Navigation Links
Cat in Biological Technology

Time Clocks Technology Catches Up With Crooks

...ere you are, from anywhere on the web, at anytime! Sydney, NSW (PRWEB) July 24, 2009 -- Technology is putting an end to the cat and mouse game of sneaking in late to work - the mouse is caught at the door, in the back room, or on pay day! We rounded up a group of intuitive empl...

New Discoveries on a Fingertip Test for Screening Silent Heart Disease Promising Results of Recent Clinical Studies to be Presented during the 2009 American College of Cardiology Conference, March 29th - April 1st in Orlando

... factor measurements as well as advanced, structural imaging tests, such as cat scan and MRI. "I acknowledge that it doesn't seem logical that mea...h as high cholesterol) or advanced, non-invasive imaging techniques such as cat scan and MRI. While traditional risk factors are good for long-term predict...

Diagnostic Imaging - Enters Purchase Agreement to Acquire Teleradiology Company

...ered a purchase agreement to acquire Canadian Teleradiology Services (CTS). CTS specializes in Teleradiology, the remote readings of MRI's, CT, PET, cat and X-rays. This service allows hospitals in remote areas to provide radiology services to its indigenous community 24hrs per day. In large population...

Humanitarian Offers $75 Million for Single Dose Sterilization of Cats and Dogs

... introduction of methods to non-surgically sterilize dogs and cats and to support the distribution and promotion of these products to humanely control cat and dog populations worldwide. ACC&D's Board of Advisors include leading scientists, veterinarians and animal health industry experts as well as senio...

New Innovation Set to Revolutionise Spray Technology - Used to Protect Against the Scottish Biting Midge & Help Fight MRSA in the NHS

...de; and is endorsed by Allergy UK for helping to remove house dust mite and cat allergen from the air. Test show that once removed, particles are suppresse.... Cleanaer is endorsed by Allergy UK for the removal of house dust mite and cat allergen, for a room up to seventeen cubic meters. This size is the standar...

UA optical scientists add new, practical dimension to holography

...d be for medicine. "Three-dimensional imaging techniques are already commonly used in medicine, for example, in MRI (Magnetic Resonance Imaging) or cat scan (Computerized Axial Tomography) techniques," Tay said. "However, the huge amount of data that is created in three dimensions is still being displ...

China Agro-Technology Appoints New CEO

...bruary 2008. Mr. Cantonnet is based in New York. cat is a leading agro-biotechnology company listed on ... of US$35 million and net income of US$32 million. cat promotes ecologically sustainable technology to me...nd serving the acute demands for paper products. cat is primarily involved in the ownership, management...

Circassia Raises GBP11 Million ($21.8 Million) in Oversubscribed Second Round Funding

...ary 2007. During the last year the company has finalised preparations to complete the phase II clinical testing programme for its lead product against cat dander allergy, and finalised the acquisition of its ToleroTrans organ anti-rejection technology. Following this second investment round, Circassia ha...

Biomerica Introduces a New 15 Minute Home Test for Allergies to Cats and Receives CE Mark Approval for Home Use

...tely 10 million people in the U.S. are allergic to cat dander, the most common pet allergy. cat allergies are about twice as common as dog allergi... various European countries." Biomerica's Fortel cat allergy test utilizes an advanced technology that ...

What To Do When a Holiday Guest Shows Up With a Pet

... surroundings? -- Where would the animal stay? Indoors or outdoors? Confined or allowed to roam? -- What if the dog barks too much or the cat scratches furniture? -- Will anyone participating in the holiday festivities have pet allergies? -- Are you willing to risk a friendship if y...

Make way for the real nanopod

...ctual design and construction of the radio. We started out by making an exceptionally sensitive force sensor, Jensen said. Nanotubes are like tiny cat whiskers. Small forces, on the order of attonewtons, cause them to deflect a significant amount. By detecting this deflection, you can infer what forc...

