Navigation Links
Duchenne in Medical News

Parent Project Muscular Dystrophy Awards Two End Duchenne Grants

Researchers at University of Florida -- Gainesville , University of California -- Los Angeles to Receive $250,000 For Duchenne Muscular Dystrophy Research MIDDLETOWN, Ohio, May 5 /PRNewswire-USNewswire/ -- Patricia A. Furlong, Founding President and CEO of...

First Treatment for Muscular Dystrophy in Sight: Scientists Harness Exon-Skipping in Large Animal to Successfully Treat Duchenne Muscular Dystrophy

Researchers from Children's National Medical Center and colleagues in Tokyo publish results, video of first successful trial in dogs with Duchenne muscular dystrophy Washington, DC (PRWEB) March 16, 2009 -- Genetic researchers at Children's National Medical Center and...

Different Drug May Help Children With Duchenne Muscular Dystrophy

According to a new study, the drug perindopril used in early treatment of children with Duchenne muscular dystrophy (DMD) may// delay the onset and progress of left ventricle dysfunction. DMD is one of the more common forms of muscular dystrophies that are characterized by muscle enlargement an...

BioMarin Announces Second Quarter 2009 Financial Results

...oMarin expects to communicate a decision on the future of the 6R-BH4 PAH program in the second half of 2009. BMN-195 - Utrophin upregulator for duchenne Muscular Dystrophy: BioMarin is completing formulation work and toxicology studies and expects to initiate a Phase I trial by the first quarter of 20...

Parent Project Muscular Dystrophy Holds 15th Annual Connect Conference in Atlanta

...in the United States focused on finding a cure for duchenne muscular dystrophy (Duchenne), announced that PPMD...9/DC38130LOGO ) Researchers, scientists, and duchenne experts from around the world travel to the Connec...e latest in muscular dystrophy research and care. duchenne , the most common form of childhood muscular dystr...

Clues to Muscular Dystrophy Seen in Womb

.... The scientists found a close relationship between the severity of abnormalities and the severity of later symptoms seen in two forms of the disease, duchenne muscular dystrophy (DMD) and the milder limb-girdle muscular dystrophy. Their findings were reported in the July/August issue of the journal Disea...

March of Dimes Awards $250,000 Prize to Scientists Unraveling the Causes of Muscular Dystrophy

...and limb girdle muscular dystrophy, as well as childhood conditions such as duchenne and Becker muscular dystrophies and congenital muscular dystrophy. The...fied dystrophin, the gene encoding the protein that is altered in boys with duchenne and Becker forms of muscular dystrophy. The March of Dimes Prize in De...

Muscular Dystrophy Association Launches New Venture Philanthropy

...r MVP's operating capital. Its investments will specifically focus on companies conducting commercially promising research in four disease categories: duchenne muscular dystrophy (DMD); amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease); spinal muscular atrophy (SMA); and Friedreich's ataxia, myotoni...

Researchers develop DNA 'patch' for canine form of muscular dystrophy

...sful treatment for dogs with the canine version of duchenne muscular dystrophy, a paralyzing, and ultimately f...lve many different exons. The canine version of duchenne muscular dystrophy occurs naturally in dogs, and a...orders causing muscle deterioration and weakness. duchenne muscular dystrophy occurs almost exclusively in ma...

First treatment for muscular dystrophy in sight: Scientists successfully harness exon-skipping

...exon-skipping" to curb the devastating effects of duchenne muscular dystrophy in an animal larger than a mou..., a disease which is genetically homologous to the duchenne muscular dystrophy that strikes 1 of every 3,500 b... in the United States and worldwide each year. duchenne muscular dystrophy, one of the most common lethal ...
Duchenne in Medical Technology

PTC Therapeutics Announces Data Showing Six-Minute Walk Test Consistently Measures Ambulatory Function in Patients With Duchenne Muscular Dystrophy

- Findings Suggest Clinically Meaningful Primary Endpoint for Clinical Trials; Data Presented at the 13th International World Muscle Society Congress - SOUTH PLAINFIELD, N.J., Sept. 30 /PRNewswire/ -- PTC Therapeutics, Inc. (PTC) today announced promising findings in patients with Duchenne/B...

