Navigation Links
gDNA in Biological Technology

TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates

TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates Jennifer Halcome Eppendorf 5 Prime, Boulder, CO, USA Introduction Eppendorf provides a complete sy...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Introduction It is not convenient in all instances to have blood drawn for gDNA extraction. The Epp...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

Laura Pollock, Jennifer Halcome, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Abstract The Perfect gDNA Blood Mini Kit is an efficient way to purify genomic DNA from 200 l of who...

EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit Nathalie Arricau-Bouvery and Armel Souriau INRA centre of TOURS, Unit de Patholog...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume Laura Pollock and Jennifer Halcomez Eppendorf 5 Prime, Boulder, Colorado Introduction ...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

Laura Pollock and Jennifer Halcome Eppendorf 5 Prime, Inc. Introduction Buccal swabs are the least invasive way of collecting gDNA from humans, and also have the added benefit of m...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Introduction It is not convenient in all instances to have blood drawn for gDNA extraction. The Epp...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume Laura Pollock and Jennifer Halcomez Eppendorf 5 Prime, Boulder, Colorado Introduction ...

EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit Nathalie Arricau-Bouvery and Armel Souriau INRA centre of TOURS, Unit de Patholog...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

Laura Pollock, Jennifer Halcome, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Abstract The Perfect gDNA Blood Mini Kit is an efficient way to purify genomic DNA from 200 l of who...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

Laura Pollock and Jennifer Halcome Eppendorf 5 Prime, Inc. Introduction Buccal swabs are the least invasive way of collecting gDNA from humans, and also have the added benefit of m...

The World's Best DNase Improved TURBO DNA-free

...conditions, the original formulation of TURBO DNA- free reduced gdna that could be PCR amplified by 451-fold. The improved kit reduced the gdna contamination much further, by 277,000-fold, or 614 times more t...

Using the TripleMaster PCR System for Robust Amplification of GC-Rich DNA Templates

...RICH PCR System Genomic DNA isolated using the Eppendorf Perfect gdna Blood Mini Kit Eppendorf Mastercycler Gradient Thermal Cycler ...d from whole blood preserved in EDTA using the Eppendorf Perfect gdna Blood Mini Kit. The oligonucleotide primers were obtained from S...

TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR

...Plus PCR System Genomic DNA isolated using the Eppendorf Perfect gdna Blood Mini Kit Eppendorf Mastercycler Gradient Thermal Cycler ...d from whole blood preserved in EDTA using the Eppendorf Perfect gdna Blood Mini Kit. For all instances in which a competitors PCR sys...

TripleMaster PCR System: Direct Comparison with Competitors

... Experimental Setup Genomic DNA amplification Reactions were executed using 200 ng of commercially purchased human gdna (Roche). Primers targeting a 24 kb region of the human tPA gene were used. Primer sequences for the 24 kb human tPA universal forward ...

HotMasterAn innovative Hot Start/Cold Stop technology for better PCR* results

... Reverse Primer: CCTGCCCCAATCCCTTTATT Template: 50 ng human gdna HotMaster Taq and Standard Taq cycling c...d using HotMaster Taq. Based on the knowledge that 6 pg of human gdna equals one copy of the genome, serial dilutions of male DNA were...

An Assessment of the Eppendorf twin.tec plate performance in PCR* applications

...s Genomic DNA from blood was isolated using an Eppendorf Perfect gdna Blood Mini Kit. All PCR reactions were performed in four sets on...dNTPs 1.25 units Eppendorf Taq polymerase 50 ng human gdna MBGW to 25 l total reaction volume ...
Other Tags
(Date:4/13/2015)... April 13, 2015 According ... "Global Biometrics Market Forecast & Opportunities, 2020", the global ... of around 14% till 2020. The biometrics market ... scale implementation and review of biometric management systems. ... new products with greater efficiency, are resulting in ...
(Date:4/10/2015)... Research and Markets ( http://www.researchandmarkets.com/research/cjk4gb/security ) has ... - NEC" report to their offering. ... to supply a range of IT security management and ... on the development of a Big Data and cloud ... Asia-Pacific region is a core ...
(Date:4/8/2015)... CHARLOTTE, N.C. , April 8, 2015 /PRNewswire/ ... technology solutions and services, and Morpho, a leading ... in partnership to produce the market,s most advanced ... Infinisource,s iSolved NXG time clock is setting ... attendance and labor data for the small and ...
Breaking Biology News(10 mins):Global Biometrics Market to Cross US$ 21 Billion by 2020: TechSci Research 2NEC Security Competitive Profile 2015 2iSolved Time Clock Offers Unmatched Accuracy due to Morpho Biometrics 2iSolved Time Clock Offers Unmatched Accuracy due to Morpho Biometrics 3
(Date:5/4/2015)... 04, 2015 The U.S. healthcare worker ... join the ranks of senior citizens (1) and 27 ... already over-burdened healthcare system. Additionally, as older healthcare employees ... them. Per the U.S. Census Bureau, the number of ... 75% by 2050 while those 25 to 54 will ...
(Date:5/4/2015)... CA (PRWEB) May 04, 2015 ... is now offering a more comfortable and attractive alternative ... restoration of choice for those who have lost teeth. ... can feel insecure or slip at the worst possible ... eats or talks. They can also painfully pinch or ...
(Date:5/4/2015)... 2015 Pricing Healthcare announces it ... one patient receiving care at St. George Surgical Center ... must be performed by July 15th, 2015, and the patient ... up front and forego the filing of insurance claims). , ... every year, and it devastates more and more individuals and ...
(Date:5/4/2015)... Unlike some camps, the Nike Middle School Running ... goal is to educate first and train second, with a significant ... the young runners are building the knowledge base needed to have ... topics covered include Effort Based Training, Running Heroes, Running Vocabulary, and ... This is not a camp where kids come to run ...
(Date:5/4/2015)... Gettysburg, Pennsylvania (PRWEB) May 04, 2015 ... bicycle and hand cycle ride in the last decade ... after riding 110 miles in two days from the ... national non-profit saw 581 registered disabled and able-bodied participants ... Face of America recognizes and honors the commitment and ...
Breaking Medicine News(10 mins):Health News:U.S. Healthcare Worker Shortage Escalating: Sterling Warns Medical Practitioners to Rapidly Reverse Low Employee Retention 2Health News:U.S. Healthcare Worker Shortage Escalating: Sterling Warns Medical Practitioners to Rapidly Reverse Low Employee Retention 3Health News:U.S. Healthcare Worker Shortage Escalating: Sterling Warns Medical Practitioners to Rapidly Reverse Low Employee Retention 4Health News:Los Angeles Dental Implants Doctor, Kevin Sands DDS, Now Offers a More Comfortable and Aesthetically-Pleasing Solution to Denture-Wearers 2Health News:Pricing Healthcare to Pay a Patient's Bill for a Procedure at Utah Facility 2Health News:Pricing Healthcare to Pay a Patient's Bill for a Procedure at Utah Facility 3Health News:US Sports Camps and Select Nike Running Camps Offer Programs for Middle School Runners 2Health News:Gettysburg Welcomes Arriving Face of America Riders with Gala Celebration 2Health News:Gettysburg Welcomes Arriving Face of America Riders with Gala Celebration 3Health News:Gettysburg Welcomes Arriving Face of America Riders with Gala Celebration 4
Other Contents