Navigation Links
duplications in Medical News

New Map of Genomic Variation Will Enable Disease Research

...esearchers have unveiled a powerful new resource for scientists and health providers studying human illnesses -- a reference standard of deletions and duplications of DNA found in the human genome. Drawn from over 2,000 healthy persons, the study provides one of the deepest and broadest sets of copy number variat...

Upstate HomeCare Expands, Adds Pharmacies

...O'Hern, MD. "A pharmacy that is knowledgeable of a homecare patient's needs plays a critical role in managing a patient's medications for errors, duplications and therapeutic effectiveness. Working with the healthcare team assembled in the home to achieve successful outcomes for the patient is more importa...

Study IDs Variations in Black, White Genomes

...362 copy number variations (CNVs) in the human genome of blacks and 1,972 in whites. CNVs -- differences in gene copy numbers caused by deletions, duplications or rearrangements of genomic regions -- account for a large amount of human diversity and can also be associated with behavioral traits or increased s...

Blue Cross Receives Disease Management Awards of health challenges: prevention, episodic and chronic conditions and catastrophic illness care. Our members have no interruption in continuity--no duplications or handoffs from case management to disease management. It's a single point of contact." A key tool in the program is a "living database" whic...

Genome Study Points to New Culprit for Schizophrenia

...esearchers identified several CNVs they believe may be associated with the psychiatric disorder. CNVs are common and usually appear as deletions or duplications of significant stretches of DNA. But the largest deletions -- those over 2 million bases long -- appear only in people with schizophrenia, Need said. ...

New candidate genes for schizophrenia identified

...icularly severe form of the disease that is both chronic and debilitating. Specifically, they looked at a number of large but rare deletions and duplications in the genome of the patients, known as copy number variants, or CNVs. Scientists suspect that such missing or duplicated segments of DNA could be res...

Huge virulence gene superfamily responsible for devastating plant diseases

...tions of these C-terminal motifs are being investigated further. The Avh gene superfamily is one of the most rapidly evolving parts of the genome. duplications of genes are common and presumably responsible for the rapid expansion of the family. The diversity and duplication of genes noted in the sequences ar...

UCLA researchers examine human embryonic stem cell genome

...erences between individual DNA sequences provide the basis for human genetic variability. Forms of variation include single DNA base pair alterations, duplications or deletions of genes or sets of genes, and translocations, a chromosomal rearrangement in which a segment of genetic material from one chromosome bec...

Schizophrenia Tied to Multiple Genetic Errors

... News) -- Scientists have found that deletions and duplications in DNA are more common in people with schizophreni...ological function. Because these deletions and duplications differ from person to person, the study findings c...t the disease. The researchers found deletions and duplications of genes in 15 percent of those with schizophrenia...

International consortium announces the 1000 Genomes Project

...oduce a high-resolution map of larger differences in genome structure called structural variants. Structural variants are rearrangements, deletions or duplications of segments of the human genome. The importance of these variants has become increasingly clear with surveys completed in the past 18 months that show...
duplications in Medical Technology

More Gene Mutations Linked to Autism Risk

...ut not in the healthy controls. The complex combination of multiple genetic duplications and deletions is thought to interfere with gene function, which can disrupt... on changes in the exons of DNA--protein-coding areas in which deletions or duplications are more likely to directly disrupt biological functions," said study leade...

Autism Genes Discovered; Help Shape Connections Among Brain Cells

...f Washington . Hakonarson's second study in Nature , also using genome-wide association tools, identified copy number variations -- deletions or duplications of DNA -- that increase a child's risk of having an ASD. Interestingly, these variants were enriched in genes that belong to two biological pathways, ...

deCODE and SGENE Consortium Discover Deletions in the Human Genome Linked to Risk of Schizophrenia

...netic contribution to susceptibility. It is encouraging that our efforts to use SNP chips to detect rarer variations such as spontaneous deletions and duplications is now bearing fruit," said Kari Stefansson, CEO of deCODE. In the recent wave of discoveries of risk variants for common diseases, those associated...

Gene Chips to Detect CYP Variations: A New Step Toward Customized Medical Therapy.

... that therapeutic value is lost. Patients can also carry mutations or duplications in one or more CYP enzymes. Usually unbeknownst to the clinician, these po...6 and CYP2C19. The microarray is also constructed in a way that can detect duplications of a particular allele. The actual test is carried out with a patient...
duplications in Biological News

Further gene mutations linked to autism risk

...n some, but not all, of the affected individuals in families. "We focused on changes in the exons of DNAprotein-coding areas in which deletions or duplications are more likely to directly disrupt biological functions," said study leader Hakon Hakonarson. "We identified additional autism susceptibility genes, ...

Ancestral genome of present-day African great apes & humans had burst of DNA sequence duplication

...on, the researchers constructed a map of segmental duplications for four primate genomes: macaque, orangutan, chimpanzee, and human. They then compared the duplications across the four species. They characterized a dupl...ontent was human-specific, while the major part of duplications was shared with the other species. "Our team fo...