PTC Therapeutics Announces Additional Results from Phase 2 Study of PTC124 in Duchenne Muscular Dystrophy

Data Presented at the World Muscle Society International Congress SOUTH PLAINFIELD, N.J., Oct. 18 /PRNewswire/ -- PTC Therapeutics, Inc. (PTC), a biopharmaceutical company focused on the discovery, development, and commercialization of small-molecule drugs targeting post-transcriptional con...

PTC Therapeutics Announces Pharmacokinetic and Safety Results from Phase 2 Study of PTC124 in Duchenne Muscular Dystrophy

- Data Presented at 36th Child Neurology Society Annual Meeting - SOUTH PLAINFIELD, N.J., Oct. 11 /PRNewswire/ -- PTC Therapeutics, Inc. (PTC), a biopharmaceutical company focused on the discovery, development and commercialization of small-molecule drugs targeting post-transcriptional cont...

PTC Therapeutics Announces Additional Positive Interim Phase 2 Results of PTC124 in Duchenne Muscular Dystrophy

Data Presented at 59th American Academy of Neurology Annual Meeting BOSTON and SOUTH PLAINFIELD, N.J., May 04, 2007 /PRNewswire/ -- PTC Therapeutics, Inc. (PTC), a biopharmaceutical company focused on the discovery and development of small-molecule drugs targeting post-transcriptional control proc...

PTC Therapeutics Completes Enrollment of Pivotal Trial in Muscular Dystrophy

... of its pivotal clinical trial of PTC124 in patients with nonsense mutation duchenne and Becker muscular dystrophy (nmDMD/BMD). Accrual was completed two month...e therapies for the muscular dystrophy community." About DMD/BMD duchenne and Becker muscular dystrophy (DMD/BMD) are progressive muscle disorders th...

PTC Announces Data Showing That PTC124 Causes Statistically Significant Improvements in Chloride Channel Function in Cystic Fibrosis Patients

... a review of all PTC124 studies to date, including studies in patients with duchenne muscular dystrophy, a genetic disorder that can also be caused by a nonsens...he FDA and the European Commission for the treatment of cystic fibrosis and duchenne muscular dystrophy due to nonsense mutations. The FDA has also granted PTC1...

PTC Therapeutics Announces $25 Million Award From Cystic Fibrosis Foundation Therapeutics for Development of PTC124

...translation process, preventing production of a functional protein. In Phase 2a clinical trials in nonsense-mutation-mediated cystic fibrosis (CF) and duchenne muscular dystrophy (DMD), PTC124 has demonstrated the ability to produce protein across a variety of nonsense mutation types. Across all clinical stud...

PTC Therapeutics Announces Data from Additional Clinical Studies of PTC124 in Cystic Fibrosis Confirming Activity

...g production of a functional protein. In Phase 2a clinical trials in nonsense-mutation-mediated cystic fibrosis (CF) and in nonsense-mutation-mediated duchenne muscular dystrophy (DMD), PTC124 has demonstrated the ability to produce functional protein across a variety of nonsense mutation types. Across all cl...

PTC Therapeutics Announces Initiation of Phase 2b Registration-Directed Clinical Trial of PTC124 in Duchenne/Becker Muscular Dystrophy

... well as additional proof-of-concept studies in other indications." About duchenne and Becker Muscular Dystrophy duchenne and Becker muscular dystrophy (DMD/BMD) are progressive muscle disorders th...

PTC Therapeutics Announces Publication of Preclinical Data in PNAS

...op codons. PTC124 has demonstrated pharmacodynamic proof of concept in Phase 2a clinical trials in nonsense-mutation-mediated cystic fibrosis (CF) and duchenne muscular dystrophy (DMD). It is estimated that 10% of the cases of CF and 13% of the cases of DMD are due to nonsense mutations. PTC believes that P...
Duchenne in Medical Dictionary

Muscular Dystrophies

...iated MD) refers to a group of genetic, hereditary ... The best-known type, duchenne muscular dystrophy (DMD), is inherited in an ... duchenne muscular dystrophy (DMD) is a severe recessive X-linked form of muscular...

