Navigation Links
AAT in Medical News

Melissa Biggs, Fashion Designer and Former Baywatch Actress, Teams with CSL Behring to Raise Awareness of Alpha-1 Antitrypsin Deficiency, a Commonly Misdiagnosed Respiratory Disease

...f of CSL Behring, and is urging Americans to get tested for alpha-1 antitrypsin (AAT) deficiency after her own diagnosis with the condition in 2005. aat deficiency (AATD), also known as Alpha-1 deficiency, is a serious, hereditary lung disease that results in progressively deteriorating lung function a...

Long-Time San Diego Community Leader, Transplant Patient, Joe Dolphin, Endorses John Mccain

...ng transplant, is also hoping to receive breath that will give him new life. The long-time San Diego community leader has suffered for many years with aat (Alpha-1 Anti-trypsin Deficiency Emphysema), a genetic lung disease which is fatal. The only effective treatment is a lung transplant. "I want my fr...

Blood Test to Detect Lung Cancer Being Eyed

.... Publishing in the Dec. 10 issue of the Journal of Clinical Oncology , researchers said a test for four blood proteins -- CEA, RBP, SCC and aat -- may provide a simple follow-up for patients who've had suspicious chest lesions detected by imaging methods such as CT scan. "CT scans have a ve...

Gene Therapy Shows Promise Against Hereditary Lung Disease

...tor of the University of North Carolina’s Gene Therapy Center. “These studies are important milestones that allow the potential for gene correction of aat to advance, as well as the (gene therapy) field in general. They also represent the step-by-step process established by the FDA and research community...

Stopping The Growth Of Viruses

...g a computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...

Stopping The Growth Of Viruses

...g a computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...

New Molecule that can stop the growth of Viruses

... computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...
AAT in Medical Technology

AlphaMed Pharmaceuticals Announces Breakthrough in the Development of Recombinant Alpha 1-Antitrypsin

...). AlphaMed scientists expressed their recombinant aat utilizing the Company's proprietary production sys..."This marks a major milestone for this company and aat research," stated Joseph McGuirl, AlphaMed's CEO, "AlphaMed is the first company to develop an aat molecule with glycosylation that resembles the hum...

Alpha-1 Foundation, AARC Cooperate on Study to Test 5,000 COPD Patients for Alpha-1

...l be encouraged to call a toll-free number to speak with the Alpha-1 genetic counselor at the Medical University of South Carolina. Epidemiology and aat genotyping for the study will be done at the University of Florida Alpha-1 Genetics Laboratory run by Mark L. Brantly, MD. Data coordination and stati...

Study Shows Need to Test More COPD and Asthma Patients for Underdiagnosed Pulmonary Disease

...AAT), suggesting the need for broader criteria for aat deficiency testing. aat deficiency, also known as Alpha-1, is a widely und... focus attention on the need for wider testing for aat deficiency. "Findings from this study suggest tha...

PARI and Kamada Announce Positive Intermediate Phase I Results for Inhaled Alpha-1 Antitrypsin

...e way to continued drug development of aerosolized aat delivered with an optimized eFlow. The study, wh...hronic replacement therapy in individuals who lack aat and have an inherited form of panacinar emphysema. Lack of aat leads to various health problems including signifi...
AAT in Biological News

Gene therapy for hereditary lung disease advances

...tor of the University of North Carolina's Gene Therapy Center. "These studies are important milestones that allow the potential for gene correction of aat to advance, as well as the (gene therapy) field in general. They also represent the step-by-step process established by the FDA and research community...
AAT in Biological Technology

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

... of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C,...