International study identifies gene variants associated with early heart attack

...sands of SNPs at once; and a gene chip developed by Altshuler's team that can simulaneously screen for SNPs and for copy-number variants deletions or duplications of gene segments, a type of change associated with several disease categories. After analysis of the consortium's samples identified SNPs that could b...

Microarray analysis improves prenatal diagnosis

...netics Laboratory. "The array enables you to detect smaller deletions or duplications of genetic material that would not be seen on a regular karyotype (a depict...genetics at BCM and first author of the report. Each of these deletions or duplications is rare but added together, the rate of event could be as high as that seen...

Aberrations in region of chromosome 1q21.1 associated with broad range of disorders in children

...e Pediatric Phenotypes." The results are discussed in an accompanying editorial by David H. Ledbetter of Emory University in Atlanta. Deletions and duplications of major sections of the human genome have long been known to cause disease or make a person susceptible to disease. Recent technological advances, ca...

Duck-billed platypus genome sequence published

...onsible for venom production in the male platypus, they made a surprising finding. They discovered that venom produced by the male platypus arose from duplications in certain genes over the course of evolutionary time which had been passed on from ancestral reptile genomes. The reptilian lineage displays a simila...

First draft of transgenic papaya genome yields many fruits

...nome took a different evolutionary path after its divergence from that of Arabidopsis about 72 million years ago, Ming said. Arabidopsis underwent two duplications of its entire genome in its recent evolutionary past, he said. These duplications, called alpha and beta, are not shared by papaya or grape. A much ea...

David H. Ledbetter, PhD, FACMG is the 2008-2009 Luminex/ACMGF Award recipient

...o develop a uniform, evidence-based Molecular Karyotype and shared national database to rapidly accumulate data on pathogenic vs. benign deletions and duplications in the human genome. ...

CSHL scientists part of team that discovers role of rare gene mutations in schizophrenia

...vastating illness is caused. The team screened for novel deletions and duplications in the genome -- what are called gene copy-number variations, or CNVs. They found that deletions, disruptions and duplications of normal genes, most of them rare, were three to four times more frequent ...

Iowa State researchers help piece together the corn genome's first draft

...s or days instead of months. LTR_par identifies retrotransposons, another mobile genetic element that can cause genome changes such as mutations, gene duplications and chromosome rearrangements. Schnable said the resulting draft of the corn genome provides plant scientists with a lot of data to work with. He ...
duplications in Biological Technology

International science consortium publishes analysis of domestic cattle genome sequence

...tical copes of DNA present in at least two locations in a genome. Segmental duplications in the human genome are associated with a variety of human disorders, inclu...ow-energy food sources into high-energy muscle, fat and milk. Segmental duplications in the domestic cattle genome have also resulted in specialized roles for g...

DNA duplication: A mechanism for 'survival of the fittest'

...ticated research techniques, they have dated these duplications as closely as possible. Yves Van de Peer's group then noticed that the most recent duplications occurred at approximately the same time in all of ...of evolution, 'the same time' is relative: the DNA duplications occurred between 40 and 80 million years ago. So, ...

Roche Makes Offer to Acquire All Outstanding Shares of Genentech for US$89.00 Per Share in Cash

..., partnerships and other key assets - Improved operational efficiency to result from reduced complexity, elimination of duplications and increased scale in the U.S. - Genentech's unique research culture to be maintained; South San Francisco site to operate as an independent research...

Impact of e-medical records will be felt at home

...rpose of research and evidence-based medicine is cumbersome, at best. And then there's the cost: old-fashioned medical records can lead to unnecessary duplications of tests and treatments, which can become expensive - not what we want when healthcare costs are skyrocketing. That's why, almost a year ago, Gov. ...

Rapid detection of genomic duplications and deletions using the Agilent 2100 bioanalyzer

... duplications and deletions are known to cause a wide variety of...ements, small (e.g. single exon) deletions and duplications are not usually detected with this method. Two ...ublished work on the analysis of deletions and duplications in the DMD geneusing MAPH3. While this concentrate...

Randomize Gene Sequences with New PCR Mutagenesis Kit

... is the product of DNA polymerase error rate and number of target duplications (Figure 2). In the GeneMorph kit, a sufficiently high...d, targets amplified from low amounts of target DNA undergo more duplications than targets amplified from high concentrations of DNA. This pri...

prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification

...tion when an RNA template is reverse transcribed with MMLV-RT (error rate of 3.3 x10 -5 /base 6 ), and then a 1-kb portion is PCR amplified for 20 duplications (10 6 -fold amplification) using Stratagenes PfuTurbo DNA polymerase (error rate of 1.3 x 10 -6 M.F./bp/duplication 7 ). The percentage of 1-kb c...