Muscular dystrophy

...up of genetic, hereditary ... The best-known type, duchenne muscular dystrophy (DMD), is inherited in ...sive services, and public health education. In duchenne muscular dystrophy , posture changes as the chi...Y . Age of onset: Teens or early adulthood ... duchenne muscular dystrophy is caused by a mutation o...
Duchenne in Biological News

'Show me the money!' MDA greenlights grants

...n muscular dystrophy. While advances in treatment of the devastating duchenne muscular dystrophy (DMD) have prolonged boys' lives, physicians are seeing ...dy and others like it could not be done. MDA is devoted to the treatment of duchenne and the progress that has been made to this date is the result of the MDA c...

New therapy substitutes missing protein in those with muscular dystrophy

... therapy that shows potential to treat people with duchenne muscular dystrophy, a fatal disease and the most c...s the muscles in the body to progressively weaken. duchenne is the most common and severe form of childhood mu...ch most directly and simply addresses the cause of duchenne muscular dystrophy," Ervasti said. This new met...

Muscular dystrophy diagnosis delayed almost 2.5 years in boys

... Boys show signs of duchenne Muscular Dystrophy (DMD) for 2 years before they obtain a diagnosis and disease-specific treatment, about the same length of delay children have endu...

March of Dimes awards $250,000 prize to scientists unraveling the causes of muscular dystrophy

...and limb girdle muscular dystrophy, as well as childhood conditions such as duchenne and Becker muscular dystrophies and congenital muscular dystrophy. The M...fied dystrophin, the gene encoding the protein that is altered in boys with duchenne and Becker forms of muscular dystrophy. The March of Dimes Prize in Dev...

While focusing on heart disease, researchers discover new tactic against fatal muscular dystrophy

...on a striking similarity between heart disease and duchenne muscular dystrophy, researchers at Columbia Univer...first glance, heart failure and the muscle-wasting duchenne disease couldn't appear more dissimilar. duchenne affects boys usually before the age of 6, destroyi...

Cell 'anchors' required to prevent muscular dystrophy

...ht also suffer from muscular dystrophy." The team turned its attention to ankB with regard to muscle cell organization. They knew that people with duchenne muscular dystrophy were missing the protein dystrophin, and that dystrophin is needed for a protein complex to form and protect the cells' thin plasma...

Potential therapy for congenital muscular dystrophy

...a 7 integrin congenital myopathy and other muscle diseases." Dr. Burkin's group is "currently investigating the potential of this technology to treat duchenne and other forms of muscular dystrophy. This work opens a whole new modality in therapeutics, of injecting extracellular matrix proteins to treat genet...

Facial expressions of emotion are innate, not learned, says new study

...ists who lost their medal matches produced "social smiles" during the ceremony. Social smiles use only the mouth muscles whereas true smiles, known as duchenne smiles, cause the eyes to twinkle and narrow and the cheeks to rise. "Losers pushed their lower lip up as if to control the emotion on their face...

Sarcospan, a little protein for a big problem

...got its moment in the spotlight. Peter et al. now show that adding it to muscle cells might ameliorate the most severe form of muscular dystrophy. In duchenne muscular dystrophy (DMD), the mutated dystrophin protein fails to anchor correctly to its membrane glycoprotein complex. And without this anchoring, m...

Scientist clears hurdles for muscular dystrophy therapy

...nited States have some form of muscular dystrophy. duchenne muscular dystrophy (DMD) is the most common type o... heart. "The difficult challenge with treating duchenne muscular dystrophy, and other types of muscle-rela...opment raises the hope of whole body correction of duchenne muscular dystrophy." Patients with Duchnne mus...
Duchenne in Biological Technology

AMT Accesses Technology for Treatment of Duchenne Muscular Dystrophy

AMSTERDAM, The Netherlands, May 22 /PRNewswire-FirstCall/ -- Amsterdam Molecular Therapeutics (Euronext: AMT), a leader in the field of human gene therapy, today announced that it obtained a license from La Sapienza University in Rome, Italy, to their advanced small nuclear RNA (snRNA)-based e...

