Navigation Links
gDNA in Biological Technology

TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates

TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates Jennifer Halcome Eppendorf 5 Prime, Boulder, CO, USA Introduction Eppendorf provides a complete sy...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Introduction It is not convenient in all instances to have blood drawn for gDNA extraction. The Epp...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

Laura Pollock, Jennifer Halcome, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Abstract The Perfect gDNA Blood Mini Kit is an efficient way to purify genomic DNA from 200 l of who...

EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit Nathalie Arricau-Bouvery and Armel Souriau INRA centre of TOURS, Unit de Patholog...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume Laura Pollock and Jennifer Halcomez Eppendorf 5 Prime, Boulder, Colorado Introduction ...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

Laura Pollock and Jennifer Halcome Eppendorf 5 Prime, Inc. Introduction Buccal swabs are the least invasive way of collecting gDNA from humans, and also have the added benefit of m...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Introduction It is not convenient in all instances to have blood drawn for gDNA extraction. The Epp...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume Laura Pollock and Jennifer Halcomez Eppendorf 5 Prime, Boulder, Colorado Introduction ...

EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit Nathalie Arricau-Bouvery and Armel Souriau INRA centre of TOURS, Unit de Patholog...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

Laura Pollock, Jennifer Halcome, and Michele Nelson Hurst Eppendorf 5 Prime, Inc. Abstract The Perfect gDNA Blood Mini Kit is an efficient way to purify genomic DNA from 200 l of who...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

Laura Pollock and Jennifer Halcome Eppendorf 5 Prime, Inc. Introduction Buccal swabs are the least invasive way of collecting gDNA from humans, and also have the added benefit of m...

The World's Best DNase Improved TURBO DNA-free

...conditions, the original formulation of TURBO DNA- free reduced gdna that could be PCR amplified by 451-fold. The improved kit reduced the gdna contamination much further, by 277,000-fold, or 614 times more t...

Using the TripleMaster PCR System for Robust Amplification of GC-Rich DNA Templates

...RICH PCR System Genomic DNA isolated using the Eppendorf Perfect gdna Blood Mini Kit Eppendorf Mastercycler Gradient Thermal Cycler ...d from whole blood preserved in EDTA using the Eppendorf Perfect gdna Blood Mini Kit. The oligonucleotide primers were obtained from S...

TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR

...Plus PCR System Genomic DNA isolated using the Eppendorf Perfect gdna Blood Mini Kit Eppendorf Mastercycler Gradient Thermal Cycler ...d from whole blood preserved in EDTA using the Eppendorf Perfect gdna Blood Mini Kit. For all instances in which a competitors PCR sys...

TripleMaster PCR System: Direct Comparison with Competitors

... Experimental Setup Genomic DNA amplification Reactions were executed using 200 ng of commercially purchased human gdna (Roche). Primers targeting a 24 kb region of the human tPA gene were used. Primer sequences for the 24 kb human tPA universal forward ...

HotMasterAn innovative Hot Start/Cold Stop technology for better PCR* results

... Reverse Primer: CCTGCCCCAATCCCTTTATT Template: 50 ng human gdna HotMaster Taq and Standard Taq cycling c...d using HotMaster Taq. Based on the knowledge that 6 pg of human gdna equals one copy of the genome, serial dilutions of male DNA were...

An Assessment of the Eppendorf twin.tec plate performance in PCR* applications

...s Genomic DNA from blood was isolated using an Eppendorf Perfect gdna Blood Mini Kit. All PCR reactions were performed in four sets on...dNTPs 1.25 units Eppendorf Taq polymerase 50 ng human gdna MBGW to 25 l total reaction volume ...
Other Tags
(Date:8/19/2014)... rating systems be used in supermarkets to encourage healthier ... sought to answer that very question by tracking the ... Guiding Stars System to rate the nutritional value of ... and Brand Lab,s David Just, PhD, and Brian Wansink ... sales records of over 150 Hannaford Supermarkets in the ...
(Date:8/19/2014)... lemur. It,s not an African Bush Baby or even a ... downright "cool" primate from Southeast Asia. , "It,s really not ... Brown, curator-in-charge at the University of Kansas, Biodiversity Institute. "A ... body; a long tail with a furry tuft at the ... a bit like the disks on the digits of tree ...
(Date:8/19/2014)... devised a new implantable tissue scaffold coated with bone ... weeks. When applied to bone injuries or defects, this ... bone that looks and behaves just like the original ... a dramatic improvement over the current standard for treating ... of the patient,s body a painful process that ...
Breaking Biology News(10 mins):Philippine tarsier gets boost from Kansas research, and genetic proof of a new variety 2Philippine tarsier gets boost from Kansas research, and genetic proof of a new variety 3Engineering new bone growth 2Engineering new bone growth 3
(Date:8/20/2014)... PA (PRWEB) August 20, 2014 A ... products from the blood did not improve survival chances ... analysis led by experts at the University of ... published online today in the journal PLOS One ... standardly used for people with sudden kidney failure, may ...
(Date:8/20/2014)... Steven Reinberg HealthDay Reporter ... disorder that dismantles a baby,s immune system is twice as ... 3 million infants says. This is the first evaluation ... treatable condition known as severe combined immunodeficiency (SCID), or "Bubble ... of this condition by the boy in the bubble, who ...
(Date:8/20/2014)... Caddis Partners LLC, has built one of the most ... in recent years, developing or acquiring 2 million square ... more than $100 million last year alone. , In ... geographic regions and a wider array of product types ... an enhanced brand identity that includes a new logo, ...
(Date:8/20/2014)... 20, 2014 Understanding the impact ... physician stakeholders networks impacting the launch of new ... Canada, and Emerging Markets. , This Flash Report ... on stakeholder management needs for the melanoma market. ... targeted therapy investigational agents that are further improving ...
(Date:8/20/2014)... MI (PRWEB) August 20, 2014 In its ... drug and alcohol treatment program that gets clients off to ... recovery they can believe in, is highlighting an important and ... be heeded by everyone who wants to understand the insidious ... are of the belief that drug abuse targets a certain ...
Breaking Medicine News(10 mins):Health News:Pitt Analysis Questions Use of Acute Hemodialysis Treatment 2Health News:'Bubble Boy' Disease May Be More Common Than Thought 2Health News:'Bubble Boy' Disease May Be More Common Than Thought 3Health News:Caddis Rebrands to Emphasize Its Growth, Expanded Capabilities 2Health News:Caddis Rebrands to Emphasize Its Growth, Expanded Capabilities 3Health News:Caddis Rebrands to Emphasize Its Growth, Expanded Capabilities 4Health News:Download HeartBeat Experts White Paper: A Stakeholder Engagement Strategy is Critical for the Evolving Melanoma Treatment Setting 2Health News:New A Forever Recovery Blog Post Reminds People that Drug Abuse Doesn’t Discriminate 2Health News:New A Forever Recovery Blog Post Reminds People that Drug Abuse Doesn’t Discriminate 3
Other Contents