Insight
Navigation Links
Insight in Medical News
EXTON, Pa., July 31 /PRNewswire/ -- BioTrends Research Group, Inc. announces the release of the wave one LaunchTrends (TM): SIMPONI and CIMZIA report. The survey was completed by U.S. Rheumatologists in late June 2009.
While awareness of both new TNF antagonists is relatively h...
Advancements Could Improve the Quality of Life of Injured Veterans WEST ORANGE, N.J., June 11 /PRNewswire/ -- A recent study by Kessler Foundation Research Center published in Brain Injury , the official journal of the International Brain Injury Association, uncovered the possible cause of c...
A recent study by Kessler Foundation Research Center published in Brain Injury, the official journal of the International Brain Injury Association, uncovered the possible cause of cognitive fatigue in patients suffering from traumatic brain injury (TBI). Cognitive fatigue has been shown to be one...
EXTON, Pa., June 4 /PRNewswire/ -- BioTrends Research Group, Inc. announces the release of the baseline LaunchTrends (TM): SIMPONI report. The survey was completed by U.S. Rheumatologists in May 2009, just days after the FDA announced approval for SIMPONI (golimumab). Once monthly dos...
'Artificial Golgi' may provide new insight into key cell structure
Scientists in New York and North Carolina are reporting assembly of the first functioning prototype of an artificial Golgi organelle. That key structure inside cells helps process and package hormones, enzymes, and other substances that allow the body to function normally. The lab-on-a-chip device...Advancements Could Improve the Quality of Life of Injured Veterans WEST ORANGE, N.J., June 11 /PRNewswire/ -- A recent study by Kessler Foundation Research Center published in Brain Injury , the official journal of the International Brain Injury Association, uncovered the possible cause of c...
A recent study by Kessler Foundation Research Center published in Brain Injury, the official journal of the International Brain Injury Association, uncovered the possible cause of cognitive fatigue in patients suffering from traumatic brain injury (TBI). Cognitive fatigue has been shown to be one...
EXTON, Pa., June 4 /PRNewswire/ -- BioTrends Research Group, Inc. announces the release of the baseline LaunchTrends (TM): SIMPONI report. The survey was completed by U.S. Rheumatologists in May 2009, just days after the FDA announced approval for SIMPONI (golimumab). Once monthly dos...
New Insight Into Primate Eye Evolution
St. Jude study of the nocturnal owl monkey suggests that evolution needed only a few genetic changes to profoundly alter eye anatomy MEMPHIS, Tenn., May 18 /PRNewswire-USNewswire/ -- Researchers comparing the fetal development of the eye of the owl monkey with that of the capuchin monkey hav...Insight in Medical Technology
BOSTON and EDISON, N.J., July 15 /PRNewswire/ -- A sub-analysis of a Phase IIb multinational study(1) with edoxaban(2) - an investigational oral Factor Xa inhibitor - provides insights into why patients with non-valvular atrial fibrillation (AF) receiving edoxaban once daily (QD) experie...
WILMINGTON, Del., July 17 /PRNewswire/ -- The research team at the Nemours Center for Childhood Cancer Research (NCCCR), a newly established division of Nemours Biomedical Research at the Alfred I. duPont Hospital for Children has discovered that the biomarker called prostate specific membrane...
REYKJAVIK, Iceland, Jan. 6 /PRNewswire/ -- deCODE scientists today report that the genetic variant on chromosome 9p21 that the company has linked to increased risk of heart attack is also associated with up to 70% increase in risk of abdominal aortic aneurysm (AAA) and intracranial aneurysm (I...
CAMBRIDGE, Mass.--(BUSINESS WIRE)--Jun 4, 2007 - Molecular Insight Pharmaceuticals, Inc. (NASDAQ: MIPI) announced today that the company will present the results of several preclinical studies at the 54th annual meeting of the Society of Nuclear Medicine (SNM) in Washington, D.C. The presentations ...
