Navigation Links
transferase in Medical News

Genes May Boost Harm to Kids From Secondhand Smoke

... and susceptibility to environmental insults," she said. "We looked at a class of genes known to be involved in antioxidant defense, the glutathione-s transferase (GST) genes. Overall, we found that variation in several of the GST genes was important. This was particularly true for children of mothers who had ...

Targeted Anticancer Drugs - In Vitro Assessment and Non-Invasive Imaging of Patient and Tumor Status Will Determine Clinical and Commercial Success

... cell adhesion molecule (EpCam); estrogen receptor-alpha (Er-alpha); eukaryotic translation initiation factor 4E (EIF4E); exonuclease III; farnesyl transferase (FTase); fibroblast growth factor 2 (FGF-2); FGFr; focal adhesion kinase (FAK); folate receptor (FOLr); FOLr1; galectin 3 (GAL3) receptor; gastrin 17 ...
transferase in Medical Technology

Telik Announces Publication of Positive Phase 1 Results of a Multicenter Study of Ezatiostat Hydrochloride (TELINTRA(R), TLK199) Tablets In Patients With Myelodysplastic Syndrome

... therapies for MDS having novel mechanisms of action. TELINTRA has a novel mechanism of action that inhibits a target enzyme called glutathione S- transferase P1-1 which in turn facilitates the activation of JNK kinase, a key regulator of cellular growth and differentiation of blood. TELINTRA has been ...

Further Clinical Testing of BZL101 in Advanced Breast Cancer Demonstrates Favorable Efficacy and Toxicity Profiles

... doses. The most frequently reported BZL101-related adverse events were: diarrhea (40%), nausea (30%), headache (20%), and increased amino alanine transferase (20%). Twelve patients were evaluable for response according to RECIST. Five of the 12 patients had stable disease (SD) for >90 days (42%) and ...

Lilly Files for European Approval of ALIMTA(R) (pemetrexed for injection) for First-Line Treatment of Non-Small Cell Lung Cancer

... failure and death, in patients receiving gemcitabine alone or in combination with other potentially hepatotoxic drugs. Rare: Increased gamma-glutamyl transferase (GGT). Gastro-intestinal: Very common: Nausea or vomiting, which require therapy in about 20% of patients and is rarely dose-limiting. ...

Vion Presents Data on Cloretazine (VNP40101M) at the 100th Annual Meeting of the American Association of Cancer Research (AACR)

... common mechanisms of resistance to cancer chemotherapy agents. Poster # 5 (section 5) entitled "Low levels of pre-treatment O6 - alkylguanine transferase (AGT) in patients with AML correlate with response to Cloretazine(R) (VNP40101M) induction therapy" will be presented on Monday, April 16 from 1 to 5 ...
transferase in Medical Products

Gamma GT (Modified IFCC)

Description:... GGT method used on the Dimension clinical chemistry system is an in vitro diagnostic test intended for the quantitative determination of g-glutamyl transferase activity in serum and ...
Company:Randox Laboratories Ltd.


Description:... For the quantitative in vitro determination of K-glutamyl transferase (K-GT) in serum or ....
Company:Randox Laboratories Ltd.

Gama-GT Soluble Reagent

Description:... Gamma Glutamyl transferase reagent is used for the quantitative determination of Gamma -GT in human ....
Company:Teco Diagnostics

Gama-GT Liquid Reagent

Description:... For the kinetic quantitative determination of g-Glutamyl transferase in serum for manual and/or automated ....
Company:Teco Diagnostics

GGT Reagent

Description:... Intended for the quantitative determination of gammaglutamyl transferase activity in serum or plasma. Single vial, dry powder reagent. Readily soluble at room temperature. Reaction: Kinetic. Wavelength: 405 nm. Linearity: ...
Company:Hemagen Diagnostics, Inc.
transferase in Biological News

HATS off to combat asthma

... Prof Peter Fischer and Prof David Heery will explore histone acetyl transferase (HAT) inhibitors in asthma and COPD. This study will investigate a bank of ... the balance between two competing groups of enzymes called histone acetyl transferase (HATs) and histone deacetylases (HDACs). In asthma and COPD sufferers the ...

