Navigation Links
gDNA in Biological Technology

TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates

TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates Jennifer Halcome Eppendorf 5 Prime, Boulder, CO, USA Introduction Eppendorf provides a complete sy...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Introduction It is not convenient in all instances to have blood drawn for gDNA extraction. The Epp...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

Laura Pollock, Jennifer Halcome, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Abstract The Perfect gDNA Blood Mini Kit is an efficient way to purify genomic DNA from 200 l of who...

EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit Nathalie Arricau-Bouvery and Armel Souriau INRA centre of TOURS, Unit de Patholog...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume Laura Pollock and Jennifer Halcomez Eppendorf 5 Prime, Boulder, Colorado Introduction ...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

Laura Pollock and Jennifer Halcome Eppendorf 5 Prime, Inc. Introduction Buccal swabs are the least invasive way of collecting gDNA from humans, and also have the added benefit of m...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Introduction It is not convenient in all instances to have blood drawn for gDNA extraction. The Epp...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume Laura Pollock and Jennifer Halcomez Eppendorf 5 Prime, Boulder, Colorado Introduction ...

EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit Nathalie Arricau-Bouvery and Armel Souriau INRA centre of TOURS, Unit de Patholog...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

Laura Pollock, Jennifer Halcome, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Abstract The Perfect gDNA Blood Mini Kit is an efficient way to purify genomic DNA from 200 l of who...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

Laura Pollock and Jennifer Halcome Eppendorf 5 Prime, Inc. Introduction Buccal swabs are the least invasive way of collecting gDNA from humans, and also have the added benefit of m...

The World's Best DNase Improved TURBO DNA-free

...conditions, the original formulation of TURBO DNA- free reduced gdna that could be PCR amplified by 451-fold. The improved kit reduced the gdna contamination much further, by 277,000-fold, or 614 times more t...

Using the TripleMaster PCR System for Robust Amplification of GC-Rich DNA Templates

...RICH PCR System Genomic DNA isolated using the Eppendorf Perfect gdna Blood Mini Kit Eppendorf Mastercycler Gradient Thermal Cycler ...d from whole blood preserved in EDTA using the Eppendorf Perfect gdna Blood Mini Kit. The oligonucleotide primers were obtained from S...

TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR

...Plus PCR System Genomic DNA isolated using the Eppendorf Perfect gdna Blood Mini Kit Eppendorf Mastercycler Gradient Thermal Cycler ...d from whole blood preserved in EDTA using the Eppendorf Perfect gdna Blood Mini Kit. For all instances in which a competitors PCR sys...

TripleMaster PCR System: Direct Comparison with Competitors

... Experimental Setup Genomic DNA amplification Reactions were executed using 200 ng of commercially purchased human gdna (Roche). Primers targeting a 24 kb region of the human tPA gene were used. Primer sequences for the 24 kb human tPA universal forward ...

HotMasterAn innovative Hot Start/Cold Stop technology for better PCR* results

... Reverse Primer: CCTGCCCCAATCCCTTTATT Template: 50 ng human gdna HotMaster Taq and Standard Taq cycling c...d using HotMaster Taq. Based on the knowledge that 6 pg of human gdna equals one copy of the genome, serial dilutions of male DNA were...

An Assessment of the Eppendorf twin.tec plate performance in PCR* applications

...s Genomic DNA from blood was isolated using an Eppendorf Perfect gdna Blood Mini Kit. All PCR reactions were performed in four sets on...dNTPs 1.25 units Eppendorf Taq polymerase 50 ng human gdna MBGW to 25 l total reaction volume ...
Other Tags
(Date:7/31/2014)... German . ... to a sponge that soaks up liquids. Hence, these ... greenhouse gases. However, loading of many MOFs is inhibited ... now report in Nature Communications that the ... This can be prevented by water-free synthesis and storing ...
(Date:7/31/2014)... has been made to help better identify and treat those ... narrowing and enlarging of medium sized arteries in the body, ... organs causing damage. In a new report appearing in August ... scientists provide evidence that that FMD may not be limited ... a connection to abnormalities of bones and joints, as well ...
(Date:7/31/2014)... A Florida State University researcher found that bacteria in ... components of the oil released during the Deepwater Horizon ... the most toxic contaminants. , In two new studies ... Mason found a species of bacteria called Colwellia ... ethylbenzene and xylene compounds that were released as part ...
Breaking Biology News(10 mins):Free pores for molecule transport 2Scientists discover biochemical mechanisms contributing to fibromuscular dysplasia 2
(Date:7/31/2014)... Atlanta-based Jvion, a leader in clinical ... lessons in predictive population health analytics as part of ... analytics in healthcare. Ritesh Sharma, Jvion COO, commented, “it ... to understand the impact of and potential within predictive ... and a good portion of it is conflicting or ...
(Date:7/31/2014)... During the July 2014 board meeting of the ... executive director of the Mesothelioma Applied Research Foundation, Mary ... promising clinical trials to choose from than ever before. ... have been reporting increased survival and response rates. Some ... is within the field of immunotherapy. One trial, ...
(Date:7/31/2014)... ANN ARBORA new bill introduced in Congress with bipartisan ... from University of Michigan research, which could improve the ... they spend on the medicines and tests they need ... Reps. Diane Black and Earl Blumenauer, grew out of ... with the U-M,s Institute for Healthcare Policy and Innovation. ...
(Date:7/31/2014)... Jacuzzi Luxury Bath, the company ... a new and improved website to meet the needs ... Luxury Bath website has been redesigned to offer a ... represented by the company’s products. The design is current, ... bathroom applications. “The site reflects our Jacuzzi® brand standards, ...
(Date:7/31/2014)... drug, researchers at The Wistar Institute discovered that ... with fewer age-related illnesses. The mice, which lack ... degeneration, obesity, and spontaneous tumor formation when compared ... scientists view the metabolic networks within cells. ... regulator of metabolism and has been shown to ...
Breaking Medicine News(10 mins):Health News:Jvion Releases Top Three Lessons in Predictive Population Health Analytics 2Health News:Jvion Releases Top Three Lessons in Predictive Population Health Analytics 3Health News:‘More Promising Mesothelioma Clinical Trials than Ever Before,’ Says Expert 2Health News:‘More Promising Mesothelioma Clinical Trials than Ever Before,’ Says Expert 3Health News:Jacuzzi Luxury Bath Launches New and Improved Website 2Health News:'Rewired' mice show signs of longer lives with fewer age-related illnesses 2Health News:'Rewired' mice show signs of longer lives with fewer age-related illnesses 3
Other Contents