Navigation Links
gDNA in Biological Technology

TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates

TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates Jennifer Halcome Eppendorf 5 Prime, Boulder, CO, USA Introduction Eppendorf provides a complete sy...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Introduction It is not convenient in all instances to have blood drawn for gDNA extraction. The Epp...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

Laura Pollock, Jennifer Halcome, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Abstract The Perfect gDNA Blood Mini Kit is an efficient way to purify genomic DNA from 200 l of who...

EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit Nathalie Arricau-Bouvery and Armel Souriau INRA centre of TOURS, Unit de Patholog...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume Laura Pollock and Jennifer Halcomez Eppendorf 5 Prime, Boulder, Colorado Introduction ...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

Laura Pollock and Jennifer Halcome Eppendorf 5 Prime, Inc. Introduction Buccal swabs are the least invasive way of collecting gDNA from humans, and also have the added benefit of m...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Introduction It is not convenient in all instances to have blood drawn for gDNA extraction. The Epp...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume Laura Pollock and Jennifer Halcomez Eppendorf 5 Prime, Boulder, Colorado Introduction ...

EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit Nathalie Arricau-Bouvery and Armel Souriau INRA centre of TOURS, Unit de Patholog...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

Laura Pollock, Jennifer Halcome, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Abstract The Perfect gDNA Blood Mini Kit is an efficient way to purify genomic DNA from 200 l of who...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

Laura Pollock and Jennifer Halcome Eppendorf 5 Prime, Inc. Introduction Buccal swabs are the least invasive way of collecting gDNA from humans, and also have the added benefit of m...

The World's Best DNase Improved TURBO DNA-free

...conditions, the original formulation of TURBO DNA- free reduced gdna that could be PCR amplified by 451-fold. The improved kit reduced the gdna contamination much further, by 277,000-fold, or 614 times more t...

Using the TripleMaster PCR System for Robust Amplification of GC-Rich DNA Templates

...RICH PCR System Genomic DNA isolated using the Eppendorf Perfect gdna Blood Mini Kit Eppendorf Mastercycler Gradient Thermal Cycler ...d from whole blood preserved in EDTA using the Eppendorf Perfect gdna Blood Mini Kit. The oligonucleotide primers were obtained from S...

TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR

...Plus PCR System Genomic DNA isolated using the Eppendorf Perfect gdna Blood Mini Kit Eppendorf Mastercycler Gradient Thermal Cycler ...d from whole blood preserved in EDTA using the Eppendorf Perfect gdna Blood Mini Kit. For all instances in which a competitors PCR sys...

TripleMaster PCR System: Direct Comparison with Competitors

... Experimental Setup Genomic DNA amplification Reactions were executed using 200 ng of commercially purchased human gdna (Roche). Primers targeting a 24 kb region of the human tPA gene were used. Primer sequences for the 24 kb human tPA universal forward ...

HotMasterAn innovative Hot Start/Cold Stop technology for better PCR* results

... Reverse Primer: CCTGCCCCAATCCCTTTATT Template: 50 ng human gdna HotMaster Taq and Standard Taq cycling c...d using HotMaster Taq. Based on the knowledge that 6 pg of human gdna equals one copy of the genome, serial dilutions of male DNA were...

An Assessment of the Eppendorf twin.tec plate performance in PCR* applications

...s Genomic DNA from blood was isolated using an Eppendorf Perfect gdna Blood Mini Kit. All PCR reactions were performed in four sets on...dNTPs 1.25 units Eppendorf Taq polymerase 50 ng human gdna MBGW to 25 l total reaction volume ...
Other Tags
(Date:1/22/2015)... (NASDAQ: NXTD and NXTDW) a biometric authentication company focused ... the Wocket™ smart wallet at CES 2015 in Las Vegas ... of the "11 Hot Products at CES" in a review published in ... by Newseveryday.com and "The top 10 gadgets from CES 2015" by ...
(Date:1/22/2015)... , Jan. 22, 2015   EyeLock, Inc. , a ... has appointed Steve Gerber to the new role ... be responsible for leading development of mobile platforms and wearable ... of success and innovation in the semiconductor industry to his ...
(Date:12/22/2014)... , Dec. 22, 2014  The 2014 Holiday Season may ... Acuity Market Intelligence reports that the long anticipated floodgates ... that intensifying demand for smart phones, tablets, and wearable ... market of 2.5 billion users with nearly 4.8 billion ...
Breaking Biology News(10 mins):CES Response for NXT-ID's Wocket Smart Wallet Kicks Off 2015 2CES Response for NXT-ID's Wocket Smart Wallet Kicks Off 2015 3EyeLock Names Steve Gerber as Senior Vice President of Mobile and Wearables 2First Season of Holiday Shopping with Mobile Biometric Payments Wraps Up With a Present for Biometrics Industry: A Rosy Forecast for More Than 2 Billion Users of 4.8 Billion Mobile Biometric Devices by 2020 2
(Date:1/22/2015)... Oceanside,CA (PRWEB) January 22, 2015 For over 20 ... the Oceanside and Vista area has treated just about ... other personal injury circumstances. And for those same twenty-plus years, ... victims of all those injuries with the best possible doctor. ...
(Date:1/22/2015)... La Jolla, Calif. (PRWEB) January 22, 2015 ... and Assemblymembers Susan Bonilla (D-Concord) and Kristin Olsen ... (CHI) for their leadership in advancing biotechnology, biomedical ... Mitchell, Bonilla and Olsen each received the “2014 ...
(Date:1/22/2015)... WASHINGTON, DC (PRWEB) January 22, 2015 ... conditions in vulnerable communities and cause financial distress to ... report by analysts at Howard University’s Center on Race ... of dollars in economic activity, payday loans at the ...
(Date:1/22/2015)... Compare-autoinsurance.org has released a new blog post presenting a list of ... . , Some types of vehicles cannot be covered under ... blog post to see if their vehicle qualifies for auto insurance ... of the cars that cannot be covered by a plan. Clients ...
(Date:12/26/2014)... December 26, 2014 The US represents the ... report. In 2013, GlobalData’s forecast estimates that sales of branded ... market due to the high incidence of the disease, high ... 5EU, Japan, and China. Increased sales of CRC therapies over ...
Breaking Medicine News(10 mins):Health News:Industry Leading Chiropractor in Oceanside Joins the Doctors on Liens Network 2Health News:California Biomedical Community Honors Senator Holly Mitchell, Assemblymembers Susan Bonilla & Kristin Olsen 2Health News:California Biomedical Community Honors Senator Holly Mitchell, Assemblymembers Susan Bonilla & Kristin Olsen 3Health News:Howard University Spotlights the Economic Impact of Payday Lending in Southern States 2Health News:Some Vehicles Cannot Be Covered By An Auto Insurance Policy! 2Health News:US Colorectal Cancer Drug Market Analysis and Forecast to 2023 Report Available at ReportsnReports.com 2Health News:US Colorectal Cancer Drug Market Analysis and Forecast to 2023 Report Available at ReportsnReports.com 3Health News:US Colorectal Cancer Drug Market Analysis and Forecast to 2023 Report Available at ReportsnReports.com 4
Other Contents