Navigation Links
Insight in Medical News

Does the Crowded TNF Market Really Need Two New Agents? Rheumatologists Provide Insight in the Wave One Report of LaunchTrends(TM): SIMPONI and CIMZIA

EXTON, Pa., July 31 /PRNewswire/ -- BioTrends Research Group, Inc. announces the release of the wave one LaunchTrends (TM): SIMPONI and CIMZIA report. The survey was completed by U.S. Rheumatologists in late June 2009. While awareness of both new TNF antagonists is relatively h...

'Artificial Golgi' may provide new insight into key cell structure

Scientists in New York and North Carolina are reporting assembly of the first functioning prototype of an artificial Golgi organelle. That key structure inside cells helps process and package hormones, enzymes, and other substances that allow the body to function normally. The lab-on-a-chip device...

Kessler Foundation Research Center Study Provides Insight into One of the Most Challenging Symptoms Following a Traumatic Brain Injury

Advancements Could Improve the Quality of Life of Injured Veterans WEST ORANGE, N.J., June 11 /PRNewswire/ -- A recent study by Kessler Foundation Research Center published in Brain Injury , the official journal of the International Brain Injury Association, uncovered the possible cause of c...

Kessler Foundation Research Center Study Provides Insight into One of the Most Challenging Symptoms Following a Traumatic Brain Injury

A recent study by Kessler Foundation Research Center published in Brain Injury, the official journal of the International Brain Injury Association, uncovered the possible cause of cognitive fatigue in patients suffering from traumatic brain injury (TBI). Cognitive fatigue has been shown to be one...

Once Monthly Dosing: How Much of a Competitive Advantage is it? Rheumatologists Provide Insight in the Baseline Report of LaunchTrends(TM): SIMPONI(TM)

EXTON, Pa., June 4 /PRNewswire/ -- BioTrends Research Group, Inc. announces the release of the baseline LaunchTrends (TM): SIMPONI report. The survey was completed by U.S. Rheumatologists in May 2009, just days after the FDA announced approval for SIMPONI (golimumab). Once monthly dos...

New Insight Into Primate Eye Evolution

St. Jude study of the nocturnal owl monkey suggests that evolution needed only a few genetic changes to profoundly alter eye anatomy MEMPHIS, Tenn., May 18 /PRNewswire-USNewswire/ -- Researchers comparing the fetal development of the eye of the owl monkey with that of the capuchin monkey hav...


Insight in Medical Technology

Analysis of Edoxaban Phase II Data Provides Insight Into Reduced Bleeding Events Seen in Once-Daily Dosing

BOSTON and EDISON, N.J., July 15 /PRNewswire/ -- A sub-analysis of a Phase IIb multinational study(1) with edoxaban(2) - an investigational oral Factor Xa inhibitor - provides insights into why patients with non-valvular atrial fibrillation (AF) receiving edoxaban once daily (QD) experie...

New Insight Into the Controls on a Go-To Enzyme

St. Jude scientists report basic findings on critical enzyme's regulation may hold key to understanding how to better treat an array of disorders MEMPHIS, Tenn., Nov. 19 /PRNewswire-USNewswire/ -- Scientists at St. Jude Children's Research Hospital have gained new insights into regulatio...

Nemours Center for Childhood Cancer Research Team at the Alfred I. duPont Hospital for Children Identifies the Function of a Biomarker Present in Prostate Cancer Cells: New Insight into Therapeutic Benefit for Patients with Advanced Prostate Cancer

WILMINGTON, Del., July 17 /PRNewswire/ -- The research team at the Nemours Center for Childhood Cancer Research (NCCCR), a newly established division of Nemours Biomedical Research at the Alfred I. duPont Hospital for Children has discovered that the biomarker called prostate specific membrane...