AstraZeneca Bolsters Its Worldwide Biologics Division Through Integration of Cambridge Antibody Technology Into MedImmune

... interim site head in Cambridge. Dr. Stageman commented, "AstraZeneca's biologics capabilities have been enhanced significantly by the acquisitions of cat and MedImmune to create a more robust, highly competitive and fully integrated biotechnology business. The scientific, technical and medical expertise...

One Year On, ALLERCA Hypoallergenic Cats Bring 'Sneeze Free' Companionship to Allergy and Asthma Sufferers

... time have allowed severely allergic and asthmatic cat lovers to enjoy the companionship of a furry friend. For Jill Skibba of Los Angeles, an ALLERCA cat was her only option to own anything but a pet fish...Smith of Connecticut was one of the first allergic cat lovers to sign up with ALLERCA, placing her order ...

Scientists say sabercat bit like a pussycat

... In public imagination, the sabre-toothed cat Smilodon ranks alongside Tyrannosaurus rex as the ...ctures, and to apply the technique to a fossil big cat required some tricks engineers usually have to han...ould have seriously limited the big toothed fossil cat cat to a very specific range of killing behaviours...

The Role of Engineering in Health Science and Technology

...area, and associated increase in transistor-switching speed, in integrated circuits provides the computing power to enable real-time three-dimensional cat (computer-aided tomography) scans to check for diseased or abnormal organs. A similar exponential growth in communication bandwidth provides the capa...

Wisconsins insurance companies use advanced IT to speed relief

...y sustains itself as a mini-office, said Wendy Scheper, catastrophe claims manager for American Family. They can be there in a matter of hours. The cat Trailer has responded to large-scale weather events in the past, including the Ladysmith Wisconsin tornado in 2002, which heavily damaged much of the ...

Google delves deep within your computer with new desktop tool

...deep within your very own computer rather than just the puny recesses of the rest of the world. Sure, you can find 60 million instances of the word cat within the 4.2 billion Web pages currently spidered by Google , but how easy is it to find that special phone number you typed in 1997 and stored som...

Wisconsin doctors pinpoint cancer with TomoTherapy radiation treatment

...lt to treat by normal means. In the TomoTherapy system, patients lie on a table that goes through a rotating tunnel, similar to the procedure for a cat scan. As they pass through the system, the tunnel walls rotate in a spiral pattern, sending radiation beams at an infinite number of angles to reach t...

Living the sweet life... in IT?

...nference call and some project planning, I couldn't help but notice the yellow finches zipping in and out from the feeder and one particularly spoiled cat stretched out in the sun to the fullest extent of the law. In the middle of this good day I picked up on a story comparing our U.S. lifestyle to the "...

Debate over `intelligent design' is a not-so-wise diversion from science education

... Madison, Wis. - The day an archeologist finds a fossil cat or dog in Precambrian rock is the day Charles Darwin's evolution theory is disproved. But that hasn't happened. In fact, the Earth's fossil records te...

Is Google's cafeteria a competitive weapon?

...are de rigueur fashion at Google Labs), taking short naps to enhance the information processing capacity of the brain (Google Labs' engineers can take cat naps whenever necessary as long as they "refrain from drooling on their keyboards"), exercising to increase blood flow to the brain (Google's campus o...

2006: A mixed blessing for Midwest life science companies

...suf Islam does not ring any bells, try this name: cat Stevens . As we have heard a lot from Clapton ...rs, and virtually nothing for almost 30 years from cat Stevens, I will focus my comments on the latter in...ight of the anti-Vietnam War movement in the U.S., cat Stevens' music seemed to be a dominant force in ou...

Monitoring Receptor-Mediated Changes in [Ca2+]i Using Single-Wavelength and Dual-Wavelength Indicators on the FlexStation Workstation

... FlexStation Calcium Assay Kit (Molecular Devices, cat # R8041), ATP (Adenosine 5'-triphosphate disodium salt, Sigma, cat # A2383), probenecid (Sigma, cat # P8761), DMSO, low water content (Sigma,...