In just 5 years, gene discovery to clinical trial of potential treatment

... pinpointed HGPS' genetic mutation in 2003. Just two years later, NHGRI scientists identified the class of experimental cancer drugs, called farnesyl transferase inhibitors (FTIs), that can prevent the cell damage caused by the gene mutation and thus might provide an effective therapy against the disease; ...

ASPB announces Summer Undergraduate Research Fellowship 2007 recipients

... on the Growth of Various Mutant Plants Mentor: Dr. Catherine Chan Tazley Hotz, East Tennessee State University Project: Salicylic acid-methyl transferase required for plant innate immunity Mentor: Dr. Dhirendra Kumar Janelle Johnson, San Francisco State University Project: WAKL4 Cis-Acting Elements ...

Scientists discover way to block growth of prostate cancer cells

... Comprehensive Cancer Center, Madison, WI, USA. He and his collaborators at the centre found that levels of a key enzyme, spermidine/spermine acetyl transferase (SSAT), which starts oxidation of polyamines, rose markedly when prostate cancer cells were treated with androgen. Polyamines are small molecules ...

A new molecule discovered in the battle between plants and disease

... pathway. Constitutively overexpressing the proAtPep1 gene in Arabidopsis induced a constitutive activation of PDF1.2, PR-1, and tyrosine amino transferase (TAT3) genes, but not the expression of LOX2 or VSP2 genes. The transgenic plants were more resistant toward the oomycete root pathogen Pythium ...
transferase in Biological Technology

Study Finds Noninvasive Blood Test for Liver Fibrosis May Alleviate Need for Liver Biopsies for Some Patients with Chronic Hepatitis C

... assessments of hyaluronic acid (HA), a biomarker specific to liver fibrosis, with assessments of the nonspecific biomarkers bilirubin, gamma-glutamyl transferase (GGT), alpha2 macroglobulin (A2M), and age and gender. Previous studies of Hepascore in populations in France and Australia have showed it is ...

VIA Pharmaceuticals' DGAT1 Inhibitors Featured in American Diabetes Association Poster Presentation

... of compounds for the treatment of cardiovascular and metabolic disease, announced today that preclinical data related to diacylglycerol acyl transferase - 1 (DGAT1) inhibitors will be presented in a poster presentation at the 69th Scientific Sessions of the American Diabetes Association June 6, 2009 ...

High-Fidelity PCR with a Novel Polymerase Mixture

... date. Pfu DNA polymerase also lacks terminal transferase activity and produces only blunt-ended ... be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures ... be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures ...

Detection of Morphine and Morphine-Glucuronide in Saliva or Urine with a Rapid and Simple Method Without Derivatization on the Varian 500-MS

... Discussion The structures of morphine and one of its metabolites are shown in Figure 1. Glucuronidation (catalyzed by uridine-glucuronic transferase or UGTs) is a Phase II metabolism reaction which involves the addition of glucuronic acid from uridine-diphosphoglucuronide to the xenobiotic being ...

Transgenic Zebrafish by Electroporation

... 79 , 6777-6781, 1982). This plasmid uses the Rous sarcoma virus (RSV) promoter to effectively drive expression of chloramphenicol acetyl transferase (CAT) in numerous eukaryotic cell types. Methods Fish Maintenance and Egg Collection ...

In Situ Cell Death Detection Kit

... strand breaks ("nicks") into the high-molecular-weight DNA. These processes can be identified by labeling the free 3-OH termini with terminal transferase (TdT), which attaches labeled nucleotides to all 3OH-ends (TUNEL reaction; TdT-mediated dUTP nick end labeling). This labeling is more ...

Housekeeping Genes: Universal Positive Controls in siRNA Knockdown Experiments

... Results siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 ...

Brilliant Core Reagent Kits for QPCR and QRT-PCR

... the sensitivity of the Brilliant two-step QRT-PCR kit to detect a low-abundance target by amplifying and detecting hypoxanthine phosphoribosyl transferase (HPRT) mRNA from human brain total RNA. For the real-time analysis of the RT-PCR amplification, we used the primers and linear hydrolysis probe ...


transferase in Biological Products

Rabbit Anti-Human Glutathione S Transferase alpha Polyclonal Antibody, Unconjugated from Abcam

Description:... Rabbit polyclonal to Glutathione S transferase alpha ( Abpromise for all tested applications). Antigen: Full length protein: Human Glutathione S transferase alpha. Entrez GeneID: 2938 Swiss Protein ID: ...