Not Only Lipids and Inflammation: Insight Into a New Cause of Heart Attack and Other Vascular Disease

REYKJAVIK, Iceland, Jan. 6 /PRNewswire/ -- deCODE scientists today report that the genetic variant on chromosome 9p21 that the company has linked to increased risk of heart attack is also associated with up to 70% increase in risk of abdominal aortic aneurysm (AAA) and intracranial aneurysm (I...

Molecular Insight Pharmaceuticals, Inc. Presents Preclinical Data at Society Of Nuclear Medicine 2007 Annual Meeting

CAMBRIDGE, Mass.--(BUSINESS WIRE)--Jun 4, 2007 - Molecular Insight Pharmaceuticals, Inc. (NASDAQ: MIPI) announced today that the company will present the results of several preclinical studies at the 54th annual meeting of the Society of Nuclear Medicine (SNM) in Washington, D.C. The presentations ...

Molecular Insight Pharmaceuticals, Inc. Presents Preclinical Data on Molecular Imaging Pharmaceutical for Prostate Cancer

CAMBRIDGE, Mass.--(BUSINESS WIRE)--Jun 4, 2007 - Researchers at Molecular Insight Pharmaceuticals today announced the presentation of preclinical data on MIP-1072, a radiolabeled, small molecule molecular imaging pharmaceutical in development for diagnosis and staging of prostate cancer at the 54th...
Insight in Medical Products

Siemens Webcast: Expert Insight - Key Elements for a Successful Electrophysiology Program

Description: ...
Company:Siemens Medical Solutions USA, Inc.

Calvin Klein Optical Collection

Description:... The Calvin Klein Collection. Provocatively inspired for individuals who possess unique insight - a bold outlook. Innovative structure: soft-sculpted shapes with hard line fluidity. Modern technology enhances modern design. Technological sophisti...
Company:Marchon Eyewear Inc.

REMstar Plus

Description:... It also has features that make set-up easy and accurate. Its session meter records the number of sessions that last more than four hours - giving you insight into patients' daily usage patterns....
Company:Respironics, Inc.

Model 700 Whole Blood/Optical Lumi-Aggregometer

Description:...ion provides unequivocal evidence of normal dense granule release. Simultaneous measurement of Aggregation and dense granule release provides a better insight into the mechanism of platelet response....
Company:Chrono-log Corporation

Bard Visilex® Mesh

Description:...imum visibility, enhanced maneuverability and retains a flat profile after insertion through the trocar. Visilex mesh is the culmination of input and insight from laparoscopic surgeons. With a myriad of clinical benefits, it will change the way you look at laparoscopic hernia repair. The Visilex reinforced...
Company:Davol, Inc.

MaximEyes Optometric & Ophthalmology Software for Practice Management and Electronic Medical Records

Description:... MaximEyes by First insight is the leading practice management and electronic medical records solution for eye care professionals. MaximEyes was the first to integrate with Eyefi...
Company:First Insight Corporation
Insight in Medical Dictionary


...o suffer from pain . In its broadest definition, pain is any unpleasant sensation. ... Of Pain Scales. These easy-to-use tools offer valuable insight into the experience of pain . ... ...


... to 5 cm at largest point, or multiple nodes, no ... Metastasis is the spread of cancer from its primary site to other places in the ... New insight Into Cancer Metastasis (June 28, 2004) — A team of researchers led ... Metastasis ... Metastasis has proven to be one of the most dangerous ...

Flat foot

...feet do not cause pain ... Can a Flat Foot be Treated? ... A discussion of flat feet as seen in the adolescent, teenager and adult with insight ... Flat feet more commonly known as fallen arches is a condition found ... ... "flexible" means that while the foot is flat when standi...

Flat feet

... Flat feet (also called pes planus or fallen arches) is an ... A discussion of flat feet as seen in the adolescent, teenager and adult with insight ... Flat feet more commonly known as fallen arches is a condition found ... Flat feet information including symptoms, diagnosis, misdiag...

