Navigation Links
AAT in Medical News

Melissa Biggs, Fashion Designer and Former Baywatch Actress, Teams with CSL Behring to Raise Awareness of Alpha-1 Antitrypsin Deficiency, a Commonly Misdiagnosed Respiratory Disease

...f of CSL Behring, and is urging Americans to get tested for alpha-1 antitrypsin (AAT) deficiency after her own diagnosis with the condition in 2005. aat deficiency (AATD), also known as Alpha-1 deficiency, is a serious, hereditary lung disease that results in progressively deteriorating lung function a...

Long-Time San Diego Community Leader, Transplant Patient, Joe Dolphin, Endorses John Mccain

...ng transplant, is also hoping to receive breath that will give him new life. The long-time San Diego community leader has suffered for many years with aat (Alpha-1 Anti-trypsin Deficiency Emphysema), a genetic lung disease which is fatal. The only effective treatment is a lung transplant. "I want my fr...

Blood Test to Detect Lung Cancer Being Eyed

.... Publishing in the Dec. 10 issue of the Journal of Clinical Oncology , researchers said a test for four blood proteins -- CEA, RBP, SCC and aat -- may provide a simple follow-up for patients who've had suspicious chest lesions detected by imaging methods such as CT scan. "CT scans have a ve...

Gene Therapy Shows Promise Against Hereditary Lung Disease

...tor of the University of North Carolina’s Gene Therapy Center. “These studies are important milestones that allow the potential for gene correction of aat to advance, as well as the (gene therapy) field in general. They also represent the step-by-step process established by the FDA and research community...

Stopping The Growth Of Viruses

...g a computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...

Stopping The Growth Of Viruses

...g a computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...

New Molecule that can stop the growth of Viruses

... computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...
AAT in Medical Technology

AlphaMed Pharmaceuticals Announces Breakthrough in the Development of Recombinant Alpha 1-Antitrypsin

...). AlphaMed scientists expressed their recombinant aat utilizing the Company's proprietary production sys..."This marks a major milestone for this company and aat research," stated Joseph McGuirl, AlphaMed's CEO, "AlphaMed is the first company to develop an aat molecule with glycosylation that resembles the hum...

Alpha-1 Foundation, AARC Cooperate on Study to Test 5,000 COPD Patients for Alpha-1

...l be encouraged to call a toll-free number to speak with the Alpha-1 genetic counselor at the Medical University of South Carolina. Epidemiology and aat genotyping for the study will be done at the University of Florida Alpha-1 Genetics Laboratory run by Mark L. Brantly, MD. Data coordination and stati...

Study Shows Need to Test More COPD and Asthma Patients for Underdiagnosed Pulmonary Disease

...AAT), suggesting the need for broader criteria for aat deficiency testing. aat deficiency, also known as Alpha-1, is a widely und... focus attention on the need for wider testing for aat deficiency. "Findings from this study suggest tha...

PARI and Kamada Announce Positive Intermediate Phase I Results for Inhaled Alpha-1 Antitrypsin

...e way to continued drug development of aerosolized aat delivered with an optimized eFlow. The study, wh...hronic replacement therapy in individuals who lack aat and have an inherited form of panacinar emphysema. Lack of aat leads to various health problems including signifi...
AAT in Biological News

Gene therapy for hereditary lung disease advances

...tor of the University of North Carolina's Gene Therapy Center. "These studies are important milestones that allow the potential for gene correction of aat to advance, as well as the (gene therapy) field in general. They also represent the step-by-step process established by the FDA and research community...
AAT in Biological Technology

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

... of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C,...