CAMBRIDGE, Mass.--(BUSINESS WIRE)--Jun 4, 2007 - Researchers at Molecular Insight Pharmaceuticals today announced the presentation of preclinical data on MIP-1072, a radiolabeled, small molecule molecular imaging pharmaceutical in development for diagnosis and staging of prostate cancer at the 54th...
New Insight Into the Controls on a Go-To Enzyme
St. Jude scientists report basic findings on critical enzyme's regulation may hold key to understanding how to better treat an array of disorders MEMPHIS, Tenn., Nov. 19 /PRNewswire-USNewswire/ -- Scientists at St. Jude Children's Research Hospital have gained new insights into regulatio...WILMINGTON, Del., July 17 /PRNewswire/ -- The research team at the Nemours Center for Childhood Cancer Research (NCCCR), a newly established division of Nemours Biomedical Research at the Alfred I. duPont Hospital for Children has discovered that the biomarker called prostate specific membrane...
REYKJAVIK, Iceland, Jan. 6 /PRNewswire/ -- deCODE scientists today report that the genetic variant on chromosome 9p21 that the company has linked to increased risk of heart attack is also associated with up to 70% increase in risk of abdominal aortic aneurysm (AAA) and intracranial aneurysm (I...
CAMBRIDGE, Mass.--(BUSINESS WIRE)--Jun 4, 2007 - Molecular Insight Pharmaceuticals, Inc. (NASDAQ: MIPI) announced today that the company will present the results of several preclinical studies at the 54th annual meeting of the Society of Nuclear Medicine (SNM) in Washington, D.C. The presentations ...
CAMBRIDGE, Mass.--(BUSINESS WIRE)--Jun 4, 2007 - Researchers at Molecular Insight Pharmaceuticals today announced the presentation of preclinical data on MIP-1072, a radiolabeled, small molecule molecular imaging pharmaceutical in development for diagnosis and staging of prostate cancer at the 54th...
Insight in Medical Products
Siemens Webcast: Expert Insight - Key Elements for a Successful Electrophysiology Program
Description: ...Company:Siemens Medical Solutions USA, Inc.
Calvin Klein Optical Collection
Description:... The Calvin Klein Collection. Provocatively inspired for individuals who possess unique insight - a bold outlook. Innovative structure: soft-sculpted shapes with hard line fluidity. Modern technology enhances modern design. Technological sophisti...Company:Marchon Eyewear Inc.
Description:... It also has features that make set-up easy and accurate. Its session meter records the number of sessions that last more than four hours - giving you insight into patients' daily usage patterns....
Company:Respironics, Inc.
Model 700 Whole Blood/Optical Lumi-Aggregometer
Description:...ion provides unequivocal evidence of normal dense granule release. Simultaneous measurement of Aggregation and dense granule release provides a better insight into the mechanism of platelet response....Company:Chrono-log Corporation
Description:...imum visibility, enhanced maneuverability and retains a flat profile after insertion through the trocar. Visilex mesh is the culmination of input and insight from laparoscopic surgeons. With a myriad of clinical benefits, it will change the way you look at laparoscopic hernia repair. The Visilex reinforced...
Company:Davol, Inc.
MaximEyes Optometric & Ophthalmology Software for Practice Management and Electronic Medical Records
Description:... MaximEyes by First insight is the leading practice management and electronic medical records solution for eye care professionals. MaximEyes was the first to integrate with Eyefi...Company:First Insight Corporation
Insight in Medical Dictionary
...o suffer from pain . In its broadest definition, pain is any unpleasant sensation. ... Of Pain Scales. These easy-to-use tools offer valuable insight into the experience of pain . ... ...
... to 5 cm at largest point, or multiple nodes, no ... Metastasis is the spread of cancer from its primary site to other places in the ... New insight Into Cancer Metastasis (June 28, 2004) — A team of researchers led ... Metastasis ... Metastasis has proven to be one of the most dangerous ...
