Dynein

Can you hear me now? How the inner ear's sensors are made

...rling particles accumulated at the proper location to form the inner ear's crystalline sensors. "We next blocked expression of a gene that controls dynein a tiny molecular motor that drives cilia movement," said Hill. "When we examined the embryos, we saw that cilia movement came to a halt. As a result,...

Key factor in brain development revealed, offers insight into disorder

...recting the movement of a molecular motor known as dynein to the surface of both sides of the cell membrane. There, dynein takes a fixed position and, like a molecular hook,...dle of the cell toward it. Just like a pulley, dynein draws the microtubules through it and that, in tur...

Tug of war in the cells

...of-war over a cargo - for example, some of the kinesin type and some of the dynein type. The kinesin motors move to the end of the microtubule that biologists call the positive end, while the dynein motors move to the minus end. The findings of the Potsdam-based scientists ...

Alzheimer's molecule is a smart speed bump on the nerve-cell transport highway

...plays an important role in Alzheimers disease. dynein and kinesin proteins transport cellular cargo towa...ng system goes awry. The transport performed by dynein and kinesin is required for continuously providing...s, microtubules are abundantly decorated with tau. dynein and kinesin encounter the tau molecules on their t...

Discovery of Agile Molecular Motors Could Aid in Treating Motor Neuron Diseases

... rather than in one direction, as previously thought. They report their findings in a recent issue of Nature Cell Biology. The proteins in this motor, dynein and dynactin, are the “long-distance truckers” of the cell: working together, they are responsible for transporting cellular cargo from the periphery ...

Dynein in Biological News

Scientists deconstruct cell division

...artment of Embryology have found that two proteins dynein and Nudelinvolved in other cell-division functions...w isolated the spindle matrix. Interestingly, both dynein and Nudel are components of the spindle matrix. Nu...and brings it to microtubules where both Nudel and dynein then help the lamin-B assemble into the spindle ma...

Media highlights in the January issues of Biophysical Journal

... by monitoring their phosphorylation status. Likewise numerous biophysical studies have explored the mechanics of single motor proteins of the myosin, dynein and kinesin families involved. Here, a biomechanical approach is taken, where in living cells the tension of the cytoskeletal network is monitored...

Mutation may cause inherited neuropathy

... in only one copy of a gene coding for one part of dynein protein have severe defects in proprioception, the...sensory neuropathies. Mutations in the gene for dynein heavy chain 1, Dync1h, led to movement defects in ...oot deformities and various anatomic features. dynein appears to be a likely suspect, the authors report...

UNC scientists solve mystery of how largest cellular motor protein powers movement

... helps solve a scientific mystery: how the protein dynein fuels itself to perform cellular functions vital t...tosis, or cell division into identical cells. dynein uses energy derived from ATP, or adenosine triphos...comprehensive and detailed molecular structure for dynein has kept scientists largely in the dark about how ...

Discovery of agile molecular motors could aid in treating motor neuron diseases

...?rather than in one direction, as previously thought. They report their findings in a recent issue of Nature Cell Biology. The proteins in this motor, dynein and dynactin, are the "long-distance truckers" of the cell: working together, they are responsible for transporting cellular cargo from the periphery ...

A new way of looking at molecular motors

...Organisms employ all three types of motors at the same time, but in different proportions. For example, yeast uses six kinesins, five myosins, and one dynein while mammals have genes for more than 40 kinesins, 40 myosins and more than a dozen dyneins. Genetic and acquired defects in the motors cause dise...

Marathon of nano-sprinters

...ner along filaments of the cytoskeleton, consuming energy provided by the hydrolysis of ATP, which can be considered the fuel of the cell. Kinesin and dynein motors move along microtubules and myosins move along actin filaments. The step sizes of these motors are of the order of 10 nm. By stepping in a dire...

Molecular Motors Cooperate In Moving Cellular Cargo, Study Shows

...ed. "We discovered that two molecular motors -- dynein and kinesin -- do not compete for control, even th...f individual motors measured outside the cell." dynein and kinesin are biomolecular motors that haul cargo from one part of a cell to another. dynein moves material from the cell membrane to the nucle...

Dynein in Biological Technology

cMaster RTplusPCR System for increased sensitivity and product length in RT-PCR

...Factor (hTSF) mRNA, 5.3 kb fragment Mouse dynein mRNA, 12.3 kb fragment Protocol: Eppendor... Three step cycling program used for hTSF and dynein T...F reverse: TATTTCACTGACAGGCAATACCGTCCAAGG dynein forward: CGGCGCTGGAGGAGAA ...

Dynein in Biological Definition

Dynein

Dynein is a class of protein found in biological cells and is involved in their reproduction. Dyneins can be divided into two groups: cytoplasmic dynein and axonemal dynein. The axonemal dynein acts to activate a sliding within flagellar microtubules , whereas the cytoplasmic dynein is...

Cilium

...ins nine pairs of microtubule doublets and other associated proteins. Motile cilia have a central core with two additional microtubule singlets and dynein motor proteins which are attached to the outer microtubule doublets. Biologists refer to this organization as a cononical "9 + 2" structure. The ...

Flagellum

...hat the interior of the flagellum is accessible to the cell's cytoplasm . This is necessary because the flagellum's flexing is driven by the protein dynein bridging the microtubules all along its length and forcing them to slide relative to each other, and ATP must be transported to them for them to func...

List of gene families

...m proteins Major histocompatibility complex (MHC) Related protein families Motor proteins Myosin Kinesin dynein Signal transducing proteins Receptor tyrosine kinases G-proteins Transporters ABC proteins ...

Dynein in Biological Dictionary

Dynein

Dynein is a motor protein in cells which converts the chemical energy contained in ATP into the mechanical energy of movement. Dynein transports various cellular cargo by "walking" along cytoskeletal microtubules towards the... Dynein , light chain, Tctex-type 3, also known ...

Pseudogene

..... Currently, none of these pseudogene detection methods is available as a ... Human genome project: advanced genome annotation tutorial. ... dynein pseudogene consisting solely of 3' UTR. KIAA1628: annotation of unfinished contigs ... Human genome project: advanced genome annotation tutor...