Navigation Links
Dynein in Medical News

Can you hear me now? How the inner ear's sensors are made

...rling particles accumulated at the proper location to form the inner ear's crystalline sensors. "We next blocked expression of a gene that controls dynein a tiny molecular motor that drives cilia movement," said Hill. "When we examined the embryos, we saw that cilia movement came to a halt. As a result,...

Key factor in brain development revealed, offers insight into disorder

...recting the movement of a molecular motor known as dynein to the surface of both sides of the cell membrane. There, dynein takes a fixed position and, like a molecular hook,...dle of the cell toward it. Just like a pulley, dynein draws the microtubules through it and that, in tur...

Tug of war in the cells

...of-war over a cargo - for example, some of the kinesin type and some of the dynein type. The kinesin motors move to the end of the microtubule that biologists call the positive end, while the dynein motors move to the minus end. The findings of the Potsdam-based scientists ...

Alzheimer's molecule is a smart speed bump on the nerve-cell transport highway

...plays an important role in Alzheimers disease. dynein and kinesin proteins transport cellular cargo towa...ng system goes awry. The transport performed by dynein and kinesin is required for continuously providing...s, microtubules are abundantly decorated with tau. dynein and kinesin encounter the tau molecules on their t...

Discovery of Agile Molecular Motors Could Aid in Treating Motor Neuron Diseases

... rather than in one direction, as previously thought. They report their findings in a recent issue of Nature Cell Biology. The proteins in this motor, dynein and dynactin, are the “long-distance truckers” of the cell: working together, they are responsible for transporting cellular cargo from the periphery ...
Dynein in Biological News

Scientists deconstruct cell division

...artment of Embryology have found that two proteins dynein and Nudelinvolved in other cell-division functions...w isolated the spindle matrix. Interestingly, both dynein and Nudel are components of the spindle matrix. Nu...and brings it to microtubules where both Nudel and dynein then help the lamin-B assemble into the spindle ma...

Media highlights in the January issues of Biophysical Journal

... by monitoring their phosphorylation status. Likewise numerous biophysical studies have explored the mechanics of single motor proteins of the myosin, dynein and kinesin families involved. Here, a biomechanical approach is taken, where in living cells the tension of the cytoskeletal network is monitored...

Mutation may cause inherited neuropathy

... in only one copy of a gene coding for one part of dynein protein have severe defects in proprioception, the...sensory neuropathies. Mutations in the gene for dynein heavy chain 1, Dync1h, led to movement defects in ...oot deformities and various anatomic features. dynein appears to be a likely suspect, the authors report...

UNC scientists solve mystery of how largest cellular motor protein powers movement

... helps solve a scientific mystery: how the protein dynein fuels itself to perform cellular functions vital t...tosis, or cell division into identical cells. dynein uses energy derived from ATP, or adenosine triphos...comprehensive and detailed molecular structure for dynein has kept scientists largely in the dark about how ...

Discovery of agile molecular motors could aid in treating motor neuron diseases

...?rather than in one direction, as previously thought. They report their findings in a recent issue of Nature Cell Biology. The proteins in this motor, dynein and dynactin, are the "long-distance truckers" of the cell: working together, they are responsible for transporting cellular cargo from the periphery ...

A new way of looking at molecular motors

...Organisms employ all three types of motors at the same time, but in different proportions. For example, yeast uses six kinesins, five myosins, and one dynein while mammals have genes for more than 40 kinesins, 40 myosins and more than a dozen dyneins. Genetic and acquired defects in the motors cause dise...

Marathon of nano-sprinters

...ner along filaments of the cytoskeleton, consuming energy provided by the hydrolysis of ATP, which can be considered the fuel of the cell. Kinesin and dynein motors move along microtubules and myosins move along actin filaments. The step sizes of these motors are of the order of 10 nm. By stepping in a dire...

Molecular Motors Cooperate In Moving Cellular Cargo, Study Shows

...ed. "We discovered that two molecular motors -- dynein and kinesin -- do not compete for control, even th...f individual motors measured outside the cell." dynein and kinesin are biomolecular motors that haul cargo from one part of a cell to another. dynein moves material from the cell membrane to the nucle...
Dynein in Biological Technology

cMaster RTplusPCR System for increased sensitivity and product length in RT-PCR

...Factor (hTSF) mRNA, 5.3 kb fragment Mouse dynein mRNA, 12.3 kb fragment Protocol: Eppendor... Three step cycling program used for hTSF and dynein T...F reverse: TATTTCACTGACAGGCAATACCGTCCAAGG dynein forward: CGGCGCTGGAGGAGAA ...
Dynein in Biological Definition

Dynein

Dynein is a class of protein found in biological cells and is involved in their reproduction. Dyneins can be divided into two groups: cytoplasmic dynein and axonemal dynein. The axonemal dynein acts to activate a sliding within flagellar microtubules , whereas the cytoplasmic dynein is...