PTC Therapeutics Receives $2.6 Million in Government Grants

...n Products Development has awarded PTC a four-year, $1.6 million grant towards its ongoing pivotal trial of ataluren (PTC124(TM)) in nonsense mutation duchenne and Becker muscular dystrophy (nmDMD/BMD). (Logo: http://www.newscom.com/cgi-bin/prnh/20010919/PTCLOGO ) "We are honored to receive th...

BioMarin Announces First Quarter 2009 Financial Results

...to communicate a decision on the future of the 6R-BH4 cardiovascular program by the third quarter of 2009. BMN-195 - Utrophin upregulator for duchenne Muscular Dystrophy: BioMarin is completing reformulation work and toxicology studies and expects to initiate a Phase I trial by the first quarter of ...

Amsterdam Molecular Therapeutics Reports Full Year Results 2008

...O Ronald Lorijn resigned for personal reasons - Start of clinical multicenter Hemophilia B trial in 2009 - Start development of treatments for duchenne Muscular Dystrophy and Parkinson's disease - Scale up of unique and proprietary production platform to fully support worldwide commerc...

Amsterdam Molecular Therapeutics Reports Half Year Results 2008

...ybera(R) (AMT-011) for Hyperlipoproteinemia type I - European patent for treatment of Non-Alcoholic Steatotic Hepatitis - License for treatment of duchenne Muscular Dystrophy from La Sapienza University, Rome, Italy - License for prevention of immune response against treatment of Hemophilia B from 'TIG...

Genzyme Reports Strong Second-Quarter Growth

...also formed a collaboration this month with PTC Therapeutics to develop and commercialize PTC124, a novel oral therapy under development initially for duchenne muscular dystrophy and cystic fibrosis. The product has broad potential in a range of other inherited disorders. -- Genzyme continued to enroll pati...

Genzyme Corporation and PTC Therapeutics Announce Collaboration on Small Molecule for Genetic Diseases

... cystic fibrosis and in nonsense-mutation-mediated duchenne muscular dystrophy, PTC124 has demonstrated the ab...he National Center for Research Resources. About duchenne Muscular Dystrophy duchenne muscular dystrophy is characterized by rapid progr...

A New President at the Head of the Genethon Laboratory

...resident of the AFM (French Muscular Dystrophy Association) from 1981 to 2001, Bernard Barataud is the father of three children, one of whom died from duchenne myopathy in 1986 at the age of sixteen. Co-founder of the French Telethon in 1987, he was also the founder of Genethon in 1990 with the Nobel Prize wi...

PTC124 Featured at Third Annual Congress of Myology

...ww.newscom.com/cgi-bin/prnh/20010919/PTCLOGO ) PTC124 is being studied in duchenne muscular dystrophy (DMD), a progressive muscle disorder in which patients l...additional nonsense-mutation-mediated genetic disorders." About DMD/BMD duchenne and Becker muscular dystrophy (DMD/BMD) are progressive muscle disorders th...

AMT's Cooperative Research and Development Agreement With NIH to Boost Production Capacity

...al manufacturing technology developed for treating duchenne Muscular Dystrophy (DMD) by Robert Kotin, Ph.D., a...H. The scale-up is also important for treatment of duchenne Muscular Dystrophy (DMD) for which AMT has just cl...opposed to local) expression of therapeutic genes. duchenne Muscular Dystrophy is such a disease, and together...
Duchenne in Biological Definition

X chromosome

...ndrome Fabry disease fragile X syndrome hemophilia incontinentia pigmenti Lesch-Nyhan syndrome Menkes syndrome duchenne and Becker's muscular dystrophy nonsyndromic deafness and X-linked nonsyndromic deafness Rett syndrome spinal and bulbar muscular atro...
Duchenne in Biological Dictionary

Sarcoplasmic reticulum

... reticulum of the rabbit. ... The purified ATPase of sarcoplasmic reticulum exists as particles with minimum ... Sarcoplasmic Reticulum in duchenne Muscular Dystrophy ... Sarcoplasmic reticulum fragments isolated from dog cardiac muscle possess a ... The sarcoplasmic reticulum prepara...

