Navigation Links
Cat in Biological Technology

Time Clocks Technology Catches Up With Crooks

...ere you are, from anywhere on the web, at anytime! Sydney, NSW (PRWEB) July 24, 2009 -- Technology is putting an end to the cat and mouse game of sneaking in late to work - the mouse is caught at the door, in the back room, or on pay day! We rounded up a group of intuitive empl...

New Discoveries on a Fingertip Test for Screening Silent Heart Disease Promising Results of Recent Clinical Studies to be Presented during the 2009 American College of Cardiology Conference, March 29th - April 1st in Orlando

... factor measurements as well as advanced, structural imaging tests, such as cat scan and MRI. "I acknowledge that it doesn't seem logical that mea...h as high cholesterol) or advanced, non-invasive imaging techniques such as cat scan and MRI. While traditional risk factors are good for long-term predict...

Diagnostic Imaging - Enters Purchase Agreement to Acquire Teleradiology Company

...ered a purchase agreement to acquire Canadian Teleradiology Services (CTS). CTS specializes in Teleradiology, the remote readings of MRI's, CT, PET, cat and X-rays. This service allows hospitals in remote areas to provide radiology services to its indigenous community 24hrs per day. In large population...

Humanitarian Offers $75 Million for Single Dose Sterilization of Cats and Dogs

... introduction of methods to non-surgically sterilize dogs and cats and to support the distribution and promotion of these products to humanely control cat and dog populations worldwide. ACC&D's Board of Advisors include leading scientists, veterinarians and animal health industry experts as well as senio...

New Innovation Set to Revolutionise Spray Technology - Used to Protect Against the Scottish Biting Midge & Help Fight MRSA in the NHS

...de; and is endorsed by Allergy UK for helping to remove house dust mite and cat allergen from the air. Test show that once removed, particles are suppresse.... Cleanaer is endorsed by Allergy UK for the removal of house dust mite and cat allergen, for a room up to seventeen cubic meters. This size is the standar...

UA optical scientists add new, practical dimension to holography

...d be for medicine. "Three-dimensional imaging techniques are already commonly used in medicine, for example, in MRI (Magnetic Resonance Imaging) or cat scan (Computerized Axial Tomography) techniques," Tay said. "However, the huge amount of data that is created in three dimensions is still being displ...

China Agro-Technology Appoints New CEO

...bruary 2008. Mr. Cantonnet is based in New York. cat is a leading agro-biotechnology company listed on ... of US$35 million and net income of US$32 million. cat promotes ecologically sustainable technology to me...nd serving the acute demands for paper products. cat is primarily involved in the ownership, management...

Circassia Raises GBP11 Million ($21.8 Million) in Oversubscribed Second Round Funding

...ary 2007. During the last year the company has finalised preparations to complete the phase II clinical testing programme for its lead product against cat dander allergy, and finalised the acquisition of its ToleroTrans organ anti-rejection technology. Following this second investment round, Circassia ha...

Biomerica Introduces a New 15 Minute Home Test for Allergies to Cats and Receives CE Mark Approval for Home Use

...tely 10 million people in the U.S. are allergic to cat dander, the most common pet allergy. cat allergies are about twice as common as dog allergi... various European countries." Biomerica's Fortel cat allergy test utilizes an advanced technology that ...

What To Do When a Holiday Guest Shows Up With a Pet

... surroundings? -- Where would the animal stay? Indoors or outdoors? Confined or allowed to roam? -- What if the dog barks too much or the cat scratches furniture? -- Will anyone participating in the holiday festivities have pet allergies? -- Are you willing to risk a friendship if y...

Make way for the real nanopod

...ctual design and construction of the radio. We started out by making an exceptionally sensitive force sensor, Jensen said. Nanotubes are like tiny cat whiskers. Small forces, on the order of attonewtons, cause them to deflect a significant amount. By detecting this deflection, you can infer what forc...

AstraZeneca Bolsters Its Worldwide Biologics Division Through Integration of Cambridge Antibody Technology Into MedImmune

... interim site head in Cambridge. Dr. Stageman commented, "AstraZeneca's biologics capabilities have been enhanced significantly by the acquisitions of cat and MedImmune to create a more robust, highly competitive and fully integrated biotechnology business. The scientific, technical and medical expertise...