Cilium

...ins nine pairs of microtubule doublets and other associated proteins. Motile cilia have a central core with two additional microtubule singlets and dynein motor proteins which are attached to the outer microtubule doublets. Biologists refer to this organization as a cononical "9 + 2" structure. The ...

Flagellum

...hat the interior of the flagellum is accessible to the cell's cytoplasm . This is necessary because the flagellum's flexing is driven by the protein dynein bridging the microtubules all along its length and forcing them to slide relative to each other, and ATP must be transported to them for them to func...

List of gene families

...m proteins Major histocompatibility complex (MHC) Related protein families Motor proteins Myosin Kinesin dynein Signal transducing proteins Receptor tyrosine kinases G-proteins Transporters ABC proteins ...
Dynein in Biological Dictionary

Dynein

Dynein is a motor protein in cells which converts the chemical energy contained in ATP into the mechanical energy of movement. Dynein transports various cellular cargo by "walking" along cytoskeletal microtubules towards the... Dynein , light chain, Tctex-type 3, also known ...

Pseudogene

..... Currently, none of these pseudogene detection methods is available as a ... Human genome project: advanced genome annotation tutorial. ... dynein pseudogene consisting solely of 3' UTR. KIAA1628: annotation of unfinished contigs ... Human genome project: advanced genome annotation tutor...
Other Tags
(Date:8/30/2014)... Jake W., 18, is completing his high ... Back2Basics Outdoor Adventures transition program known as Beyond the ... I can actually start on a real career path,” said ... done.” , He has six months of sobriety under his ... choose to continue on to the Beyond the Basics transition ...
(Date:8/30/2014)... 2014 “In 2013, a vehicle crash occurred ... says in a recently released article on 2013 Washington ... in an auto accident every 12 minutes, and a motorcyclist ... “Based on the 2013 statistics, between now and this same ... The threat of an auto accident is real and impending ...
(Date:8/30/2014)... FL (PRWEB) August 30, 2014 Zensah®, the ... Camo Compression Leg Sleeve . The camo sleeves are ... Leg Sleeve collection. The camo line includes classic colors ... and magenta. , Known as tibial stress syndrome, shin ... of the lower leg. Swollen and irritated muscles, stress fractures, ...
(Date:8/30/2014)... Barton Associates, an industry leading physician, ... , announces a new office location in Keene, NH, ... headquartered in Peabody, MA, with additional staffing centers in ... Jupiter, FL. , Barton Associates made the decision to ... crisis affecting the United States, a crisis that will ...
(Date:8/30/2014)... August 30, 2014 What challenges exist ... are the latest trends, concerns, and considerations? Sports ... Ken Pendleton recently spoke with Woody Wommack, Southeast Football ... current issues in football recruiting. Notably, Wommack spoke ... athletes, changes that he thinks are coming as a ...
Breaking Medicine News(10 mins):Health News:Startling Washington Auto Accident Statistics Discussed In Recently Released Article By The Jones Firm 2Health News:Camo Compression Leg Sleeves Provide Shin Splint Relief for Runners 2Health News:Barton Associates to Open a New Office Location in Keene, NH 2Health News:Woody Wommack of Rivals.com Discusses the World of NCAA Football Recruiting on SCI TV 2Health News:Woody Wommack of Rivals.com Discusses the World of NCAA Football Recruiting on SCI TV 3
(Date:8/29/2014)... been known about what genetic changes transform wild animals ... of whom is a University of Montana assistant professor, ... the development of the brain and the nervous system ... published Aug. 28 in Science and gives ... http://www.sciencemag.org/ ., The domestication of animals and plants, ...
(Date:8/29/2014)... This news release is available in German . ... of chemical signals between organisms is considered the oldest ... social interactions between conspecifics, for example, the sexual attraction ... trigger social responses and to coordinate reproductive behavior in ... at the University of the Algarve in Faro, Portugal, ...
(Date:8/28/2014)... app called TX Invasives is now available from the ... Texas at Austin for identifying harmful non-native plant, insect ... in the United States cause about $137 billion in ... crops, clog waterways, kill native plants and more. , ... for reporting where invasive species occur, we,re more likely ...
Breaking Biology News(10 mins):New research reveals how wild rabbits were genetically transformed into tame rabbits 2New research reveals how wild rabbits were genetically transformed into tame rabbits 3Ready for mating at the right time 2Ready for mating at the right time 3Mobile app makes ID of harmful plants, insects in Texas a snap 2
Other Contents