Exon

...clopedia article of Exon at Reference.com compiled from comprehensive and current sources. ... Antisense-induced exon skipping for duplications in duchenne ... MYH7 Exon 3 ... Primers for Exon 3. bMHC 3F. tcttgactcttgagcatggtgcta (24 bp) bMHC 3R. tctgtccacccaggtgtacaggtg ... Amplimer for Exon 4 ....
Other Tags
(Date:7/11/2014)... 2014 Superior Labs announce the launch ... supplements to aid in maintaining optimal digestive health by ... metabolism of fat. Formulated and manufactured in the U.S ... is available in all-natural, vegetarian capsules, with each capsule ... Health Benefits of Artichoke Leaf Extract , Superior Labs ...
(Date:7/11/2014)... TN (PRWEB) July 11, 2014 This morning(July ... Fox 13--Good Morning Memphis to discuss the illegal immigration crisis ... border town of McAllen, Texas. , Dr. Flinn told Good ... it is absolutely wide open… The problem is that they ... influx. Thousands of people per day are coming into the ...
(Date:7/11/2014)... July 11, 2014 Yisrayl Hawkins, Pastor and ... a letter pleading to let the children from other nations, ... allowed to come. Yisrayl says President Barack Obama is fighting ... the United States, and he wants to help him. ... from Guatemala, Honduras and El Salvador being treated as if ...
(Date:7/11/2014)... 2014 Shu Cosmetic Surgery announces ... each qualifying patient undergoing a laser vaginal ... laser vaginal rejuvenation, an advanced type of vaginal ... procedure decreases the internal and external diameters of ... strength, and control, resulting in enhanced sexual gratification ...
(Date:7/11/2014)... TX (PRWEB) July 11, 2014 Based ... urgent care to residents of Brazoria County and surrounding ... that the clinic is now accessible from Northbound Highway ... as a center where patients can get low-cost urgent ... are far from rare, finding places that can match ...
Breaking Medicine News(10 mins):Health News:Artichoke Leaf Extract Released by SuperiorLabs Now Available on Amazon.com With 2 Day Prime Shipping 2Health News:Artichoke Leaf Extract Released by SuperiorLabs Now Available on Amazon.com With 2 Day Prime Shipping 3Health News:Senate Candidate, George Flinn on Fox13 NEWS About the Border Crisis 2Health News:Yisrayl Hawkins Backs Barack Obama’s Pleas to Let the Children Come to the U.S. in New Letter 2Health News:Yisrayl Hawkins Backs Barack Obama’s Pleas to Let the Children Come to the U.S. in New Letter 3Health News:Shu Cosmetic Surgery of Twin Cities Now Offers Complimentary Perineoplasty in Laser Vaginal Rejuvenation 2Health News:Shu Cosmetic Surgery of Twin Cities Now Offers Complimentary Perineoplasty in Laser Vaginal Rejuvenation 3Health News:Prime Urgent Care Announces New Access to the Clinic, Available from Northbound Highway 288 2
(Date:7/10/2014)... The Marshall Institute for Interdisciplinary Research (MIIR) ... of Medicine today announced they will be partnering ... anti-cancer drugs. , Under the agreement with Shanghai-based ... share the costs and risks of discovery and ... jointly own any intellectual property and commercialization rights ...
(Date:7/10/2014)... controversy centres around a family of enzymes known as ... group in their active site. At the centre of ... becomes oxidised (ferryl) when a reacting heme is in ... has remained unanswered for decades is whether this oxidation ... group (OH). Resolving this fundamental question has implications for ...
(Date:7/10/2014)... GOES-West satellite spotted smoke over the U.S. Mid-West ... Territories. , At 1200 UTC (8 a.m. EDT) ... of the brownish-colored haze created by forest fires ... way into South Dakota. This image was created ... Space Flight Center, Greenbelt, Md. , According ...
Breaking Biology News(10 mins):Marshall University to partner with international company in drug development venture 2Neutron crystallography solves long-standing biological mystery 2Neutron crystallography solves long-standing biological mystery 3
Other Contents