brain, according ... research scholar at the Princeton Neuroscience Institute at ... people rated the desirability of more than 300 ... at images of paired products with different or ...
(Date:7/24/2014)... 24, 2014 Memantine was initially developed by ... in Germany under the brand name Akatinol; it was later ... Ebixa and in the USA to Forest Labs as Namenda. ... in 2013. In the US, Forest reported Namenda sales of ... in Canada, Australia and the European region has increased the ...
(Date:7/24/2014)... scientists at Carnegie Mellon University, working with high-throughput ... Berkeley National Laboratory, have devised a computational method ... normal breast cells turn malignant and as they ... for analyzing how genes interact with each other ... published today by the online journal PLOS ...
Breaking Medicine News(10 mins):Health News:Alzheimer's Association Walk to End Alzheimer's Steps Off Saturday, September 20 in Denver 2Health News:Alzheimer's Association Walk to End Alzheimer's Steps Off Saturday, September 20 in Denver 3Health News:Brain's dynamic duel underlies win-win choices 2Health News:Brain's dynamic duel underlies win-win choices 3Health News:Memantine Discussed in New Comprehensive Patent Search Report by Ark Patent Intelligence Published at MarketPublishers.com 2Health News:Memantine Discussed in New Comprehensive Patent Search Report by Ark Patent Intelligence Published at MarketPublishers.com 3Health News:Gene changes in breast cancer cells pinpointed with new computational method 2Health News:Gene changes in breast cancer cells pinpointed with new computational method 3
(Date:7/24/2014)... reduce fire hazard in the United States, wildland managers ... shrubs and suppressed trees (ladder fuels). These cuttings ... of low fire danger in order to dispose of ... air pollutants, managers often cover all or part of ... to as agricultural plastic, in order to keep water ...
(Date:7/24/2014)... primordial soup in which life arose have been maintained in ... East Anglia. , Research published today in the Journal ... and very likely also in animals still perform ancient reactions ... some four billion years ago. , The primordial soup ... as a result of the combination of metals, gases from ...
(Date:7/24/2014)... his work with a new drug that successfully treated lupus ... has received a $250,000 grant to expand his research to ... treat a wider range of autoimmune diseases., Chandra Mohan, Hugh ... at UH, previously published a study in Arthritis Research & ... treated lupus in mice and reduced the number of cases ...
Breaking Biology News(10 mins):Study gives new perspective on agricultural plastic, debris burning, and air quality 2Biomedical engineer looks at new applications for novel lupus drug 2Biomedical engineer looks at new applications for novel lupus drug 3
Other Contents