An Assessment of the Eppendorf twin.tec plate performance in PCR* applications

...mponents and cycling conditions were used: Forward primer: 5'-GAA GAG CCA AGG ACA GGT AC-3' Reverse primer: 5'-CCT CCA aat CAA GCC TCT AC-3' Reaction components for PCR: 1.68 x PCR buffer (2.5 mM MgCl2 Final) 0.2 M of each primer 0...
AAT in Biological Products

pLivSelect Cloning Kit R-B from Bio S&T

Description:... accuracy in recombinant selection. pLivSelect is also the ideal platform for robot colony picking. This cloning kit can be used for ends generated by aat II, Xma I, Nco I, Mfe I and Sac I. Dry-state and stable at room temperature....
Company:Bio S&T

pLivSelect Cloning Kit C from Bio S&T

Description:...ing kit is customized as vector DNA is digested using customer-selected group of five restriction enzymes from : Xba I, Nhe I, Hpa I, Hind III, Xho I, aat II, Xma I, Nco I, Mfe I and Sac I....
Company:Bio S&T
Other Tags
(Date:8/21/2014)... August 21, 2014 The results of ... in The Journal of the American Medical Association (JAMA) ... cancers and reduces unnecessary recalls. Memorial Healthcare System was ... study. , “This study confirms what we already know ... cancers we want to find and, at the same ...
(Date:8/21/2014)... According to a new market report published ... - Home Theatre in-a-box, Home audio systems, Home radios, ... Size, Share, Growth, Trends and Forecast, 2013 - 2019,” ... 2012 and is expected to reach USD 20.68 billion ... 2013 to 2019. Europe was the largest contributor to ...
(Date:8/21/2014)... Aug. 21, 2014 (HealthDay News) -- In a new ... pregnant women avoid eating tuna due to concerns about ... which is second only to shrimp as the most ... pregnant women to avoid all tuna," Jean Halloran, director ... division of Consumer Reports, said in a news release ...
(Date:8/21/2014)... 21, 2014 Pleio, Inc., a ... launching a new suite of services for retail ... retail pharmacy by applying proven behavior shaping programs ... in increased medication adherence, higher PDC scores and ... Pleio’s PDC-targeted offerings align retail’s desire to meet ...
(Date:8/21/2014)... scientific collaboration led by Baylor College of Medicine has ... a rare form of kidney cancer, providing new insights ... as well. , The collaboration, a project of the ... , completed the sequence of chromophobe renal cell carcinoma ... Cancer Cell . , "The Cancer Genome Atlas ...
Breaking Medicine News(10 mins):Health News:Dr. Mary Hayes: Study Shows 3D Mammography Finds More Invasive Cancers While Reducing Unnecessary Recalls 2Health News:Home Audio Equipment Market Expected to Reach USD 20.68 Billion in 2019 2Health News:Home Audio Equipment Market Expected to Reach USD 20.68 Billion in 2019 3Health News:Consumer Reports Advises Pregnant Women to Avoid Tuna 2Health News:Pleio, Inc. Expands Adherence Offerings For Retail Pharmacy 2Health News:Sequence of rare kidney cancer reveals unique alterations involving telomerase 2Health News:Sequence of rare kidney cancer reveals unique alterations involving telomerase 3
(Date:8/21/2014)... Nxt-ID, Inc. (OTCQB: NXTD), a biometric authentication ... today that its shares of common stock and the ... its proposed underwritten public offering of common stock and ... Capital Market, subject to closing of its proposed underwritten ... will trade under the symbol "NXTD" and "NXTDW," respectively. ...
(Date:8/21/2014)... Bacteria growing in near darkness use a previously unknown ... a research team led by a Penn State University ... further research aimed at improving plant growth, harvesting energy ... now occurring on Lake Erie and other lakes worldwide. ... the Science Express edition of the journal ...
(Date:8/21/2014)... might seem easy to ignore, but they are the ... depend upon. Humans are increasingly dependent on algae, too, ... and sink it to the bottom of the ocean. ... laboratory experiments, researchers have evidence showing that viruses infecting ... algae,s blooms, even when all else stays essentially the ...
Breaking Biology News(10 mins):Nxt-ID Approved for NASDAQ Capital Market Listing 2Nxt-ID Approved for NASDAQ Capital Market Listing 3Hot-spring bacteria reveal ability to use far-red light for photosynthesis 2Hot-spring bacteria reveal ability to use far-red light for photosynthesis 3Viruses take down massive algal blooms, with big implications for climate 2
Other Contents