Navigation Links
Psp1406 in other areas

Restriction Endonucleases

Restriction Endonucleases > Psp1406 I. Psp1406 I. Recognition site: AACGTT. TTGCAA ... 37°C. Heat Inactivation: 65°C. Links: Psp1406 I, Fermentas. SPONSORED LINKS ...

pSOS-HUS (non-RV,Sfi I)

Qing Luo, Molecular Oncology Lab of The University of Chicago Medical Center ... Psp1406 I (1) 771. PspA I (1) 1591. Pvu I (1) 577. Pvu II (3) 808 2471 3076 ...

Vector :

Ni Tang, Molecular Oncology Lab of The University of Chicago Medical Center ... Psp1406 I (1) 6713. PspA I (3) 2564 2744 4820. Pst I (4) 2412 2439 2869 3602 ...

Digest 1 of pEXP1: 4864 bases (circular)

Psp1406 I. CGAGCATGCATCTAGGGCGGCCAATTCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCC ... Psp1406 I. BsrDI ...

Restriction Enzymes: Psp1406I (AclI)

Home. Contacts. Order. OEM. Catalog. Support. Search. Alphabetical Index. Numerical Index ... Chart (in pdf, 721 KB) Brochure (in pdf, 316 KB) Concentration. 10 u/µl ...

Genetic Studies Exposing the Splicing Events Involved in Herpes Simplex ...

... sites) and the pSG28 XhoI-Psp1406 I fragment downstream (into the XhoI ... The ends produced by Psp1406-I and SapI were filled-in with the Klenow fragment ...
Other Tags
(Date:7/30/2014)... Hawley, Pennsylvania (PRWEB) July 30, 2014 ... and have contributed over $8,500 to ensure its protection. ... Resort, presents a check to the Delaware Highlands Conservancy ... Partnership program. The small $2-per-stay donations add up fast, ... future of the Upper Delaware River Region. , The ...
(Date:7/30/2014)... West Orange, NJ. July 30, 2014. A new network ... the NIH Stroke Trials Network (NIH StrokeNet) is ... in the U.S. Despite advances of the last ... Each year, stroke causes death or disability for 795,000 ... the aging of the population. , To accelerate ...
(Date:7/30/2014)... 2014 LTC Consumer, an independent, free online ... insurance, features an Instant Quote tool on its website, ... LTC Consumer. Quotes are free and unlimited. , The ... seven areas – including age, gender, and state of residence ... (you don’t need to enter any contact information to get ...
(Date:7/30/2014)... July 30, 2014 The Institute for ... pleased to announce that Arianna Huffington has joined as a ... the Health Coach Training Program . , Arianna Huffington ... a world-renowned news and blogging site that won a Pulitzer ... of fourteen books and was included on the Forbes “Most ...
(Date:7/30/2014)... 30, 2014 (HealthDay News) -- For patients with asthma, ... to trigger airway inflammation for at least 24 hours, ... you smell, but also what you think you smell," ... Senses Center in Philadelphia, said in a Monell news ... and fragrances. When we expect that an odor is ...
Breaking Medicine News(10 mins):Health News:Pocono Mountain Resort Guests Contribute Over $8500 to Protect Land in 6 Short Months 2Health News:Kessler funded as satellite site for NIH Stroke Trials Network 2Health News:LTC Consumer Launches Online Tool for Getting Instant Long Term Care Insurance Estimates 2Health News:Arianna Huffington Joins Integrative Nutrition as a Guest Speaker 2Health News:Arianna Huffington Joins Integrative Nutrition as a Guest Speaker 3Health News:Even Thinking an Odor is Harmful May Spur Asthma Symptoms 2
(Date:7/30/2014)... spinal cord injury (SCI), traumatic brain injury (TBI) and ... has been learned over the past 30 years regarding ... regulate axon growth, but this large body of information ... Lemmon and his team from University of Miami in ... but a consensus is emerging that one contributing factor ...
(Date:7/30/2014)... The analysis of the roughly 3,000 pieces is still ... that the results will be of major significance. "Amazingly ... insect species in Fushun amber that we found in ... , The Baltic amber comes from the Baltic ... Sites rich in finds are, e.g., the coastal regions ...
(Date:7/30/2014)... unveiled the first high-resolution map of the carbon ... of Per. The new and improved methodology used ... for future market-based carbon economies. The new ... diversity and it provides the critical input to ... land use, and enforcement purposes. The technique includes ...
Breaking Biology News(10 mins):Chinese mosquitos on the Baltic Sea 2Peru's carbon quantified: Economic and conservation boon 2Peru's carbon quantified: Economic and conservation boon 3
Other Contents