One Year On, ALLERCA Hypoallergenic Cats Bring 'Sneeze Free' Companionship to Allergy and Asthma Sufferers

... time have allowed severely allergic and asthmatic cat lovers to enjoy the companionship of a furry friend. For Jill Skibba of Los Angeles, an ALLERCA cat was her only option to own anything but a pet fish...Smith of Connecticut was one of the first allergic cat lovers to sign up with ALLERCA, placing her order ...

Scientists say sabercat bit like a pussycat

... In public imagination, the sabre-toothed cat Smilodon ranks alongside Tyrannosaurus rex as the ...ctures, and to apply the technique to a fossil big cat required some tricks engineers usually have to han...ould have seriously limited the big toothed fossil cat cat to a very specific range of killing behaviours...

The Role of Engineering in Health Science and Technology

...area, and associated increase in transistor-switching speed, in integrated circuits provides the computing power to enable real-time three-dimensional cat (computer-aided tomography) scans to check for diseased or abnormal organs. A similar exponential growth in communication bandwidth provides the capa...

Wisconsins insurance companies use advanced IT to speed relief

...y sustains itself as a mini-office, said Wendy Scheper, catastrophe claims manager for American Family. They can be there in a matter of hours. The cat Trailer has responded to large-scale weather events in the past, including the Ladysmith Wisconsin tornado in 2002, which heavily damaged much of the ...

Google delves deep within your computer with new desktop tool

...deep within your very own computer rather than just the puny recesses of the rest of the world. Sure, you can find 60 million instances of the word cat within the 4.2 billion Web pages currently spidered by Google , but how easy is it to find that special phone number you typed in 1997 and stored som...

Wisconsin doctors pinpoint cancer with TomoTherapy radiation treatment

...lt to treat by normal means. In the TomoTherapy system, patients lie on a table that goes through a rotating tunnel, similar to the procedure for a cat scan. As they pass through the system, the tunnel walls rotate in a spiral pattern, sending radiation beams at an infinite number of angles to reach t...

Living the sweet life... in IT?

...nference call and some project planning, I couldn't help but notice the yellow finches zipping in and out from the feeder and one particularly spoiled cat stretched out in the sun to the fullest extent of the law. In the middle of this good day I picked up on a story comparing our U.S. lifestyle to the "...

Debate over `intelligent design' is a not-so-wise diversion from science education

... Madison, Wis. - The day an archeologist finds a fossil cat or dog in Precambrian rock is the day Charles Darwin's evolution theory is disproved. But that hasn't happened. In fact, the Earth's fossil records te...

Is Google's cafeteria a competitive weapon?

...are de rigueur fashion at Google Labs), taking short naps to enhance the information processing capacity of the brain (Google Labs' engineers can take cat naps whenever necessary as long as they "refrain from drooling on their keyboards"), exercising to increase blood flow to the brain (Google's campus o...

2006: A mixed blessing for Midwest life science companies

...suf Islam does not ring any bells, try this name: cat Stevens . As we have heard a lot from Clapton ...rs, and virtually nothing for almost 30 years from cat Stevens, I will focus my comments on the latter in...ight of the anti-Vietnam War movement in the U.S., cat Stevens' music seemed to be a dominant force in ou...

Monitoring Receptor-Mediated Changes in [Ca2+]i Using Single-Wavelength and Dual-Wavelength Indicators on the FlexStation Workstation

... FlexStation Calcium Assay Kit (Molecular Devices, cat # R8041), ATP (Adenosine 5'-triphosphate disodium salt, Sigma, cat # A2383), probenecid (Sigma, cat # P8761), DMSO, low water content (Sigma,...

Luciferase Reporter Gene Cells and Recombinant Luciferase Dilutions Studied with the CLIPR Luciferase Assay Kit and the LMax Microplate Luminometer (MaxLine Application Note #38)

...ATERIALS 1. Lmax microplate luminometer with SOFTmax PRO for Lmax (Molecular Devices Corp.) 2. Recombinant Firefly Luciferase, Sigma cat # 9506. 3. CLIPR Luciferase Assay Kit, Cat. No. R 8032; Molecular Devices Corporation; 1-800-635-5577. The kit contains luciferin (lyophilized) a...