Novel PCR Enhancing Factor Improves Performance of Pfu DNA Polymerase

...mic DNA, and error rates (mutation frequency per base pair per duplication) were found to be independent of the number of target duplications (data not shown). No significant difference in error rate was observed between PfuTurbo and Pfu DNA polymerases under several di...
duplications in Biological Definition


...ed fruit fly are legs where the antennae should be, and a second pair of wings. Duplication of homeobox genes can produce new body segments, and such duplications are likely to have been important in the evolution of segmented animals. In a loose analogy to computing , one can think of a homeobox gene like ...
duplications in Biological Dictionary


...crosatellite might be a useful molecular ... Intragenic deletions and duplications that affect single or multiple exons are ... We determined the frequency of intragenic deletions and duplications in a select ... Details on Gene Mutation, Intragenic , Intergenic, Poin...

Gene family

... related genes of similar sequence and function resulting from multiple duplications and subsequent For resources and information on Family genes and Hum...Humans and Chimps Differ by 6 ... complex gene family relationships. duplications can be tandem or dispersed and can ... from gene family relationships, ...

Gene families

...of related genes of similar sequence and function resulting from multiple duplications and subsequent complex gene family relationships. duplications can be tandem or ... Higher levels of gene or protein classifica- tion,...

Gene duplication

...lication is now widely believed by Darwinists to be the main ... Gene duplications followed by subsequent mutation of the duplicated genes are often cited by treangen on 2008-11-21 09:54: ... Bibliograph on Gene and Genome duplications ... 2009 2008 2007 2006 2005 2004 2003 2002 2001 2000. 1999 1998 1997 1996 ...


...xxon ... Encyclopedia article of Exon at compiled from comprehensive and current sources. ... Antisense-induced exon skipping for duplications in Duchenne ... MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer fo...
Other Tags
(Date:4/25/2015)... 2015 The Hon. Ellen Tauscher, Independent ... the following statement following the deadly earthquake in Nepal: ... resulting in the deaths of more than 1,000 people. ... across Nepal, Bangladesh, India and other parts of South ... to the people of Nepal and the families of ...
(Date:4/25/2015)... York, NY (PRWEB) April 25, 2015 By ... technology and data for the enterprise relying on their judgement ... running smoothly. But according to an article published ... can many times actually be doing a disservice to their ... i’s are dotted and t’s are crossed when it comes ...
(Date:4/25/2015)... Parker and Sons projects growth in 2015. The demand ... alongside the growing economy. As a result, Parker and Sons ... help account for the rising need for heating, cooling, and ... we are enthusiastic about. It means growth for us, and ... and Sons. , Indeed, Parker and Sons has been contributing ...
(Date:4/25/2015)... Minnesota (PRWEB) April 25, 2015 For thirteen ... the premier income protection education event in the nation! This ... with The Plus Group, US to take DI Day on ... , George G. Davidson, CLU, ChFC, RHU, DIA, CLTC, Chief ... Cities DI Day reflects on the change by stating, "The ...
(Date:4/24/2015)... As the nation recognizes the Month ... of these young men and women, the “Alaska – ... their Families” presents a special training session on Adverse ... a better understanding of the effect of childhood trauma ... – civilian and military – who provide services and ...
Breaking Medicine News(10 mins):Health News:An Outsider’s Perspective on Cyber Security Can Only Benefit CIOs 2Health News:An Outsider’s Perspective on Cyber Security Can Only Benefit CIOs 3Health News:An Outsider’s Perspective on Cyber Security Can Only Benefit CIOs 4Health News:An Outsider’s Perspective on Cyber Security Can Only Benefit CIOs 5Health News:Parker and Sons Plans to Expand in 2015 2Health News:Secura Consultants Takes DI Day On The Road 2Health News:Coalition Presents Resiliency Training to Raise Awareness during Month of the Military Child (#MOTMC2015) 2
(Date:3/30/2015)... , Mar. 26, 2015 Research and Markets ... the "Global Gesture Recognition Market in Automotive Sector ... analysts forecast the Global Gesture Recognition market in Automotive ... the period 2013-2018. Gesture recognition is the ... different gestures of an individual. Gesture recognition technology can ...
(Date:3/24/2015)... PALM BEACH GARDENS, Fla. , March 24, ... of biometric identity management solutions, today announced that ... enabling premium clothing accessory retailer Goorin Bros ... login. The Crossmatch biometrics-based solution secures access to ... customers from the increased risk of data breaches. ...
(Date:3/20/2015)... , Mar. 20, 2015 Research and Markets ... addition of the "India Sensors Market Forecast ... The sensor market is projected to ... Consumer electronics, automotive, industrial and healthcare ... in the country. In addition, adoption of MEMS ...
Breaking Biology News(10 mins):Global Gesture Recognition Market in Automotive Sector Report 2015 - Growing Number of Partnerships 2Crossmatch Fingerprint Readers Help Retailer Prevent Data Breaches at Point-of-Sale 2India Sensors Market Forecast and Opportunities 2020 - STMicroelectronics held the largest share in 2014 2India Sensors Market Forecast and Opportunities 2020 - STMicroelectronics held the largest share in 2014 3
Other Contents