...feet do not cause pain ... Can a Flat Foot be Treated? ... A discussion of flat feet as seen in the adolescent, teenager and adult with insight ... Flat feet more commonly known as fallen arches is a condition found ... ... "flexible" means that while the foot is flat when standi...
... Flat feet (also called pes planus or fallen arches) is an ... A discussion of flat feet as seen in the adolescent, teenager and adult with insight ... Flat feet more commonly known as fallen arches is a condition found ... Flat feet information including symptoms, diagnosis, misdiag...
...ries which require immediate medical attention. While not usually providing long-term or continuing care, emergency medicine ... Magazine offers insight into problems in emergency depts/primary care: trauma, heartattack, stroke, gastrointestinal dysfunction, dermatologic disorders, and more. E...
...n again and getting my life back. ... Many digestive problems can be prevented by eating healthy. WebMD tells you how. ... A. Drossman, offers insight on alternative therapies for digestive problems . ... Major and minor Digestive Disorders, How the Digestive System Works, Diseases of the ...
... to 5 cm at largest point, or multiple nodes, no ... Metastasis is the spread of cancer from its primary site to other places in the ... New insight Into Cancer Metastasis (June 28, 2004) — A team of researchers led ... Metastasis ... Metastasis has proven to be one of the most dangerous ...
...feet do not cause pain ... Can a Flat Foot be Treated? ... A discussion of flat feet as seen in the adolescent, teenager and adult with insight ... Flat feet more commonly known as fallen arches is a condition found ... ... "flexible" means that while the foot is flat when standi...
... Flat feet (also called pes planus or fallen arches) is an ... A discussion of flat feet as seen in the adolescent, teenager and adult with insight ... Flat feet more commonly known as fallen arches is a condition found ... Flat feet information including symptoms, diagnosis, misdiag...
...ries which require immediate medical attention. While not usually providing long-term or continuing care, emergency medicine ... Magazine offers insight into problems in emergency depts/primary care: trauma, heartattack, stroke, gastrointestinal dysfunction, dermatologic disorders, and more. E...
...n again and getting my life back. ... Many digestive problems can be prevented by eating healthy. WebMD tells you how. ... A. Drossman, offers insight on alternative therapies for digestive problems . ... Major and minor Digestive Disorders, How the Digestive System Works, Diseases of the ...
Insight in Biological News
Penn-Wistar team gains insight into HIV vaccine failure
PHILADELPHIA (July 20, 2009) A team of researchers from The Wistar Institute and the University of Pennsylvania reports new evidence refuting a popular hypothesis about the highly publicized failure in 2007 of the Merck STEP HIV vaccine study that cast doubt on the feasibility of HIV-1 vaccines....Study by NTU professors provides important insight into apoptosis or programmed cell death
A study by Nanyang Technological University (NTU)'s Assistant Professor Li Hoi Yeung, Assistant Professor Koh Cheng Gee and their team have made an important contribution to the understanding of the process that cells go through when they die. This process known as 'apoptosis' or programmed cell d...Researchers gain insight into mechanism underlying Huntington's
LEXINGTON, Ky. (July 13, 2009) Researchers at the University of Kentucky Markey Cancer Center and Graduate Center for Toxicology (GCT) have gained new insight into the genetic mechanisms underlying Huntington's disease and other neurodegenerative or neuromuscular disorders caused by trinucleotide...U of M study finds new insight on therapy for a devastating parasitic disease
MINNEAPOLIS / ST. PAUL (June 23, 2009) University of Minnesota Medical School researchers have discovered an important new insight into how a commonly prescribed drug may work to treat those infected by a parasitic flatworm. The Schistosomasis parasite infects about 200 million ...A new mouse model provides insight into genetic neurological disorders
Neurosensory diseases are difficult to model in mice because their symptoms are complex and diverse. The genetic causes identified are often lethal when transferred to a mouse. The lack of animal models slows progress in understanding and treating the diseases. By strategically altering a protein-...University of Florida study provides insight into evolution of first flowers
GAINESVILLE, Fla. --- Charles Darwin described the sudden origin of flowering plants about 130 million years ago as an abominable mystery, one that scientists have yet to solve. But a new University of Florida study, set to appear next week in the online edition of the Proceedings of the Nati...Insight in Biological Technology
Stephen H. Friend, MD, PhD to Keynote at Defined Health's 9th Annual Therapeutic Insight Conference
FLORHAM PARK, N.J., Feb. 25 /PRNewswire/ -- Defined Health has announced the agenda and confirmed speakers for its 9th annual Therapeutic Insight conference. Therapeutic Insight 2009 ("TI2009") will take place on March 31- April 2, 2009, at The New York Marriott Downtown. The agenda, list of speak...Demonstrating the Clinical and Economic Value of Pharmaceuticals in a New U.S. Political Administration PHILADELPHIA, Feb. 9 /PRNewswire/ -- ExL Pharma today announced the start of the first annual conference on Managed Markets Insight & Marketing for the Pharmaceutical Industry at the Lo...
