Navigation Links
gDNA in Biological Technology

TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates

TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates Jennifer Halcome Eppendorf 5 Prime, Boulder, CO, USA Introduction Eppendorf provides a complete sy...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Introduction It is not convenient in all instances to have blood drawn for gDNA extraction. The Epp...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

Laura Pollock, Jennifer Halcome, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Abstract The Perfect gDNA Blood Mini Kit is an efficient way to purify genomic DNA from 200 l of who...

EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit Nathalie Arricau-Bouvery and Armel Souriau INRA centre of TOURS, Unit de Patholog...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume Laura Pollock and Jennifer Halcomez Eppendorf 5 Prime, Boulder, Colorado Introduction ...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

Laura Pollock and Jennifer Halcome Eppendorf 5 Prime, Inc. Introduction Buccal swabs are the least invasive way of collecting gDNA from humans, and also have the added benefit of m...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Introduction It is not convenient in all instances to have blood drawn for gDNA extraction. The Epp...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume Laura Pollock and Jennifer Halcomez Eppendorf 5 Prime, Boulder, Colorado Introduction ...

EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit Nathalie Arricau-Bouvery and Armel Souriau INRA centre of TOURS, Unit de Patholog...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

Laura Pollock, Jennifer Halcome, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Abstract The Perfect gDNA Blood Mini Kit is an efficient way to purify genomic DNA from 200 l of who...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

Laura Pollock and Jennifer Halcome Eppendorf 5 Prime, Inc. Introduction Buccal swabs are the least invasive way of collecting gDNA from humans, and also have the added benefit of m...

The World's Best DNase Improved TURBO DNA-free

...conditions, the original formulation of TURBO DNA- free reduced gdna that could be PCR amplified by 451-fold. The improved kit reduced the gdna contamination much further, by 277,000-fold, or 614 times more t...

Using the TripleMaster PCR System for Robust Amplification of GC-Rich DNA Templates

...RICH PCR System Genomic DNA isolated using the Eppendorf Perfect gdna Blood Mini Kit Eppendorf Mastercycler Gradient Thermal Cycler ...d from whole blood preserved in EDTA using the Eppendorf Perfect gdna Blood Mini Kit. The oligonucleotide primers were obtained from S...

TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR

...Plus PCR System Genomic DNA isolated using the Eppendorf Perfect gdna Blood Mini Kit Eppendorf Mastercycler Gradient Thermal Cycler ...d from whole blood preserved in EDTA using the Eppendorf Perfect gdna Blood Mini Kit. For all instances in which a competitors PCR sys...

TripleMaster PCR System: Direct Comparison with Competitors

... Experimental Setup Genomic DNA amplification Reactions were executed using 200 ng of commercially purchased human gdna (Roche). Primers targeting a 24 kb region of the human tPA gene were used. Primer sequences for the 24 kb human tPA universal forward ...

HotMasterAn innovative Hot Start/Cold Stop technology for better PCR* results

... Reverse Primer: CCTGCCCCAATCCCTTTATT Template: 50 ng human gdna HotMaster Taq and Standard Taq cycling c...d using HotMaster Taq. Based on the knowledge that 6 pg of human gdna equals one copy of the genome, serial dilutions of male DNA were...

An Assessment of the Eppendorf twin.tec plate performance in PCR* applications

...s Genomic DNA from blood was isolated using an Eppendorf Perfect gdna Blood Mini Kit. All PCR reactions were performed in four sets on...dNTPs 1.25 units Eppendorf Taq polymerase 50 ng human gdna MBGW to 25 l total reaction volume ...
Other Tags
(Date:4/18/2014)... population predicted to reach 9 billion by 2050 ... considers human-altered landscapes such as farmland, according to ... that supports it might be an increasingly scarce ... of the land surface is directly affected by ... impacts such as climate change. But what if ...
(Date:4/18/2014)... NC Seeds that sprout as soon as they,re planted ... need to be more careful. In the wild, a plant ... day would risk disaster. More than just an insurance policy ... that seed dormancy has long-term advantages too: Plants whose ... rise to more species, finds in a team of researchers ...
(Date:4/17/2014)... April 17 In the most densely forested and ... reflect two centuries of human needs, values and practices. ... clearing forests for agriculture and development, have set the ... U.S. Forest Service study reports. , The report ... and management needs in the Northern United States ...
Breaking Biology News(10 mins):Stanford researchers rethink 'natural' habitat for wildlife 2Stanford researchers rethink 'natural' habitat for wildlife 3Stanford researchers rethink 'natural' habitat for wildlife 4Plants with dormant seeds give rise to more species 2Five anthropogenic factors that will radically alter northern forests in 50 years 2Five anthropogenic factors that will radically alter northern forests in 50 years 3
(Date:4/18/2014)... University School of Medicine researchers have been awarded two-year ... Novo Nordisk announced this month. Of the 110 initial ... Biologics Science Forum Program, only four projects were funded, ... They are Jonathan Powell, M.D., Ph.D.; G. William Wong, ... Powell, a professor of oncology, will use his $500,000 ...
(Date:4/18/2014)... April 18, 2014) Benaroya Research Institute at ... how blocking a particular molecule in metastatic breast cancer ... number of lung metastases. BRI scientists have found in ... shrink tumors by 60 - 80 percent and can ... lung. The $1.8 million five-year grant comes from the ...
(Date:4/18/2014)... Diego, Calif. (April 18, 2014) ― A new study ... analyzing weekly patterns in health-related Google searches reveals a ... health strategies. , Investigators from San Diego ... and the Monday Campaigns, analyzed "healthy" Google searches (searches ... e.g., "healthy diet") originating in the U.S. from 2005 ...
(Date:4/18/2014)... Northwestern Medicine scientists could lead to potential new treatments ... with scleroderma. , Fibrosis, or scarring, is a ... skin and lungs can lead to serious organ damage ... new therapeutic options centers on findings made by Swati ... the role that a specific protein plays in promoting ...
(Date:4/17/2014)... chronic inflammation in non-cancerous prostate tissue may have nearly ... those with no inflammation, according to results of a ... Kimmel Cancer Center. , The link between persistent inflammation ... high-grade prostate cancer those with a Gleason score ... the most aggressive and rapidly growing prostate cancers. , ...
Breaking Medicine News(10 mins):Health News:Benaroya Research Institute evaluates immunology approach to blocking breast cancer 2Health News:New research shows people are thinking about their health early in the week 2Health News:New clues on tissue scarring in scleroderma 2Health News:Chronic inflammation linked to 'high-grade' prostate cancer 2Health News:Chronic inflammation linked to 'high-grade' prostate cancer 3
Other Contents