Navigation Links
tTG in Medical News

How to confirm the causes of iron deficiency anemia in young women

...t-positive. The serological results were confirmed by gastroscopy in 100% of those with positive H. pylori antibodies, in 50% of those with positive ttg and in 81.5% of test-negative patients. Sensitivity and specificity were 84.8% and 100% for H. pylori infection, and 80% and 92.8% for tTG, respecti...

Tutogen Medical, Inc. to Report First Quarter Fiscal 2008 Financial Results

... ALACHUA, Fla., Jan. 29 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, will report financial resu...
tTG in Medical Technology

Non-Invasive Diagnostic Tests for Celiac Disease

...tions known to be associated with the disease are targeted. Tests for ttg autoantibodies are easier to perform and less subjective and time-consuming...ictive value of anti-gliadin antibody (AGA) testing is not as strong as the ttg autoantibody tests, they still populate reference laboratory menus and are ...
tTG in Medical Products

ImmuLisa Anti-hu tTG IgA ELISA

Description: An enzyme-linked immuno-sorbent assay for the detectionand quantitation of anti-tissue Transglutaminase in serum of patients with Celiac Disease and Dermatitis Herpetiformis....
Company:IMMCO Diagnostics

Anti-Human (Umana) Eu-tTG IgA Assay

Description:... The IgA in vitro diagnostic enzyme immunoassay is intended for the qualitative detection of anti-human ttg IgA antibodies in human serum as an aid in the diagnosis of CD....
Company:Scimedx Corporation

Anti-Human (Umana) Eu-tTG IgG Assay

Description:... The IgG in vitro diagnostic immunoassay is for the determination of anti-human ttg IgG antibodies in serum, and aids in the diagnosis of CD in patients with total serum IgA deficiency....
Company:Scimedx Corporation
tTG in Biological Technology

Tutogen Medical, Inc. Reports First Quarter Fiscal 2008 Financial Results

... ALACHUA, Fla., Feb. 6 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, today announced financial ...

Tutogen Medical, Inc. Reports Year-End Fiscal 2007 Financial Results

... ALACHUA, Fla., Dec. 10 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, today announced financial ...

Tutogen Medical, Inc. to Report Fourth Quarter and Fiscal Year 2007 Financial Results

... ALACHUA, Fla., Dec. 7 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, will report financial resu...

Tutogen Medical, Inc. and Zimmer Holdings, Inc. Announce Agreement for International Distribution of Biological Products

... ALACHUA, Fla. and WARSAW, Ind., Sept. 4 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, and Zimmer Holdings, Inc. ...

Tutogen Medical, Inc. to Present at the Roth Capital Partners 2007 New York Conference

... ALACHUA, Fla., Aug. 29 /PRNewswire-FirstCall/ -- Tutogen Medical, Inc. (Amex: ttg ), a leading manufacturer of sterile biological implant products made from human (allograft) and animal (xenograft) tissue, announced today that Guy L...

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

...tions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germ...

Using the TripleMaster PCR System for Robust Amplification of GC-Rich DNA Templates

...CT GAG 3' Human melanocortin-1 receptor gene (MC1R) 760 bp 63% 5' CTG GTG AGC ttg GTG GAG A 3' 5' GGC TGT GGA AGG CGT AGA T 3' Table 2: Fi...
Other Tags
(Date:8/22/2014)... An increasing number of mergers and acquisitions ... market. M&As provide financial assistance to smaller companies, increase ... distribution channels of companies and help in increasing the ... According to the “ Global Animal Health Market 2014-2018 ... diet is one of the major drivers in the ...
(Date:8/22/2014)... August 22, 2014 The international ... Clinics are promoting non-invasive screening, risk assessment and ... of cardiovascular morbidity and mortality, even in asymptomatic ... Vein Thrombosis and Pulmonary Embolus, and Peripheral Vascular ... painless, noninvasive screening at accredited facilities at all ...
(Date:8/22/2014)... On October 10, 2014, Dr. ... present an in-depth workshop on mindfulness and biofeedback ... the one-day workshop, participants will learn how to ... practice. , According to Dr. Khazan, "Biofeedback is ... control their physiological responses. However, extensive research shows ...
(Date:8/22/2014)... FastFingerprints is adding a new location to the ... August 27, 2014 and is located at 3740 Euclid ... addition of this new office, that will bring the ... area. Our new Cleveland-Midtown location will provide live ... of operation will be Monday-Friday 8:00am – 5:00pm with ...
(Date:8/22/2014)... Teen substance abuse has long been a ... numbers of young adults falling victim to a drug or ... a difference in the community, the new Troubled Teens Toledo ... seeking to overcome their chemical dependency. The helpline is designed ... rehab center to focus on achieving sobriety. , By contacting ...
Breaking Medicine News(10 mins):Health News:Global Animal Health Market 2014-2018 a New Research Report Added to ReportsnReports.com 2Health News:Global Animal Health Market 2014-2018 a New Research Report Added to ReportsnReports.com 3Health News:Global Animal Health Market 2014-2018 a New Research Report Added to ReportsnReports.com 4Health News:NY Heart Health Clinics Created by Dr. David Greuner and Dr. David Luu of NYC Surgical Associates 2Health News:NY Heart Health Clinics Created by Dr. David Greuner and Dr. David Luu of NYC Surgical Associates 3Health News:Mindfulness Expert and Author Dr. Inna Khazan to Present One-day Workshop In Montreal on Integrating Mindfulness Based Skills Into a Biofeedback Practice 2Health News:Mindfulness Expert and Author Dr. Inna Khazan to Present One-day Workshop In Montreal on Integrating Mindfulness Based Skills Into a Biofeedback Practice 3Health News:FastFingerprints Expands In The Cleveland Ohio Area 2Health News:FastFingerprints Expands In The Cleveland Ohio Area 3Health News:New Helpline Provides Hope for Troubled Teens in Toledo 2
(Date:8/21/2014)... 2014 , WHERE: , San Diego Convention ... 92101 , WHAT: , Invited and platform ... research in human genetics. Examples of sessions include: ... rare genetic variants in health and disease, the ... sensitivity (Saturday, Oct. 18, 5:30-7:30 pm) , Crowdsourced ...
(Date:8/21/2014)... from North Carolina State University have developed a novel ... model has applications for creating new materials as well ... "Our new technique allows us to model much larger ... much more quickly," says Nan Li, lead author of ... in NC State,s Department of Materials Science and Engineering. ...
(Date:8/20/2014)... Knoxville, research finds life can persist in a cold, ... of a team that examined waters and sediments from ... and found the extreme environment supports microbial ecosystems. ... and her colleagues has implications for life in other ... system. The findings are published in the current edition ...
Breaking Biology News(10 mins):American Society of Human Genetics 2014 Annual Meeting 2Researchers develop models to study polyelectrolytes, including DNA and RNA 2University of Tennessee research uncovers subglacial life beneath Antarctic ice sheet 2
Other Contents