Navigation Links
tTG in Medical News

How to confirm the causes of iron deficiency anemia in young women

...t-positive. The serological results were confirmed by gastroscopy in 100% of those with positive H. pylori antibodies, in 50% of those with positive ttg and in 81.5% of test-negative patients. Sensitivity and specificity were 84.8% and 100% for H. pylori infection, and 80% and 92.8% for tTG, respecti...

Tutogen Medical, Inc. to Report First Quarter Fiscal 2008 Financial Results

... ALACHUA, Fla., Jan. 29 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, will report financial resu...
tTG in Medical Technology

Non-Invasive Diagnostic Tests for Celiac Disease

...tions known to be associated with the disease are targeted. Tests for ttg autoantibodies are easier to perform and less subjective and time-consuming...ictive value of anti-gliadin antibody (AGA) testing is not as strong as the ttg autoantibody tests, they still populate reference laboratory menus and are ...
tTG in Medical Products

ImmuLisa Anti-hu tTG IgA ELISA

Description: An enzyme-linked immuno-sorbent assay for the detectionand quantitation of anti-tissue Transglutaminase in serum of patients with Celiac Disease and Dermatitis Herpetiformis....
Company:IMMCO Diagnostics

Anti-Human (Umana) Eu-tTG IgA Assay

Description:... The IgA in vitro diagnostic enzyme immunoassay is intended for the qualitative detection of anti-human ttg IgA antibodies in human serum as an aid in the diagnosis of CD....
Company:Scimedx Corporation

Anti-Human (Umana) Eu-tTG IgG Assay

Description:... The IgG in vitro diagnostic immunoassay is for the determination of anti-human ttg IgG antibodies in serum, and aids in the diagnosis of CD in patients with total serum IgA deficiency....
Company:Scimedx Corporation
tTG in Biological Technology

Tutogen Medical, Inc. Reports First Quarter Fiscal 2008 Financial Results

... ALACHUA, Fla., Feb. 6 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, today announced financial ...

Tutogen Medical, Inc. Reports Year-End Fiscal 2007 Financial Results

... ALACHUA, Fla., Dec. 10 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, today announced financial ...

Tutogen Medical, Inc. to Report Fourth Quarter and Fiscal Year 2007 Financial Results

... ALACHUA, Fla., Dec. 7 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, will report financial resu...

Tutogen Medical, Inc. and Zimmer Holdings, Inc. Announce Agreement for International Distribution of Biological Products

... ALACHUA, Fla. and WARSAW, Ind., Sept. 4 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, and Zimmer Holdings, Inc. ...

Tutogen Medical, Inc. to Present at the Roth Capital Partners 2007 New York Conference

... ALACHUA, Fla., Aug. 29 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, announced today that Guy L...

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

...tions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germ...

Using the TripleMaster PCR System for Robust Amplification of GC-Rich DNA Templates

...CT GAG 3' Human melanocortin-1 receptor gene (MC1R) 760 bp 63% 5' CTG GTG AGC ttg GTG GAG A 3' 5' GGC TGT GGA AGG CGT AGA T 3' Table 2: Fi...
Other Tags
(Date:10/22/2014)... Grants Pass, OR (PRWEB) October 22, 2014 ... while Southern California’s fresh water supply runs dangerously low, ... climate change. Southern Oregon’s rivers, despite the lowest mountain ... fast even in late summer and early autumn.* That ... Urness, authors of the new book “Hiking Southern Oregon,” ...
(Date:10/22/2014)... Healthcare professionals who are looking for ... home or on-the-go via laptops, tablets or mobile ... premium Seminar-on-Demand CE courses. The new courses add ... hours of CE course offerings, allowing therapy ... such a diverse library, there’s something for everyone. ...
(Date:10/22/2014)... Although there are only 24 hours in a day, that ... trouble finding time within their busy schedules for exercise and fitness. ... time to get in shape. Here are five ways you can ... , Change Up Your Commute , Consider riding a bike or ... into your daily routine. If you must use your car to ...
(Date:10/22/2014)... Prussia, PA (PRWEB) October 22, 2014 ... recognized as an industry leader with over 25 years ... winning team leader in the areas related to EDI, ... Mr. Carlson is an Editorial Advisory Board member for ... Council Educator. Blue Fin Group is a management ...
(Date:10/22/2014)... By Steven Reinberg ... -- Infants who quickly add weight and length may be ... study suggests. In adults, certain genes have been linked ... promote proportionate gains in fat and lean muscle, the researchers ... be heavier and taller. By ages 2 and 3, however, ...
Breaking Medicine News(10 mins):Health News:Southern Oregon Is West’s Most Drought Proof Fresh Water Region Say Hiking Guide Authors 2Health News:Southern Oregon Is West’s Most Drought Proof Fresh Water Region Say Hiking Guide Authors 3Health News:Southern Oregon Is West’s Most Drought Proof Fresh Water Region Say Hiking Guide Authors 4Health News:Top Provider of Continuing Education at Home Releases 20 New Online Courses 2Health News:HealthGuideMD Presents Ways to Improve Your Exercise and Fitness 2Health News:Rich Carlson and Marc Duey to Hold Workshop at CBI’s Specialty Pharmacy and Distribution Networks Conference 2Health News:Tall, Heavy 1-Year-Olds May Be at Risk for Obesity Later, Study Finds 2
(Date:10/17/2014)... release is available in German . ... a very few drugs. When treating overdoses, doctors are often ... especially difficult if there is a combination of drugs involved. ... and accidentally swallows his grandmother,s pills? ETH professor Jean-Christophe Leroux ... to find an answer to this question. "The task was ...
(Date:10/16/2014)... Virginia Institute of Marine Science have received a ... to identify the streams and wetlands most vulnerable ... help local governments and citizens conserve these important ... dataset of tidal-marsh observations first gathered by VIMS ... baseline can today,s researchers accurately map the slow ...
(Date:10/16/2014)... thinking on how the bowel lining develops and, in ... cancer starts. , The researchers produced evidence that stem ... that are a feature of the bowel lining, and ... development, a controversial finding as scientists are still divided ... technologies, Dr Chin Wee Tan and Professor Tony Burgess ...
Breaking Biology News(10 mins):Emergency aid for overdoses 2Emergency aid for overdoses 3EPA grant will help localities conserve headwater wetlands 2EPA grant will help localities conserve headwater wetlands 3Cryptic clues drive new theory of bowel cancer development 2
Other Contents