Dual-Luciferase Quantitation in the LMax Microplate Luminometer (MaxLine Application Note #39)

... 1. Dual-Luciferase Reporter Assay System kit, cat #E1960; Promega Corporation. The contents include:...ent (E194A). 2. Firefly Luciferase, Sigma cat # 9506. 3. Recombinant Renilla luciferase; Novalite, cat #4400; Chemicon International; 800-437-7500. ...

High Sensitivity, Wide Dynamic Range, Horseradish Peroxidase (HRP) ELISA Using the LMax Microplate Luminometer (MaxLine Application Note #41)

... LMax microplate luminometer with SoftMax Pro for LMax (Molecular Devices Corp.) 2. QuantiGlo Human TNF-α Immunoassay kit (R&D Systems1, cat #QTA50). The kit contains all reagents and standards needed for the assay, including the polystyrene microplate (12 strips of 8 wells@) pre-treated wi...

Quantitative Analysis of the Cell Cycle in Imaging Applications

... metabolic inhibitors, aphidicolin (Sigma-Aldrich, A0781), a DNA topoisomerase alpha inhibitor (G1/S blocker) for two hours or colcemid (Sigma-Aldrich cat # D7385) a (G2/ M blocker for two hours. During drug treatment, cells were cocultured with 20 μM BrdU (Calbiochem, 203806) (a thymidine analogue ...

Transgenic Zebrafish by Electroporation

...hapter 9, 1989) in 6x SSC for 2 hours at 68 C. The cat gene (1.6 kb) is cut out of a plasmid v....6, and the soluble proteins tested for cat enzyme activity (Neumann, J. R., et al., BioTechni... Figure 3 shows the results of a cat enzyme assay of the soluble proteins of...

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

...Nonidet, 0.2 mM each dNTP and 2 mM MgCl 2 . The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase ...

Translate High Yields of Active Protein

... Autoradiograph of 35 S-labeled GFP and cat proteins that were in vitro transcribed...using the method described by Shaw [1] to evaluate cat activity. Figure...d total protein yields were calculated. cat activity was measured using methods described by S...

RNAi: Get the Whole Story

...radiolabeled RNA probe transcribed from pTRI-GAPDH human (Ambion cat #7430). For the Western blot, anti-GAPDH antibody (Ambion cat #4300) was used. Figure 2 also pr...

pSilencer 4.1-CMV: Versatile Vectors for Expression of siRNA, miRNA, and mRNA

...close correlation between luciferase or cat gene transcript levels and the enzymatic activity ...ors carrying either a firefly luciferase cDNA or a cat cDNA. (A) Relative luciferase activit...ours after transfection. (B) Relative cat activity 48 hours after transfection. NT = not tra...

Transfection Reagent Selector Kit Handbook

...ample, cells transfected with -gal or cat reporter constructs are typically incubated for 24...cetyl-coenzyme A to chloramphenicol. In the common cat assay, cell lysates prepared from transfe...in-layer chromatography. A qualitative estimate of cat activity can be obtained simply by exposi...

Genetic Reporter Systems

...coenzyme A to chloramphenicol. With the cat assay, the CAT-containing lysates of transfected ... increasingly common, non-radioactive alternative, cat expression is quantified by an ELISA via immunological detection of the cat enzyme which has been expressed. ...