Apo-BrdU Apoptosis Detection Kit from eBioscience

Description:... for processing individual steps in the assay; terminal deoxynucleotidyl transferase enzyme (TdT), bromodeoxyuridine triphosphate (Br-dUTP), and fluorescein ... triphosphate nucleotides (Br-dUTP). The enzyme terminal deoxynucleotidyl transferase (TdT) catalyzes a template independent addition of deoxyribonucleoside ...

Apo-Direct Apoptosis Detection Kit from eBioscience

Description:... for processing individual steps in the assay; terminal deoxynucleotidyl transferase enzyme (TdT), Fluorescein-deoxyuridine triphosphate and propidium ... triphosphate nucleotides (FITC-dUTP). The enzyme terminal deoxynucleotidyl transferase (TdT) catalyzes a template-independent addition of deoxyribonucleoside ...

Mouse Anti-Human gamma Glutamyl Transferase (gammaGT) Monoclonal Antibody, Unconjugated from AnaSpec

Description:... Anti-gamma Glutamyl transferase (gammaGT) Host: mouse monoclonal Species Reactivity: human Applications: WB, IP, FC Storage: ...

Flp-In pcDNA5/FRT Complete Kit from Invitrogen

Description:... the protein of interest. This homogeneous expression is demonstrated in Figure 3. In this experiment the coding sequence for chloramphenicol-acetyl transferase (CAT) was subcloned into pcDNA5/FRT and transfected into Flp-In-293 cells. Western blot analysis of individual hygromycin-resistant clones clearly ...

Flp-In pcDNA5/FRT Core Kit from Invitrogen

Description:... This homogeneous expression is demonstrated in Figure 3 (click link below). In this experiment the coding sequence for chloramphenicol-acetyl transferase (CAT) was subcloned into pcDNA5/FRT and transfected into Flp-In-293 cells. Western blot analysis of individual hygromycin-resistant clones clearly ...

Anisomycin from Sigma-Aldrich

Description:... Antibiotic isolated fromStreptomyces griseolusthat inhibits protein synthesis. Acts by inhibiting peptidyl transferase activity in eukaryote ribosomes. Reported to induce apoptosis in a variety of cells including promyelocytic leukemia cells, Jurkat cells, ventricular ...

Flow Cytometry Kit for Apoptosis from Sigma-Aldrich

Description:... bromodeoxyuridine triphosphate (Br-dUTP). Br-dUTP is enzymatically attached to the 3-hydroxyl sites of double- or single-stranded DNA by terminal transferase (TdT). Non-apoptotic cells do not incorporate Br-dUTP due to the lack of available 3-hydroxyl sites. BRAND: SIGMA Adequate for: 60 ...

ApoDIRECT DNA Fragmentation Assay Kit from MBL International

Description:... detecting DNA fragmentation by fluorescence microscopy or flow cytometry. The TUNEL-based detection kit utilizes terminal deoxynucleotidyl transferase (TdT) to catalyze incorporation of fluorescein-12-dUTP at the free 3-hydroxyl ends of the fragmented DNA. The fluorescein-labeled DNA can then be ...
Company:MBL International

APO-DIRECT™ Kit from BD Biosciences Pharmingen

Description:... for assessing reagent performance; washing, reaction and rinsing buffers for processing individual steps in the assay; terminal deoxynucleotidyl transferase enzyme (TdT); fluorescein labeled deoxyuridine triphosphate (FITC-dUTP) and propidium iodide (PI)/RNase solution for staining total ....
Company:BD Biosciences Pharmingen


transferase in Biological Dictionary

Peptidyl transferase

... The Peptidyl transferase is an aminoacyltransferase (EC as well ... biosynthesis. Aspects of the topic peptidyl - transferase are discussed in the following places at ... of proteins ) 6. The enzyme peptidyl transferase , which is part of the larger of the two ...