EXTON, Pa., Jan. 12 /PRNewswire/ -- BioTrends Research Group, Inc. released TreatmentTrends(TM): US Nephrology, a syndicated report based on online survey results from 305 Nephrologists in the US. The renal anemia market continues to show signs of stabilization. While the percent of pati...
EXTON, Pa., Oct. 27 /PRNewswire/ -- BioTrends Research Group, Inc. released two new Nephrology TreatmentTrends(TM) publications based on survey results from 204 Nephrologists and 201 Renal Dietitians in the US. Renal Dietitians (RDs) are an integral part of the management of dialysis patients,...
New insight to demineralization
Blacksburg, Va. From toothpaste to technology, noncrystalline or amorphous silica is an active ingredient in a myriad of products that we use in our daily lives. As a minor, but essential component of vertebrate bone, an understanding of silica reactivity in physiological environments is crucial ...Molecular changes in brain fluid give insight into brain-damaging disease
Soon after an individual becomes infected with HIV the virus infects cells in the brain and spinal cord (the central nervous system [CNS]). Although this causes no immediate problems, during the late-stages of disease it can cause dementia and encephalitis (acute inflammation of the brain that can...Insight in Biological Definition
... this structure from X-ray patterns. Even in the initial crude diffraction data from DNA, it was evident that the structure involved helices. But this insight was only a beginning. There remained the questions of how many strands came together, whether this number was the same for every helix, whether the ba...
...nd processing of sequence data. External links An article on glycomics appeared New Scientist 26 October , 2002 . It provides a broad insight into some of the challenges and opportunties posed by glycomics, as of 2002. ...
...il 2, 2005 "Conscious Awareness & The Unconscious Mind" by Rhawn Joseph, Brainmind.com, retrieved April 3, 2005 "Chimpanzee Communication: insight into the Origin of Language" by Amy Stafford, Minnesota State University Mankato, retrieved April 4, 2005 Genetic migrations , by Kevin Duerinck, ...
... field is generally slow and sporadic, though it still draws the attention of many due to the gravity of question being investigated. A few facts give insight into the conditions in which life may have emerged, but the mechanisms by which non-life became life are elusive. For the observed evolution of li...
...to the breadth and subtlety of Lamarck's ideas). Lamarck's most important insight may have been that species can be extraordinarily fluid; his 1809 Zoolog...he existence of distinct species. Darwin's work drew on Thomas Malthus ' insight that the rate of growth of a biological population will always outpace the ...
...nd processing of sequence data. External links An article on glycomics appeared New Scientist 26 October , 2002 . It provides a broad insight into some of the challenges and opportunties posed by glycomics, as of 2002. ...
...il 2, 2005 "Conscious Awareness & The Unconscious Mind" by Rhawn Joseph, Brainmind.com, retrieved April 3, 2005 "Chimpanzee Communication: insight into the Origin of Language" by Amy Stafford, Minnesota State University Mankato, retrieved April 4, 2005 Genetic migrations , by Kevin Duerinck, ...
