Navigation Links
AAT in Medical News

Melissa Biggs, Fashion Designer and Former Baywatch Actress, Teams with CSL Behring to Raise Awareness of Alpha-1 Antitrypsin Deficiency, a Commonly Misdiagnosed Respiratory Disease

...f of CSL Behring, and is urging Americans to get tested for alpha-1 antitrypsin (AAT) deficiency after her own diagnosis with the condition in 2005. aat deficiency (AATD), also known as Alpha-1 deficiency, is a serious, hereditary lung disease that results in progressively deteriorating lung function a...

Long-Time San Diego Community Leader, Transplant Patient, Joe Dolphin, Endorses John Mccain

...ng transplant, is also hoping to receive breath that will give him new life. The long-time San Diego community leader has suffered for many years with aat (Alpha-1 Anti-trypsin Deficiency Emphysema), a genetic lung disease which is fatal. The only effective treatment is a lung transplant. "I want my fr...

Blood Test to Detect Lung Cancer Being Eyed

.... Publishing in the Dec. 10 issue of the Journal of Clinical Oncology , researchers said a test for four blood proteins -- CEA, RBP, SCC and aat -- may provide a simple follow-up for patients who've had suspicious chest lesions detected by imaging methods such as CT scan. "CT scans have a ve...

Gene Therapy Shows Promise Against Hereditary Lung Disease

...tor of the University of North Carolina’s Gene Therapy Center. “These studies are important milestones that allow the potential for gene correction of aat to advance, as well as the (gene therapy) field in general. They also represent the step-by-step process established by the FDA and research community...

Stopping The Growth Of Viruses

...g a computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...

Stopping The Growth Of Viruses

...g a computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...

New Molecule that can stop the growth of Viruses

... computer virus off from the hard drive.” Previous research has shown aat is able to block the AIDS virus in whole human blood. However, aat is not found naturally in lymph nodes -- a place where viruses grow and mul...
AAT in Medical Technology

AlphaMed Pharmaceuticals Announces Breakthrough in the Development of Recombinant Alpha 1-Antitrypsin

...). AlphaMed scientists expressed their recombinant aat utilizing the Company's proprietary production sys..."This marks a major milestone for this company and aat research," stated Joseph McGuirl, AlphaMed's CEO, "AlphaMed is the first company to develop an aat molecule with glycosylation that resembles the hum...

Alpha-1 Foundation, AARC Cooperate on Study to Test 5,000 COPD Patients for Alpha-1

...l be encouraged to call a toll-free number to speak with the Alpha-1 genetic counselor at the Medical University of South Carolina. Epidemiology and aat genotyping for the study will be done at the University of Florida Alpha-1 Genetics Laboratory run by Mark L. Brantly, MD. Data coordination and stati...

Study Shows Need to Test More COPD and Asthma Patients for Underdiagnosed Pulmonary Disease

...AAT), suggesting the need for broader criteria for aat deficiency testing. aat deficiency, also known as Alpha-1, is a widely und... focus attention on the need for wider testing for aat deficiency. "Findings from this study suggest tha...

PARI and Kamada Announce Positive Intermediate Phase I Results for Inhaled Alpha-1 Antitrypsin

...e way to continued drug development of aerosolized aat delivered with an optimized eFlow. The study, wh...hronic replacement therapy in individuals who lack aat and have an inherited form of panacinar emphysema. Lack of aat leads to various health problems including signifi...
AAT in Biological News

Gene therapy for hereditary lung disease advances

...tor of the University of North Carolina's Gene Therapy Center. "These studies are important milestones that allow the potential for gene correction of aat to advance, as well as the (gene therapy) field in general. They also represent the step-by-step process established by the FDA and research community...
AAT in Biological Technology

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

... of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase (Boehringer Mannheim, Germany). PCR was performed using a program of 45 cycles (45s 95 C,...