CAT assay

...... A direct assay for chloramphenicol acetyl transferase ( CAT ) has been presented ... Promega, " CAT ... assay . CAT assay . Chloramphenicol Acetyl transferase ( CAT ) is a bacterial enzyme which inactivates ... and ... Assay for chloramphenicol acetyl transferase in amoebal lysates ... Spot solution onto a ...


... Transferase-Mediated dUTP ... Terminal deoxyribonucleotide transferase (TdT)-mediated dUTP nick end labeling ... deoxyribonucleotide ... can ... Processes and reagent kits employing terminal deoxynucleotide transferase are provided for terminally chemically ... labeled deoxyribonucleotide ...


... for eukaryotic ... ... on why this elongation is necessary see Telomere shortening. ... Identification of a specific telomere terminal transferase activity in Tetrahymena extracts" ... Telomere length and progression of diabetic nephropathy in patients with type 1 diabetes. ... Telomere ...

Cloning vector

... is called "molecular cloning ", because multiple copies of ... TA Cloning Technology: TA cloning is brought about by the terminal transferase activity of certain type of DNA polymerase such as the Taq polymerase ... and cancer research tools: multigenic vectors , plasmid vectors ...
Other Contents
(Date:4/24/2014)... the corresponding terminology, and the relevance of palliation ... publications on randomized controlled trials (RCTs). This is ... Institute for Quality and Efficiency in Health Care ... report. , Together with external experts, IQWiG analysed ... lung cancer, malignant melanoma, and pancreatic cancer. For ...
(Date:4/24/2014)... 4/24/14) Dartmouth has been awarded one of 30 ... as a Lead Academic Participating Site in its new ... recipients are a select groups of investigators charged with ... cooperative groups., The NCTN grant system reflects recommendations from ... streamlines operations to achieve four goals:, Faster ...
(Date:4/23/2014)... A pilot study by Massachusetts General Hospital (MGH) investigators ... unusual treatment for a serious medical problem use ... diarrhea caused by the Clostridium difficile ( ... published online in the journal Clinical Infectious Diseases ... fecal material from donors unrelated to patients was as ...
(Date:4/23/2014)... O,Shea, M.D., scientific director at the National Institute of ... named the 2014 recipient of the Ross Prize in ... journal Molecular Medicine . The award will be ... of Sciences in Manhattan, followed by scientific presentations by ... of the National Institutes of Health. , The award, ...
(Date:4/23/2014)... an important enzyme pathway that helps prevent new cells ... condition that has been directly linked to cancer and ... found that near the end of cell division, the ... breaks in DNA are fully repaired before the parent ... This process helps safeguard against some of the most ...
Breaking Medicine News(10 mins):Health News:Palliation is rarely a topic in studies on advanced cancer 2Health News:Palliation is rarely a topic in studies on advanced cancer 3Health News:Dartmouth awarded lead role in NCI clinical trials network 2Health News:Dartmouth awarded lead role in NCI clinical trials network 3Health News:Use of frozen material for fecal transplant successfully treats C. difficile infection 2Health News:Use of frozen material for fecal transplant successfully treats C. difficile infection 3Health News:NIH scientist to receive Ross Prize in Molecular Medicine 2Health News:Study identifies enzymes that help fix cancer-causing DNA defects 2
(Date:4/23/2014)... of Toronto Scarborough research shows that male black widow ... a rare example of mate preference by male ... post-doc Emily MacLeod and Maydianne Andrade, a professor in ... field studies and the wild that males overwhelmingly chose ... male black widows can tell whether a potential mate ...
(Date:4/23/2014)... TX (4/23/14) -- Researchers have found evidence of ... factors that increase aggressive behavior in children, especially ... not all children exposed to prenatal smoking will ... will not," said Brian Boutwell, Assistant Professor at ... and senior author on the study. "One ...
(Date:4/23/2014)... today announced Sophie Martin of the University of Lausanne, ... Medal. The award acknowledges her work to understand the ... the cell. , Martin has been working for the ... the way in which the spatial organization of cells ... last 11 years, she has been using fission yeast, ...
Breaking Biology News(10 mins):Picky male black widow spiders prefer well-fed virgins 2Genetics risk, prenatal smoking may predict behavioral problems 2EMBO Gold Medal 2014 awarded to Sophie Martin 2
Other TagsOther Tags