Navigation Links
tTG in Medical News

How to confirm the causes of iron deficiency anemia in young women

...t-positive. The serological results were confirmed by gastroscopy in 100% of those with positive H. pylori antibodies, in 50% of those with positive ttg and in 81.5% of test-negative patients. Sensitivity and specificity were 84.8% and 100% for H. pylori infection, and 80% and 92.8% for tTG, respecti...

Tutogen Medical, Inc. to Report First Quarter Fiscal 2008 Financial Results

... ALACHUA, Fla., Jan. 29 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, will report financial resu...
tTG in Medical Technology

Non-Invasive Diagnostic Tests for Celiac Disease

...tions known to be associated with the disease are targeted. Tests for ttg autoantibodies are easier to perform and less subjective and time-consuming...ictive value of anti-gliadin antibody (AGA) testing is not as strong as the ttg autoantibody tests, they still populate reference laboratory menus and are ...
tTG in Medical Products

ImmuLisa Anti-hu tTG IgA ELISA

Description: An enzyme-linked immuno-sorbent assay for the detectionand quantitation of anti-tissue Transglutaminase in serum of patients with Celiac Disease and Dermatitis Herpetiformis....
Company:IMMCO Diagnostics

Anti-Human (Umana) Eu-tTG IgA Assay

Description:... The IgA in vitro diagnostic enzyme immunoassay is intended for the qualitative detection of anti-human ttg IgA antibodies in human serum as an aid in the diagnosis of CD....
Company:Scimedx Corporation

Anti-Human (Umana) Eu-tTG IgG Assay

Description:... The IgG in vitro diagnostic immunoassay is for the determination of anti-human ttg IgG antibodies in serum, and aids in the diagnosis of CD in patients with total serum IgA deficiency....
Company:Scimedx Corporation
tTG in Biological Technology

Tutogen Medical, Inc. Reports First Quarter Fiscal 2008 Financial Results

... ALACHUA, Fla., Feb. 6 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, today announced financial ...

Tutogen Medical, Inc. Reports Year-End Fiscal 2007 Financial Results

... ALACHUA, Fla., Dec. 10 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, today announced financial ...

Tutogen Medical, Inc. to Report Fourth Quarter and Fiscal Year 2007 Financial Results

... ALACHUA, Fla., Dec. 7 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, will report financial resu...

Tutogen Medical, Inc. and Zimmer Holdings, Inc. Announce Agreement for International Distribution of Biological Products

... ALACHUA, Fla. and WARSAW, Ind., Sept. 4 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, and Zimmer Holdings, Inc. ...

Tutogen Medical, Inc. to Present at the Roth Capital Partners 2007 New York Conference

... ALACHUA, Fla., Aug. 29 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, announced today that Guy L...

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

...tions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germ...

Using the TripleMaster PCR System for Robust Amplification of GC-Rich DNA Templates

...CT GAG 3' Human melanocortin-1 receptor gene (MC1R) 760 bp 63% 5' CTG GTG AGC ttg GTG GAG A 3' 5' GGC TGT GGA AGG CGT AGA T 3' Table 2: Fi...
Other Tags
(Date:3/30/2015)... Murfreesboro, TN (PRWEB) March 30, 2015 Good ... in need. The Children’s Home in Murfreesboro provides a Christian-based ... the love of Christ and his special plan for their ... dawn of a new day begins as, one-by-one, the children ... Samantha’s day begins as the alarm continues to buzz. ...
(Date:3/30/2015)... Murfreesboro, TN (PRWEB) March 30, 2015 Dr. ... TN office. , The mini implant is placed into ... to be stabilized is fitted and snapped into place. For ... or talking, mini implants could be the solution. Thousands of ... right in place without any adhesives. It is all made ...
(Date:3/30/2015)... Dr. Jeffrey Allred DDS, with his practice based ... second opinion consultations for patients who need a second ... second opinions show how small percentage of dentistry patients go ... 6%” – says Dr. Allred. , “People should not ... the dental care provider, for the simple fact that every ...
(Date:3/30/2015)... The partners of Urgent Care of Westchester and ... Bella Diosa Laser Med Spa, offering the residents of ... spa treatments. , February marked the grand opening of ... the medical services provided by Urgent Care of Westchester ... for both women and men. , Conveniently located in ...
(Date:3/30/2015)... The fertility team at Ada ... asked questions to give intended parents across the globe ... , After unveiling the most affordable, non-sharing ... IVF clinic has witnessed an increase in fertility patients. ... provides attentive reproductive care — with all-inclusive IVF treatment ...
Breaking Medicine News(10 mins):Health News:Good Shepherd Children’s Home Announces 53rd Year of Providing a Safe-Haven for Children in Need 2Health News:Dr. Jeffrey Farmer A Murfreesboro Dentist Announces New High Tech Dentistry 2Health News:Allred Dental Offers Complimentary 15 Minute Consults with Dr. Jeffrey Allred in San Marcos, CA 2Health News:Yonkers Celebrates the Grand Opening of Bella Diosa 2Health News:Top Fertility Clinic in Cyprus Answers Key Questions on Egg Donation Process 2Health News:Top Fertility Clinic in Cyprus Answers Key Questions on Egg Donation Process 3Health News:Top Fertility Clinic in Cyprus Answers Key Questions on Egg Donation Process 4
(Date:3/12/2015)... , March 12, 2015 WHEN:Tuesday, March ... Registration here: http://bit.ly/1G7Os0L . SPEAKERS: , Frost ... SeshagiriPhoto - http://photos.prnewswire.com/prnh/20150311/181111 Biometric ... to compete in several different markets and industries. ... currently witnessing an uptrend. Join ...
(Date:3/10/2015)... Colo. , March 10, 2015 ... Flight "Personalized Medicine in Human Space ... and Thomas J. Goodwin , Ph.D. was recently ... of the past two years. Specifically, "Personalized ... most downloaded scientific papers published in 2013 and 2014 ...
(Date:3/4/2015)... , Mar. 04, 2015 Research and Markets ... addition of the "Global Biometrics Market Forecast ... The market for biometric authentication systems ... around 14% till 2020 The driving ... increasing security needs, government projects and constant development ...
Breaking Biology News(10 mins):Biometrics Key to Future Growth in Healthcare, Retail and Financial Markets 2Biometrics Key to Future Growth in Healthcare, Retail and Financial Markets 3"Personalized Medicine in Human Space Flight" Listed Among Most Influential Papers of 2013 and 2014 2Global Biometrics Market Forecast and Opportunities, 2020 2Global Biometrics Market Forecast and Opportunities, 2020 3
Other Contents