Emergency Medicine

...ries which require immediate medical attention. While not usually providing long-term or continuing care, emergency medicine ... Magazine offers insight into problems in emergency depts/primary care: trauma, heartattack, stroke, gastrointestinal dysfunction, dermatologic disorders, and more. E...

Digestive problems

...n again and getting my life back. ... Many digestive problems can be prevented by eating healthy. WebMD tells you how. ... A. Drossman, offers insight on alternative therapies for digestive problems . ... Major and minor Digestive Disorders, How the Digestive System Works, Diseases of the ...
Insight in Biological News

Penn-Wistar team gains insight into HIV vaccine failure

PHILADELPHIA (July 20, 2009) A team of researchers from The Wistar Institute and the University of Pennsylvania reports new evidence refuting a popular hypothesis about the highly publicized failure in 2007 of the Merck STEP HIV vaccine study that cast doubt on the feasibility of HIV-1 vaccines....

Study by NTU professors provides important insight into apoptosis or programmed cell death

A study by Nanyang Technological University (NTU)'s Assistant Professor Li Hoi Yeung, Assistant Professor Koh Cheng Gee and their team have made an important contribution to the understanding of the process that cells go through when they die. This process known as 'apoptosis' or programmed cell d...

Researchers gain insight into mechanism underlying Huntington's

LEXINGTON, Ky. (July 13, 2009) Researchers at the University of Kentucky Markey Cancer Center and Graduate Center for Toxicology (GCT) have gained new insight into the genetic mechanisms underlying Huntington's disease and other neurodegenerative or neuromuscular disorders caused by trinucleotide...

U of M study finds new insight on therapy for a devastating parasitic disease

MINNEAPOLIS / ST. PAUL (June 23, 2009) University of Minnesota Medical School researchers have discovered an important new insight into how a commonly prescribed drug may work to treat those infected by a parasitic flatworm. The Schistosomasis parasite infects about 200 million ...

A new mouse model provides insight into genetic neurological disorders

Neurosensory diseases are difficult to model in mice because their symptoms are complex and diverse. The genetic causes identified are often lethal when transferred to a mouse. The lack of animal models slows progress in understanding and treating the diseases. By strategically altering a protein-...

University of Florida study provides insight into evolution of first flowers

GAINESVILLE, Fla. --- Charles Darwin described the sudden origin of flowering plants about 130 million years ago as an abominable mystery, one that scientists have yet to solve. But a new University of Florida study, set to appear next week in the online edition of the Proceedings of the Nati...


Insight in Biological Technology

Stephen H. Friend, MD, PhD to Keynote at Defined Health's 9th Annual Therapeutic Insight Conference

FLORHAM PARK, N.J., Feb. 25 /PRNewswire/ -- Defined Health has announced the agenda and confirmed speakers for its 9th annual Therapeutic Insight conference. Therapeutic Insight 2009 ("TI2009") will take place on March 31- April 2, 2009, at The New York Marriott Downtown. The agenda, list of speak...

ExL Pharma Presents The Pharmaceutical Managed Markets Insight & Marketing for the Pharmaceutical Industry Conference

Demonstrating the Clinical and Economic Value of Pharmaceuticals in a New U.S. Political Administration PHILADELPHIA, Feb. 9 /PRNewswire/ -- ExL Pharma today announced the start of the first annual conference on Managed Markets Insight & Marketing for the Pharmaceutical Industry at the Lo...

BioTrends Releases TreatmentTrends(TM): US Nephrology, an Ongoing Syndicated Publication Providing Insight into Physician Perceptions and Management of Renal Anemia, Hyperphosphatemia, and Secondary Hyperparathyroidism

EXTON, Pa., Jan. 12 /PRNewswire/ -- BioTrends Research Group, Inc. released TreatmentTrends(TM): US Nephrology, a syndicated report based on online survey results from 305 Nephrologists in the US. The renal anemia market continues to show signs of stabilization. While the percent of pati...

