Navigation Links
AAT in Medical News

Melissa Biggs, Fashion Designer and Former Baywatch Actress, Teams with CSL Behring to Raise Awareness of Alpha-1 Antitrypsin Deficiency, a Commonly Misdiagnosed Respiratory Disease

...f of CSL Behring, and is urging Americans to get tested for alpha-1 antitrypsin (AAT) deficiency after her own diagnosis with the condition in 2005. aat deficiency (AATD), also known as Alpha-1 deficiency, is a serious, hereditary lung disease that results in progressively deteriorating lung function a...

Long-Time San Diego Community Leader, Transplant Patient, Joe Dolphin, Endorses John Mccain

...ng transplant, is also hoping to receive breath that will give him new life. The long-time San Diego community leader has suffered for many years with aat (Alpha-1 Anti-trypsin Deficiency Emphysema), a genetic lung disease which is fatal. The only effective treatment is a lung transplant. "I want my fr...

Blood Test to Detect Lung Cancer Being Eyed

.... Publishing in the Dec. 10 issue of the Journal of Clinical Oncology , researchers said a test for four blood proteins -- CEA, RBP, SCC and aat -- may provide a simple follow-up for patients who've had suspicious chest lesions detected by imaging methods such as CT scan. "CT scans have a ve...

Gene Therapy Shows Promise Against Hereditary Lung Disease

...tor of the University of North Carolina’s Gene Therapy Center. “These studies are important milestones that allow the potential for gene correction of aat to advance, as well as the (gene therapy) field in general. They also represent the step-by-step process established by the FDA and research community...

Stopping The Growth Of Viruses

...g a computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...

Stopping The Growth Of Viruses

...g a computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...

New Molecule that can stop the growth of Viruses

... computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...
AAT in Medical Technology

AlphaMed Pharmaceuticals Announces Breakthrough in the Development of Recombinant Alpha 1-Antitrypsin

...). AlphaMed scientists expressed their recombinant aat utilizing the Company's proprietary production sys..."This marks a major milestone for this company and aat research," stated Joseph McGuirl, AlphaMed's CEO, "AlphaMed is the first company to develop an aat molecule with glycosylation that resembles the hum...

Alpha-1 Foundation, AARC Cooperate on Study to Test 5,000 COPD Patients for Alpha-1

...l be encouraged to call a toll-free number to speak with the Alpha-1 genetic counselor at the Medical University of South Carolina. Epidemiology and aat genotyping for the study will be done at the University of Florida Alpha-1 Genetics Laboratory run by Mark L. Brantly, MD. Data coordination and stati...

Study Shows Need to Test More COPD and Asthma Patients for Underdiagnosed Pulmonary Disease

...AAT), suggesting the need for broader criteria for aat deficiency testing. aat deficiency, also known as Alpha-1, is a widely und... focus attention on the need for wider testing for aat deficiency. "Findings from this study suggest tha...

PARI and Kamada Announce Positive Intermediate Phase I Results for Inhaled Alpha-1 Antitrypsin

...e way to continued drug development of aerosolized aat delivered with an optimized eFlow. The study, wh...hronic replacement therapy in individuals who lack aat and have an inherited form of panacinar emphysema. Lack of aat leads to various health problems including signifi...
AAT in Biological News

Gene therapy for hereditary lung disease advances

...tor of the University of North Carolina's Gene Therapy Center. "These studies are important milestones that allow the potential for gene correction of aat to advance, as well as the (gene therapy) field in general. They also represent the step-by-step process established by the FDA and research community...
AAT in Biological Technology

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

... of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C,...

An Assessment of the Eppendorf twin.tec plate performance in PCR* applications

...mponents and cycling conditions were used: Forward primer: 5'-GAA GAG CCA AGG ACA GGT AC-3' Reverse primer: 5'-CCT CCA aat CAA GCC TCT AC-3' Reaction components for PCR: 1.68 x PCR buffer (2.5 mM MgCl2 Final) 0.2 M of each primer 0...
AAT in Biological Products

pLivSelect Cloning Kit R-B from Bio S&T

Description:... accuracy in recombinant selection. pLivSelect is also the ideal platform for robot colony picking. This cloning kit can be used for ends generated by aat II, Xma I, Nco I, Mfe I and Sac I. Dry-state and stable at room temperature....
Company:Bio S&T