... field is generally slow and sporadic, though it still draws the attention of many due to the gravity of question being investigated. A few facts give insight into the conditions in which life may have emerged, but the mechanisms by which non-life became life are elusive. For the observed evolution of li...
...to the breadth and subtlety of Lamarck's ideas). Lamarck's most important insight may have been that species can be extraordinarily fluid; his 1809 Zoolog...he existence of distinct species. Darwin's work drew on Thomas Malthus ' insight that the rate of growth of a biological population will always outpace the ...
Insight in Biological Dictionary
... ... Wikipedia has an article on: Stele . Wikipedia [edit] Etymology ... The Israel Museum unveiled a unique 2,200-year-old stele that provides insight into the story of Heliodorus and the Temple in Jerusalem, as related in the Second ... Get information, facts, and pictures about stele at Encycl...
... mature transcript , called messenger RNA (mRNA) ... The ratio of mature mRNA to primary transcript was higher for CheB42a than for ... some insight into how mature CheB42a and llz transcripts may be generated. ... Understanding the molecular mechanisms responsible for the regulation of the ...
...stem and a surprisingly low ... Get the latest in hybrid car news and video from around the internet, social media, and reviewers. ... 2010 Honda insight Hybrid Makes Debut ... Features an illustrated description of the parallel hybrid powertrain of the Toyota Prius. Discover and learn about G...
...gctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctg aagcagaggctgagaccgag ... GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ... Information about exon in the free online ...
...f Siebel Systems, and Ernie von Simson of Ostriker von Simson ... BDNA insight Publisher 6.0.1 schema and ERD documentation is now ... Visit the Product D...avings in software license compliance, data center consolidation ... BDNA insight delivers immediate and capturable return on investment to its ... ...
... mature transcript , called messenger RNA (mRNA) ... The ratio of mature mRNA to primary transcript was higher for CheB42a than for ... some insight into how mature CheB42a and llz transcripts may be generated. ... Understanding the molecular mechanisms responsible for the regulation of the ...
...stem and a surprisingly low ... Get the latest in hybrid car news and video from around the internet, social media, and reviewers. ... 2010 Honda insight Hybrid Makes Debut ... Features an illustrated description of the parallel hybrid powertrain of the Toyota Prius. Discover and learn about G...
...gctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctg aagcagaggctgagaccgag ... GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ... Information about exon in the free online ...
...f Siebel Systems, and Ernie von Simson of Ostriker von Simson ... BDNA insight Publisher 6.0.1 schema and ERD documentation is now ... Visit the Product D...avings in software license compliance, data center consolidation ... BDNA insight delivers immediate and capturable return on investment to its ... ...
Other TagsOther Contentscausticcellulitephonesphonesphonescesareancesareancerumencerebralcerebralcerebralcerebralcerebralcerebralcerebralcerebralchalazion
BronchospasmBruiseBruisingBullaeBunionBurnsBunionsBurkittBursaBursitisCachexiaByssinosisCalcificationCamphor
(Date:11/27/2009)... Three new interactive anatomy education apps fro...xpand health sciences learning opportunities for i...rham, NC (Vocus) November 27, 2009 -- Modality, I...a division of Wolters Kluwer Health, today announc... apps on the App Store. Clemente’s Anatomy, ...
(Date:11/26/2009)...ov.27/PRNewswire/--ThediabetespopulationintheUnite...medicalspendingonthediseaseisprojectedtohit$336bil...shedintheDecemberissueof DiabetesCare .TheNational...voNordisk,commissionedtheanalysisbyateamfromtheUni...numberofAmericanslivingwithdiabeteswillrisefrom23....
(Date:11/26/2009)...g drug tetrathiomolybdate (TM) has been shown in s...disease, a disease caused by an overload of copper...wn. Very little, however, is known about how the d...led by Northwestern University researchers now has...l structure of TM bound to copper-loaded metalloch...
