Navigation Links
AAT in Medical News

Melissa Biggs, Fashion Designer and Former Baywatch Actress, Teams with CSL Behring to Raise Awareness of Alpha-1 Antitrypsin Deficiency, a Commonly Misdiagnosed Respiratory Disease

...f of CSL Behring, and is urging Americans to get tested for alpha-1 antitrypsin (AAT) deficiency after her own diagnosis with the condition in 2005. aat deficiency (AATD), also known as Alpha-1 deficiency, is a serious, hereditary lung disease that results in progressively deteriorating lung function a...

Long-Time San Diego Community Leader, Transplant Patient, Joe Dolphin, Endorses John Mccain

...ng transplant, is also hoping to receive breath that will give him new life. The long-time San Diego community leader has suffered for many years with aat (Alpha-1 Anti-trypsin Deficiency Emphysema), a genetic lung disease which is fatal. The only effective treatment is a lung transplant. "I want my fr...

Blood Test to Detect Lung Cancer Being Eyed

.... Publishing in the Dec. 10 issue of the Journal of Clinical Oncology , researchers said a test for four blood proteins -- CEA, RBP, SCC and aat -- may provide a simple follow-up for patients who've had suspicious chest lesions detected by imaging methods such as CT scan. "CT scans have a ve...

Gene Therapy Shows Promise Against Hereditary Lung Disease

...tor of the University of North Carolina’s Gene Therapy Center. “These studies are important milestones that allow the potential for gene correction of aat to advance, as well as the (gene therapy) field in general. They also represent the step-by-step process established by the FDA and research community...

Stopping The Growth Of Viruses

...g a computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...

Stopping The Growth Of Viruses

...g a computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...

New Molecule that can stop the growth of Viruses

... computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...
AAT in Medical Technology

AlphaMed Pharmaceuticals Announces Breakthrough in the Development of Recombinant Alpha 1-Antitrypsin

...). AlphaMed scientists expressed their recombinant aat utilizing the Company's proprietary production sys..."This marks a major milestone for this company and aat research," stated Joseph McGuirl, AlphaMed's CEO, "AlphaMed is the first company to develop an aat molecule with glycosylation that resembles the hum...

Alpha-1 Foundation, AARC Cooperate on Study to Test 5,000 COPD Patients for Alpha-1

...l be encouraged to call a toll-free number to speak with the Alpha-1 genetic counselor at the Medical University of South Carolina. Epidemiology and aat genotyping for the study will be done at the University of Florida Alpha-1 Genetics Laboratory run by Mark L. Brantly, MD. Data coordination and stati...

Study Shows Need to Test More COPD and Asthma Patients for Underdiagnosed Pulmonary Disease

...AAT), suggesting the need for broader criteria for aat deficiency testing. aat deficiency, also known as Alpha-1, is a widely und... focus attention on the need for wider testing for aat deficiency. "Findings from this study suggest tha...

PARI and Kamada Announce Positive Intermediate Phase I Results for Inhaled Alpha-1 Antitrypsin

...e way to continued drug development of aerosolized aat delivered with an optimized eFlow. The study, wh...hronic replacement therapy in individuals who lack aat and have an inherited form of panacinar emphysema. Lack of aat leads to various health problems including signifi...
AAT in Biological News

Gene therapy for hereditary lung disease advances

...tor of the University of North Carolina's Gene Therapy Center. "These studies are important milestones that allow the potential for gene correction of aat to advance, as well as the (gene therapy) field in general. They also represent the step-by-step process established by the FDA and research community...
AAT in Biological Technology

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

... of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C,...