Genetic Reporter Systems

...coenzyme A to chloramphenicol. With the cat assay, the CAT-containing lysates of transfected ... increasingly common, non-radioactive alternative, cat expression is quantified by an ELISA via immunological detection of the cat enzyme which has been expressed. ...
Other Tags
(Date:7/24/2014)... planet,s current biodiversity, the product of 3.5 billion years ... the history of life. But it may be reaching ... scientific literature and analysis of data published in ... the loss and decline of animals is contributing to ... planet,s sixth mass biological extinction event. , Since 1500, ...
(Date:7/24/2014)... MADISON A multi-institutional team of researchers has developed ... tract. This safe, noninvasive method for assessing the function ... could lead to better diagnosis and treatment of gut ... bacterial overgrowth, irritable bowel syndrome and inflammatory bowel disease ... serious side effects in patients with diseases such as ...
(Date:7/24/2014)... counterparts in humans, affect the connections between nerve cells ... hippocampus, an area of the brain that plays a ... memories. The results of the study have been published ... depends on the active communication between nerve cells, known ... into a dense network where they constantly relay signals ...
Breaking Biology News(10 mins):Stanford biologist warns of early stages of Earth's 6th mass extinction event 2Stanford biologist warns of early stages of Earth's 6th mass extinction event 3New imaging agent provides better picture of the gut 2A protein couple controls flow of information into the brain's memory center 2A protein couple controls flow of information into the brain's memory center 3A protein couple controls flow of information into the brain's memory center 4
(Date:7/26/2014)... “Today, we introduce our new items of prom ... All these models are offered at discounted prices, and ... says the CEO of the company. DressesOnlineShops.co.uk is one ... outfits. , Ladies have to find a dress solution ... the best choices for many ladies worldwide to buy ...
(Date:7/26/2014)... “Healthy teeth are important, and having your teeth cleaned regularly ... Health Center of Snohomish County (CHC) in their article, “ ... integration of medical and dental care is the best way ... encourage regular cleanings and checkups not only with a family ... adults will find knowledgeable and friendly staff that ...
(Date:7/26/2014)... (PRWEB) July 26, 2014 Another DePuy Pinnacle ... Orthopedics, Inc., has been filed by Wright & Schulte LLC. ... on behalf of an Erie County, Ohio man who ... left hip and groin since receiving his Pinnacle Hip implant ... man will be forced to undergo a complex and risky ...
(Date:7/26/2014)... July 26, 2014 As the ... the true vision of Xoçai is ... its exclusive and healthy chocolate products. One such ... of cacao, açaí berries and blueberries, an ingredient ... high-antioxidant blend is utilized in all of Xoçai ...
(Date:7/25/2014)... 2014 Deep Research Report on Global ... is a professional and in-depth research report on ... The report provides basic Laser Scanning Confocal Microscope ... definition, classification, application, and industry chain structure as ... market analysis, including China’s domestic market as well ...
Breaking Medicine News(10 mins):Health News:Famous Supplier DressesOnlineShops.co.uk Announces Its New Selection of Prom Dresses for the UK Market 2Health News:Common Dental Care Questions Answered by Community Health Center of Snohomish County in Recent Article 2Health News:DePuy Pinnacle Hip Lawsuit Filed By Wright & Schulte LLC On Behalf of Recipient Who Faces Surgery To Replace Artificial Hip Implant 2Health News:DePuy Pinnacle Hip Lawsuit Filed By Wright & Schulte LLC On Behalf of Recipient Who Faces Surgery To Replace Artificial Hip Implant 3Health News:DePuy Pinnacle Hip Lawsuit Filed By Wright & Schulte LLC On Behalf of Recipient Who Faces Surgery To Replace Artificial Hip Implant 4Health News:DePuy Pinnacle Hip Lawsuit Filed By Wright & Schulte LLC On Behalf of Recipient Who Faces Surgery To Replace Artificial Hip Implant 5Health News:Xocai-Asia Japanese Distributors in Hachioji, Japan Sanction Local Single-Source-Chocolate Investigative Report: MXI-Corp-Asia Discloses Direct-Sales Compensation Plan 2Health News:Xocai-Asia Japanese Distributors in Hachioji, Japan Sanction Local Single-Source-Chocolate Investigative Report: MXI-Corp-Asia Discloses Direct-Sales Compensation Plan 3Health News:Xocai-Asia Japanese Distributors in Hachioji, Japan Sanction Local Single-Source-Chocolate Investigative Report: MXI-Corp-Asia Discloses Direct-Sales Compensation Plan 4Health News:Laser Scanning Confocal Microscope Market: 2014 Global, China Manufacturing Bases Analysis Now at DeepResearchReports.com 2Health News:Laser Scanning Confocal Microscope Market: 2014 Global, China Manufacturing Bases Analysis Now at DeepResearchReports.com 3Health News:Laser Scanning Confocal Microscope Market: 2014 Global, China Manufacturing Bases Analysis Now at DeepResearchReports.com 4
Other Contents