An Assessment of the Eppendorf twin.tec plate performance in PCR* applications

...mponents and cycling conditions were used: Forward primer: 5'-GAA GAG CCA AGG ACA GGT AC-3' Reverse primer: 5'-CCT CCA aat CAA GCC TCT AC-3' Reaction components for PCR: 1.68 x PCR buffer (2.5 mM MgCl2 Final) 0.2 M of each primer 0...
AAT in Biological Products

pLivSelect Cloning Kit R-B from Bio S&T

Description:... accuracy in recombinant selection. pLivSelect is also the ideal platform for robot colony picking. This cloning kit can be used for ends generated by aat II, Xma I, Nco I, Mfe I and Sac I. Dry-state and stable at room temperature....
Company:Bio S&T

pLivSelect Cloning Kit C from Bio S&T

Description:...ing kit is customized as vector DNA is digested using customer-selected group of five restriction enzymes from : Xba I, Nhe I, Hpa I, Hind III, Xho I, aat II, Xma I, Nco I, Mfe I and Sac I....
Company:Bio S&T
Other Tags
(Date:7/24/2014)... Mass. (PRWEB) July 24, 2014 Dr. ... Beth Israel Deaconess Medical Center in Boston, is the ... . Dr. Oettgen brings his considerable experience in the ... EBSCO Health . , Dr. Oettgen received his ... Medicine and completed his residency at Tufts New England ...
(Date:7/24/2014)... July 24, 2014 The first-ever successful ... a patient’s blood has been achieved by NFCR-supported scientist ... General Hospital. This is an important milestone on the ... selecting the best treatment for each patient. , ... “They often acquire new genetic features that make them ...
(Date:7/24/2014)... LSE Health and the European Heart Academy (EHA) ... pleased to announce the launch of a new, ... field of cardiovascular sciences. , The MSc in ... aims to equip cardiovascular specialists with the health ... take on advisory, management or leadership roles within ...
(Date:7/24/2014)... Texas at Arlington professor who co-authored a book ... in community revitalization has been awarded the Community ... Martinez-Cosio, associate professor in the School of Urban ... week at the society,s national conference, along with ... academic coordinator in the Urban Studies and Planning ...
(Date:7/24/2014)... seldom sufficient to read the declaration of contents if you ... fact, to do this you need to be a highly ... you can look directly into the molecular structure of the ... Engineering, is almost both, as he has developed a method ... biological samples. , The ,Fingerprints, of a Substance ...
Breaking Medicine News(10 mins):Health News:DynaMed™ Names Peter Oettgen, MD as Deputy Editor of Cardiology 2Health News:DynaMed™ Names Peter Oettgen, MD as Deputy Editor of Cardiology 3Health News:New Blood Test Advances Individualized Cancer Therapy and Cuts Down on Need for Painful Biopsies 2Health News:LSE and ESC announce the launch of a new executive-style MSc 2Health News:Strategy for community development partnerships earns award for UT Arlington professor 2Health News:Chemist develops X-ray vision for quality assurance 2Health News:Chemist develops X-ray vision for quality assurance 3
(Date:7/23/2014)... from North Carolina State University shows that urban "heat ... United States. One factor is that researchers have found ... the gloomy scale insect a significant tree pest ... 200 times more adult gloomy scales on urban trees. ... like the gloomy scale in cities, and now we ...
(Date:7/23/2014)... NEWPORT, Ore. -- A comprehensive 15-year analysis of the ... of the United States found that their favored feeding ... the threat of injury and mortality. , The researchers ... and San Francisco to slightly different areas at ... most abundant could significantly decrease the probability of ...
(Date:7/23/2014)... , , , , ... , , , , ... medical care is delivered could help prevent multiple chronic diseases and extend healthy lifespan. The idea, they argue, would be to target the... , ... , , , , ... , , , , , ...
Breaking Biology News(10 mins):Urban heat boosts some pest populations 200-fold, killing red maples 2Urban heat boosts some pest populations 200-fold, killing red maples 315-year analysis of blue whale range off California finds conflict with shipping lanes 215-year analysis of blue whale range off California finds conflict with shipping lanes 315-year analysis of blue whale range off California finds conflict with shipping lanes 4Strategy proposed for preventing diseases of aging 2Strategy proposed for preventing diseases of aging 3Strategy proposed for preventing diseases of aging 4Strategy proposed for preventing diseases of aging 5
Other Contents