Luciferase Reporter Gene Cells and Recombinant Luciferase Dilutions Studied with the CLIPR Luciferase Assay Kit and the LMax Microplate Luminometer (MaxLine Application Note #38)

...ATERIALS 1. Lmax microplate luminometer with SOFTmax PRO for Lmax (Molecular Devices Corp.) 2. Recombinant Firefly Luciferase, Sigma cat # 9506. 3. CLIPR Luciferase Assay Kit, Cat. No. R 8032; Molecular Devices Corporation; 1-800-635-5577. The kit contains luciferin (lyophilized) a...

Dual-Luciferase Quantitation in the LMax Microplate Luminometer (MaxLine Application Note #39)

... 1. Dual-Luciferase Reporter Assay System kit, cat #E1960; Promega Corporation. The contents include:...ent (E194A). 2. Firefly Luciferase, Sigma cat # 9506. 3. Recombinant Renilla luciferase; Novalite, cat #4400; Chemicon International; 800-437-7500. ...

High Sensitivity, Wide Dynamic Range, Horseradish Peroxidase (HRP) ELISA Using the LMax Microplate Luminometer (MaxLine Application Note #41)

... LMax microplate luminometer with SoftMax Pro for LMax (Molecular Devices Corp.) 2. QuantiGlo Human TNF-α Immunoassay kit (R&D Systems1, cat #QTA50). The kit contains all reagents and standards needed for the assay, including the polystyrene microplate (12 strips of 8 wells@) pre-treated wi...

Quantitative Analysis of the Cell Cycle in Imaging Applications

... metabolic inhibitors, aphidicolin (Sigma-Aldrich, A0781), a DNA topoisomerase alpha inhibitor (G1/S blocker) for two hours or colcemid (Sigma-Aldrich cat # D7385) a (G2/ M blocker for two hours. During drug treatment, cells were cocultured with 20 μM BrdU (Calbiochem, 203806) (a thymidine analogue ...

Transgenic Zebrafish by Electroporation

...hapter 9, 1989) in 6x SSC for 2 hours at 68 C. The cat gene (1.6 kb) is cut out of a plasmid v....6, and the soluble proteins tested for cat enzyme activity (Neumann, J. R., et al., BioTechni... Figure 3 shows the results of a cat enzyme assay of the soluble proteins of...

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

...Nonidet, 0.2 mM each dNTP and 2 mM MgCl 2 . The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase ...

Translate High Yields of Active Protein

... Autoradiograph of 35 S-labeled GFP and cat proteins that were in vitro transcribed...using the method described by Shaw [1] to evaluate cat activity. Figure...d total protein yields were calculated. cat activity was measured using methods described by S...

RNAi: Get the Whole Story

...radiolabeled RNA probe transcribed from pTRI-GAPDH human (Ambion cat #7430). For the Western blot, anti-GAPDH antibody (Ambion cat #4300) was used. Figure 2 also pr...

pSilencer 4.1-CMV: Versatile Vectors for Expression of siRNA, miRNA, and mRNA

...close correlation between luciferase or cat gene transcript levels and the enzymatic activity ...ors carrying either a firefly luciferase cDNA or a cat cDNA. (A) Relative luciferase activit...ours after transfection. (B) Relative cat activity 48 hours after transfection. NT = not tra...

Transfection Reagent Selector Kit Handbook

...ample, cells transfected with -gal or cat reporter constructs are typically incubated for 24...cetyl-coenzyme A to chloramphenicol. In the common cat assay, cell lysates prepared from transfe...in-layer chromatography. A qualitative estimate of cat activity can be obtained simply by exposi...

Genetic Reporter Systems

...coenzyme A to chloramphenicol. With the cat assay, the CAT-containing lysates of transfected ... increasingly common, non-radioactive alternative, cat expression is quantified by an ELISA via immunological detection of the cat enzyme which has been expressed. ...