BioTrends Releases TreatmentTrends(TM): Nephrology and Renal Dietitians, Two Syndicated Reports Providing Continuing Insight into the Management of Renal Anemia, Hyperphosphatemia, and Secondary Hyperparathyroidism

EXTON, Pa., Oct. 27 /PRNewswire/ -- BioTrends Research Group, Inc. released two new Nephrology TreatmentTrends(TM) publications based on survey results from 204 Nephrologists and 201 Renal Dietitians in the US. Renal Dietitians (RDs) are an integral part of the management of dialysis patients,...

New insight to demineralization

Blacksburg, Va. From toothpaste to technology, noncrystalline or amorphous silica is an active ingredient in a myriad of products that we use in our daily lives. As a minor, but essential component of vertebrate bone, an understanding of silica reactivity in physiological environments is crucial ...

Molecular changes in brain fluid give insight into brain-damaging disease

Soon after an individual becomes infected with HIV the virus infects cells in the brain and spinal cord (the central nervous system [CNS]). Although this causes no immediate problems, during the late-stages of disease it can cause dementia and encephalitis (acute inflammation of the brain that can...


Insight in Biological Definition


... this structure from X-ray patterns. Even in the initial crude diffraction data from DNA, it was evident that the structure involved helices. But this insight was only a beginning. There remained the questions of how many strands came together, whether this number was the same for every helix, whether the ba...


...nd processing of sequence data. External links An article on glycomics appeared New Scientist 26 October , 2002 . It provides a broad insight into some of the challenges and opportunties posed by glycomics, as of 2002. ...

Human 2, 2005 "Conscious Awareness & The Unconscious Mind" by Rhawn Joseph,, retrieved April 3, 2005 "Chimpanzee Communication: insight into the Origin of Language" by Amy Stafford, Minnesota State University Mankato, retrieved April 4, 2005 Genetic migrations , by Kevin Duerinck, ...

Origin of life

... field is generally slow and sporadic, though it still draws the attention of many due to the gravity of question being investigated. A few facts give insight into the conditions in which life may have emerged, but the mechanisms by which non-life became life are elusive. For the observed evolution of li...

Species the breadth and subtlety of Lamarck's ideas). Lamarck's most important insight may have been that species can be extraordinarily fluid; his 1809 Zoolog...he existence of distinct species. Darwin's work drew on Thomas Malthus ' insight that the rate of growth of a biological population will always outpace the ...
Insight in Biological Dictionary


... ... Wikipedia has an article on: Stele . Wikipedia [edit] Etymology ... The Israel Museum unveiled a unique 2,200-year-old stele that provides insight into the story of Heliodorus and the Temple in Jerusalem, as related in the Second ... Get information, facts, and pictures about stele at Encycl...

Mature transcript

... mature transcript , called messenger RNA (mRNA) ... The ratio of mature mRNA to primary transcript was higher for CheB42a than for ... some insight into how mature CheB42a and llz transcripts may be generated. ... Understanding the molecular mechanisms responsible for the regulation of the ...


...stem and a surprisingly low ... Get the latest in hybrid car news and video from around the internet, social media, and reviewers. ... 2010 Honda insight Hybrid Makes Debut ... Features an illustrated description of the parallel hybrid powertrain of the Toyota Prius. Discover and learn about G...


...gctagtg (25 bp) TrpnT 4R ... TNNT2 Exon 5. agcaggaggaggcagcggaagaggatgctg aagcagaggctgagaccgag ... GeneChip® Mouse Exon 1.0 ST Array offers new insight and powerful key information for researchers. ... Analysis Methods for Exon Arrays v1.1 (pdf, 79 ... Information about exon in the free online ...