pLivSelect Cloning Kit C from Bio S&T

Description:...ing kit is customized as vector DNA is digested using customer-selected group of five restriction enzymes from : Xba I, Nhe I, Hpa I, Hind III, Xho I, aat II, Xma I, Nco I, Mfe I and Sac I....
Company:Bio S&T
Other Tags
(Date:3/3/2015)... New York, NY (PRWEB) March 03, 2015 ... sleepy this spring. Sanjeev Kothare, MD, has tips for parents. ... tired come March 8 at 2:00 a.m. when they set ... because when you wake up that day -- one hour ... sleep. , That’s why parents should start thinking about “sleep ...
(Date:3/3/2015)... Sunday, March 1, through Saturday, March 7, ... of year, every region of the country is at risk ... Amica Insurance is sharing the following tips from the ... keep you safe in the event of severe weather: , ... clothing frequently to prevent loss of body heat. Wear warm, ...
(Date:3/3/2015)... 2015 -- vRad ( Virtual Radiologic ), the nation’s ... Arlene Sussman, MD, a highly regarded breast imaging and ... explore how telemedicine best practices allow for the access ... virtually anywhere. Click here to register for ... 4, 2015 at 1:00 pm CT. , Hospitals must ...
(Date:3/3/2015)... March 03, 2015 Splashtop Inc. ... announces Mirroring360 is now available for Epson® MoverioTM BT-200 ... the Moverio Apps Market , iPod, iPhone, and ... experience to the Epson Moverio smart glasses using Mirroring360, ... , The Epson smart glasses have an ...
(Date:3/3/2015)... 2015 According to a new ... market saturation has made neurosurgery navigation system procedures ... States. Unit sales growth moderately increased in 2014, ... replace older systems, and as new technology becomes ... very much a replacement and upgrade market,” explains ...
Breaking Medicine News(10 mins):Health News:Don’t Let Daylight Savings Disrupt Your Child’s Sleep 2Health News:Amica Insurance Has Tips for National Severe Weather Preparedness Week 2Health News:Latest vRad Webinar: Building World-Class Breast Imaging Services Virtually Anywhere with Telemedicine Best Practices 2Health News:Latest vRad Webinar: Building World-Class Breast Imaging Services Virtually Anywhere with Telemedicine Best Practices 3Health News:Latest vRad Webinar: Building World-Class Breast Imaging Services Virtually Anywhere with Telemedicine Best Practices 4Health News:Splashtop’s Mirroring360 Now Available for Epson® MoverioTM BT-200 Smart Glasses, Enabling Viewing of iOS Apps and Content on Glasses 2Health News:Splashtop’s Mirroring360 Now Available for Epson® MoverioTM BT-200 Smart Glasses, Enabling Viewing of iOS Apps and Content on Glasses 3Health News:Neurosurgery Navigation System Market Reaches Saturation in the United States 2Health News:Neurosurgery Navigation System Market Reaches Saturation in the United States 3
(Date:2/5/2015)... 2015   Marvin Test Solutions , ... test solutions for military, aerospace, and manufacturing ... TS-323 GENASYS Test Platform to ... is a high-performance PXI-based system designed to ... require performance functional testing. GENASYS features a ...
(Date:2/5/2015)... 28, 2015 Research and Markets ... the "Global Biometrics Market (2014-2020): Market Forecast ... report to their offering. , ... is anticipated to overtake ... increasing government spending towards IT security, government biometric ...
(Date:1/22/2015)... Research and Markets ( http://www.researchandmarkets.com/research/4trb7t/biometrics_a ) has announced ... Overview" report to their offering. , ... an individual is who she/he is claiming to be, and ... person,s unique physical characteristics, such as fingerprint, hand or palm ...
Breaking Biology News(10 mins):Marvin Test Solutions' GENASYS Platform Advances Mission-Critical Aerospace Production Test 2Marvin Test Solutions' GENASYS Platform Advances Mission-Critical Aerospace Production Test 3Marvin Test Solutions' GENASYS Platform Advances Mission-Critical Aerospace Production Test 4Global Biometrics Market (2014-2020): Market Forecast By Technologies, Applications, End Use, Regions and Countries 2Global Biometrics Market (2014-2020): Market Forecast By Technologies, Applications, End Use, Regions and Countries 3Biometrics - A Global Market Overview 2Biometrics - A Global Market Overview 3
Other Contents