Genetic Reporter Systems

...coenzyme A to chloramphenicol. With the cat assay, the CAT-containing lysates of transfected ... increasingly common, non-radioactive alternative, cat expression is quantified by an ELISA via immunological detection of the cat enzyme which has been expressed. ...
Other Tags
(Date:8/29/2014)... In a cell,s nucleus, chromosomal DNA is tightly ... amalgam biologists call chromatin. Until about two decades ... the mere packing material around which the glamorous ... developed a greater appreciation for how DNA/histone interactions ... multiple research institutions studying the sequence of the ...
(Date:8/29/2014)... Colo., USA - The rise of the Tibetan plateau ... Earth -- is important for both its profound effect ... this study published in GSA Bulletin , Katharine ... "clumped" isotope thermometry -- using modern and fossil snail ... basin in southwestern Tibet. , Views range widely ...
(Date:8/28/2014)... pleased to announce the selection of Dr. Fred Baxendale ... acknowledges those who have served ESA for at least ... the Society that has reached an extraordinary level. Candidates ... Board and then voted on by the ESA membership. ... at Entomology 2014, ESA,s Annual Meeting in Portland, Oregon ...
Breaking Biology News(10 mins):'K-to-M' histone mutations: How repressing the repressors may drive tissue-specific cancers 2'K-to-M' histone mutations: How repressing the repressors may drive tissue-specific cancers 3Snails tell of the rise and fall of the Tibetan Plateau 2Snails tell of the rise and fall of the Tibetan Plateau 3Snails tell of the rise and fall of the Tibetan Plateau 4Snails tell of the rise and fall of the Tibetan Plateau 5Snails tell of the rise and fall of the Tibetan Plateau 6Snails tell of the rise and fall of the Tibetan Plateau 7Fred Baxendale selected as Honorary Member of the Entomological Society of America 2
(Date:8/30/2014)... 30, 2014 The term nutraceuticals ... Pharameuticals. Nutraceuticals is a source of healthy-dietary supplements ... natural food sources. Nutraceutical ingredients have certain curative ... human body. Nutraceutical health products include factors such ... and more. Although nature is the most bountiful ...
(Date:8/30/2014)... Acne is a common problem millions of American ... more than a daily nuisance, for some, it can have a ... can even lead to dramatic mood swings and depression. , ... clear up their skin. In some cases, that can make the ... and error, those on a quest for clearer skin can now ...
(Date:8/30/2014)... August 30, 2014 Continuing to meet ... is expanding with the addition of a new doctor ... who has provided leading-edge skin care in Grand Rapids ... , “As a doctor, my passion is making ... partnering with Forefront Dermatology, I’m better able to focus ...
(Date:8/30/2014)... commonly used to treat gout, before and after ... complications from this type of surgery, but it ... according to a study published by JAMA ... to coincide with its presentation at the European ... cardiac surgery include postpericardiotomy syndrome (the occurrence of ...
(Date:8/30/2014)... York, New York (PRWEB) August 30, 2014 ... litigation for transvaginal mesh lawsuits ( http://www.injurybeacon.com/transvaginal-mesh/ ) ... company’s request to sever four cases selected for ... an Order issued on August 18, 2014, U.S. ... District of West Virginia disagrees with Boston Scientific’s ...
Breaking Medicine News(10 mins):Health News:A Granular Analysis of the Nutraceutical Ingredients Market by Transparency Market Research 2Health News:A Granular Analysis of the Nutraceutical Ingredients Market by Transparency Market Research 3Health News:A Granular Analysis of the Nutraceutical Ingredients Market by Transparency Market Research 4Health News:Acne Treatment Reviews Added to Popular Treatment Website 2Health News:Expanding Care at the Forefront of Dermatology 2Health News:Medication shows mixed results in reducing complications from cardiac surgery 2Health News:Transvaginal Mesh Lawsuit News: Federal Judge Refuses Boston Scientific Request for Separate Trials in Four Bellwether Cases, Bernstein Liebhard LLP Reports 2Health News:Transvaginal Mesh Lawsuit News: Federal Judge Refuses Boston Scientific Request for Separate Trials in Four Bellwether Cases, Bernstein Liebhard LLP Reports 3
Other Contents