(Date:11/26/2009)... when on an emotional rollercoaster, study finds ,... Call it the fear factor meets the jubilant sports... especially those who root for the winning team --... contested match and victory was in doubt, produci...n that this Thanksgiving weekend as you,re glued t...
(Date:11/26/2009)... Dr. David Kim of the Live Life Again Center, a p...is one of a growing number of physicians who are ...s to connect with individuals who are interested i...besity. Dr. Kim is utilizing Facebook to share bef...ctice with the community. , ...
Breaking Medicine News(10 mins):Health News:Clemente's Anatomy, Rohen's Photographic Anatomy, and Moore's Clinical Anatomy Customizable Apps Now Available on App Store 2Health News:Clemente's Anatomy, Rohen's Photographic Anatomy, and Moore's Clinical Anatomy Customizable Apps Now Available on App Store 3Health News:Clemente's Anatomy, Rohen's Photographic Anatomy, and Moore's Clinical Anatomy Customizable Apps Now Available on App Store 4Health News:Clemente's Anatomy, Rohen's Photographic Anatomy, and Moore's Clinical Anatomy Customizable Apps Now Available on App Store 5Health News:Diabetes Population to Double, Diabetes Costs to Nearly Triple, in 25 Years, New Study Shows 2Health News:Diabetes Population to Double, Diabetes Costs to Nearly Triple, in 25 Years, New Study Shows 3Health News:Research sheds light on workings of anti-cancer drug 2Health News:Research sheds light on workings of anti-cancer drug 3Health News:Watching the Nail-Biting Big Game Hurts So Good 2Health News:Watching the Nail-Biting Big Game Hurts So Good 3Health News:Dallas Texas Weight Loss Surgeon Using Social Media To Reach Out to Patients 2Health News:Dallas Texas Weight Loss Surgeon Using Social Media To Reach Out to Patients 3[0] Clemente's Anatomy, Rohen's Photographic Anatomy, and Moore's Clinical Anatomy Customizable Apps Now Available on App Store[1] Diabetes Population to Double, Diabetes Costs to Nearly Triple, in 25 Years, New Study Shows[1] Research sheds light on workings of anti-cancer drug[0] Watching the Nail-Biting Big Game Hurts So Good[1] Dallas Texas Weight Loss Surgeon Using Social Media To Reach Out to Patients
(Date:11/23/2009)...iated strain of the deadly superbug MRSAan infecti...ioticsposes a far greater health threat than previ...according to a study in the December issue of Eme... easily picked up in fitness centers, schools, and... burden of MRSA within hospitals, the report found...
(Date:11/23/2009)...me of day matters to forest trees dealing with dro...rch team led by Professor Malcolm Campbell, Univer...esearch and colleagues in the department of cell a... Capitalizing on their previous work to decode the...ined how poplar trees use their 45,000 genes to re...
(Date:11/23/2009)...cipants gathered this week for the seventh annual ...nce. This year,s topic, "Synthetic Biology," broug...earchers to explore the engineering, scientific, a... synthetic biology. , Bonnie L. Bassler, profess...d this year,s conference chair, challenged the att...
Breaking Biology News(10 mins):New study finds MRSA on the rise in hospital outpatients 2Time of day matters to thirsty trees, U of T researcher discovers 2Synthetic biology offers new opportunities for interdisciplinary collaboration 2Deals keep Coming in Medical real Estate 14213 1Deals keep Coming in Medical real Estate 14213 2Global Cooperation Urged to Control Species Crossing Disease 58009 1Global Cooperation Urged to Control Species Crossing Disease 58009 2Global Cooperation Urged to Control Species Crossing Disease 58009 3Candy and Fruit Flavored Cigarettes Now Illegal in United States 3B Step is First Under New Tobacco Law 58006 1Candy and Fruit Flavored Cigarettes Now Illegal in United States 3B Step is First Under New Tobacco Law 58006 2| Copyright © 2003-2009 Bio-Medicine. All rights reserved. ABOUT | CONTACT US | DISCLAIMER | PRIVACY POLICY | TERMS AND CONDITIONS |  |