An Assessment of the Eppendorf twin.tec plate performance in PCR* applications

...mponents and cycling conditions were used: Forward primer: 5'-GAA GAG CCA AGG ACA GGT AC-3' Reverse primer: 5'-CCT CCA aat CAA GCC TCT AC-3' Reaction components for PCR: 1.68 x PCR buffer (2.5 mM MgCl2 Final) 0.2 M of each primer 0...
AAT in Biological Products

pLivSelect Cloning Kit R-B from Bio S&T

Description:... accuracy in recombinant selection. pLivSelect is also the ideal platform for robot colony picking. This cloning kit can be used for ends generated by aat II, Xma I, Nco I, Mfe I and Sac I. Dry-state and stable at room temperature....
Company:Bio S&T

pLivSelect Cloning Kit C from Bio S&T

Description:...ing kit is customized as vector DNA is digested using customer-selected group of five restriction enzymes from : Xba I, Nhe I, Hpa I, Hind III, Xho I, aat II, Xma I, Nco I, Mfe I and Sac I....
Company:Bio S&T
Other Tags
(Date:5/27/2015)... 27, 2015 Hands On HealthCare ... be offering Eco-fin Hand Treatments to spa party guests, ... paraffin wax alternative. It is a healthy, nourishing hand/foot ... emollients and pure essential oils. No petroleum, artificial dyes, ... Eco-fin treatments for our mobile spa party services ...
(Date:5/26/2015)... May 27, 2015 Avid Collector, ... his search for original Jimi Hendrix January 11-23, 1969 psychedelic ... famous "medusa" image of Hendrix for this concert ... artwork is also known as the Hendrix with ... cities over twelve days. The tour started at ...
(Date:5/26/2015)... May 27, 2015 Bellabeat, a ... for women, today announces the LEAF , ... stress, sleep, activity and ovulation. The LEAF seamlessly ... health tracking technolo- gy, particularly its mechanism for ... provide women with lifestyle data and recommendations through ...
(Date:5/26/2015)... Readers who struggle with memory , concentration ... Chester Litvin ’s new book, “ Introduction to Brain ... Publishing). , Litvin, who is a clinical psychologist, has ... book will guide readers through a series of exercises ... . He shares his patented process for reviving brain ...
(Date:5/26/2015)... Ville Platte, LA (PRWEB) May 26, 2015 ... the readers along with her as she writes an ... unusually difficult challenges in her life. The first black ... she was harassed and beaten by some students, treated ... a white woman. A motivating personal phone conversation with ...
Breaking Medicine News(10 mins):Health News:Long Island's Massage and Spa Of Commack Announces A Change To Their Spa Party Menu Of Services 2Health News:Long Island's Massage and Spa Of Commack Announces A Change To Their Spa Party Menu Of Services 3Health News:Avid Collector from Vintage Rock Posters Announces His Search for Original Jimi Hendrix January 11-23, 1969 Psychedelic German Concert Tour Posters 2Health News:Bellabeat debuts the LEAF - smart jewelry that monitors women’s health. 2Health News:Bellabeat debuts the LEAF - smart jewelry that monitors women’s health. 3Health News:Chester Litvin’s New Book Offers ‘Tune-Up’ for Brain Cells 2Health News:Chester Litvin’s New Book Offers ‘Tune-Up’ for Brain Cells 3Health News:Grace Sibley Releases Second Book, God's Unstoppable Favor 2
(Date:5/11/2015)... May 11, 2015 Curemark LLC, a privately ... of a new Phase III double blind, randomized, placebo-controlled ... formulation, CM-AT, on all children ages 3-8 with Autism. ... Phase III double blinded clinical trial for CM-AT in ... of the digestive enzyme chymotrypsin. This new trial will ...
(Date:5/8/2015)... -- Synaptics Inc. (NASDAQ: SYNA ), the leading developer ... executive management team will present at the following investor events: ... Conference Date: May 18, 2015 Time: 10:40am ET ... Cowen and Company Technology, Media & Telecom ... New York Palace Hotel, New York, NY ...
(Date:5/6/2015)... AVIV, Israel , May 6, 2015 ... world,s most established helmet producer, announced today that they ... Smart Helmet, the world,s first bio-sensing cycling helmet and ... be released in two new colors in order to ... for the product. In addition, LifeBEAM and Lazer announced ...
Breaking Biology News(10 mins):Curemark, LLC, Launches New Phase III Trial in Expanded Population of Children with Autism 2Synaptics to Present at Upcoming Investor Conferences 2LifeBEAM and Lazer Announce Expanded Partnership in Bio-Sensing Sports Gear 2LifeBEAM and Lazer Announce Expanded Partnership in Bio-Sensing Sports Gear 3
Other Contents