An Assessment of the Eppendorf twin.tec plate performance in PCR* applications

...mponents and cycling conditions were used: Forward primer: 5'-GAA GAG CCA AGG ACA GGT AC-3' Reverse primer: 5'-CCT CCA aat CAA GCC TCT AC-3' Reaction components for PCR: 1.68 x PCR buffer (2.5 mM MgCl2 Final) 0.2 M of each primer 0...
AAT in Biological Products

pLivSelect Cloning Kit R-B from Bio S&T

Description:... accuracy in recombinant selection. pLivSelect is also the ideal platform for robot colony picking. This cloning kit can be used for ends generated by aat II, Xma I, Nco I, Mfe I and Sac I. Dry-state and stable at room temperature....
Company:Bio S&T

pLivSelect Cloning Kit C from Bio S&T

Description:...ing kit is customized as vector DNA is digested using customer-selected group of five restriction enzymes from : Xba I, Nhe I, Hpa I, Hind III, Xho I, aat II, Xma I, Nco I, Mfe I and Sac I....
Company:Bio S&T
Other Tags
(Date:9/17/2014)... Irvington, NY (PRWEB) September 17, 2014 ... youth sports, concussion prevention is top of mind ... developed five facts to remember about concussions and ... Treatment, developed for kids, parents, coaches and teachers ... , "As a pediatric orthopedic ...
(Date:9/17/2014)... Lee Berman, a seasoned veteran of ... on The Balancing Act® airing on Lifetime Television®. Berman ... segment will premiere on September 19 and re-air on ... on Lifetime Television®' with show host Julie Moran. Berman ... over a decade and is the Director of Marketing ...
(Date:9/17/2014)... Freeslate, Inc. , the leading ... development, today announced that Baylor University acquired a ... to both support Baylor research interests and provide ... throughput system is expected to significantly accelerate innovation ... for small molecule organic chemistry. , The ...
(Date:9/17/2014)... Presence Technology, a multinational provider ... Suite 10.0, which incorporates significant enhancements to meet ... , The Contact Center Agents and Supervisors will ... get a better feel for the performance of ... and who requires additional coaching or mentoring to ...
(Date:9/16/2014)... BamboofloorChina.com, the popular online supplier of elegant bamboo items, ... bamboo floors to its product catalogue. Along with ... new items; the current discount is up to 27 ... season. Therefore, BamboofloorChina.com spares no energy to offer more ... items offered by BamboofloorChina.com are in stock and ready ...
Breaking Medicine News(10 mins):Health News:Video Helps Kids and Adults Talk About Concussion Recognition and Treatment 2Health News:Lee Berman Will Appear On The Balancing Act® airing on Lifetime Television® 2Health News:Baylor University Selects Freeslate Reaction Screening System to Support New High Throughput Screening Lab 2Health News:Presence Technology’s 10.0 Release Drives Contact Center Web Supervisor Effectiveness While Reducing Operation Costs and Delivering Enterprise Grade Scalability 2Health News:BamboofloorChina.com Announces Its Promotion For Strand Woven Bamboo Floors 2
(Date:9/16/2014)... morbidity amongst women in Australia is increased by ... today (17 September) in BJOG: An International ... generally enjoy high standards of living; however, existing ... particular between indigenous and non indigenous Australians. , ... impact of socioeconomic position on severe maternal morbidities ...
(Date:9/16/2014)... $100 trillion in cumulative public and private spending, ... 40 percent reduction of urban passenger transport emissionscould ... public transportation, walking and cycling in cities, according ... of California, Davis, and the Institute for Transportation ... estimated 1.4 million early deaths could be avoided ...
(Date:9/16/2014)... September 13, 2014. The fire is human-caused and ... acres in size and is mostly being fueled by ... Monday night due to higher humidity. Yesterday (8/15), ... to construct a fireline on the West and North sides ... the fire: , 7 20-person Crews, 4 Hot Shot Crews, ...
Breaking Biology News(10 mins):New study examines the impact of socioeconomic position & maternal morbidity in Australia 2New study examines the impact of socioeconomic position & maternal morbidity in Australia 3Global shift away from cars saves US$100 trillion, eliminates 1,700 MT of CO2 pollution 2Global shift away from cars saves US$100 trillion, eliminates 1,700 MT of CO2 pollution 3Global shift away from cars saves US$100 trillion, eliminates 1,700 MT of CO2 pollution 4Global shift away from cars saves US$100 trillion, eliminates 1,700 MT of CO2 pollution 5
Other Contents