...f Siebel Systems, and Ernie von Simson of Ostriker von Simson ... BDNA insight Publisher 6.0.1 schema and ERD documentation is now ... Visit the Product D...avings in software license compliance, data center consolidation ... BDNA insight delivers immediate and capturable return on investment to its ... ...
Other Tags
(Date:10/22/2014)... HealthDay Reporter , TUESDAY, Oct. 21, ... may lead to increased blood pressure, according to a new ... in blood pressure for young adult women or for teenagers, ... drank lightly or moderately, their risk of high blood pressure ... parallels studies in older adult men and women," said lead ...
(Date:10/22/2014)... taken by Firestone officials at the company,s rubber ... spread of the disease there and could prove effective ... provides health services to about 80,000 employees, retirees, their ... Between Aug. 1 and Sept. 23, there were 71 ... That incidence rate of 0.09 percent was much lower ...
(Date:10/22/2014)... HealthDay Reporter TUESDAY, Oct. 21, 2014 ... while working for NBC News in Liberia has cleared ... unit at Nebraska Medical Center in Omaha, where he had been ... A blood test confirmed by the U.S. Centers for Disease Control ... Providence, R.I., NBC News reported Tuesday night. "Recovering ...
(Date:10/20/2014)... 20, 2014 With a mere 19 ... Crist made a brief fundraising stop at the ... , Fresh from a debate last night with his ... stage for the first seven minutes because Crist had ... described the incident in one word: "weird." , Before ...
(Date:10/20/2014)... Wakefield, MA (PRWEB) October 20, 2014 ... be sponsoring a booth at the American Foundation for ... October 25th. The AFSP is a not-for-profit organization that ... year. Net proceeds from these events are used to ... research, but education and personal relationships as well. ...
Breaking Medicine News(10 mins):Health News:Binge Drinking May Boost Blood Pressure in Young Men 2Health News:Binge Drinking May Boost Blood Pressure in Young Men 3Health News:Binge Drinking May Boost Blood Pressure in Young Men 4Health News:Tire Company Sets Standard for Ebola Care in Liberia: CDC 2Health News:U.S. Cameraman Treated for Ebola 'Free' of the Virus 2Health News:U.S. Cameraman Treated for Ebola 'Free' of the Virus 3Health News:At Crist Fundraiser, Dan Newlin Says, "No More Robert Germans," Will Seek Changes to Florida Missing Persons Law 2Health News:At Crist Fundraiser, Dan Newlin Says, "No More Robert Germans," Will Seek Changes to Florida Missing Persons Law 3Health News:The Advocator Group, LLC is Proud to Participate in an Out of the Darkness Community Walk, October 25th, to Increase Suicide Awareness 2Health News:The Advocator Group, LLC is Proud to Participate in an Out of the Darkness Community Walk, October 25th, to Increase Suicide Awareness 3
(Date:10/15/2014)... Life, is a non-traditional biophysics textbook and it describes ... a journey of discovery into biological systems and provides ... regulation. It is about how our genes make proteins ... billions of cells in an organism. It quantifies the ... which can be found on both large and small ...
(Date:10/15/2014)... NXT-ID, Inc. (NASDAQ: NXTD and NXTDW) ("NXT-ID" or ... commerce market releases photos and video of the recent opening bell ... th . Gino Pereira , CEO of ... Mr. Chad A. Verdi rang the bell.  ... and employees "for their work and dedication in bringing the world,s ...
(Date:10/14/2014)... A new study published in Cancer Research ... liver and colon cancers—can promote the development of skin ... proliferation and survival of sun-damaged skin cells. , Previously ... seven proteins called sirtuins that help regulate genomic stability ... aging. SIRT6 helps repair DNA damage, which can lead ...
Breaking Biology News(10 mins):New book about life as seen from physics 2Photo Release: NXT-ID Inc. Rings Opening Bell of the NASDAQ Stock Market October 13th 2Photo Release: NXT-ID Inc. Rings Opening Bell of the NASDAQ Stock Market October 13th 3Two-faced gene: SIRT6 prevents some cancers but promotes sun-induced skin cancer 2
Other Contents