transferase

A new molecule discovered in the battle between plants and disease

...ive activation of PDF1.2, PR-1, and tyrosine amino transferase (TAT3) genes, but not the expression of LOX2 or VSP2 genes. The transgenic plants were more resistant toward the oomycete root pathogen Pythium irregulare than wild-type plants, evidenced by a more robust leaf and root growth upon infection. ProAtPep...

Scientists discover way to block growth of prostate cancer cells

...levels of a key enzyme, spermidine/spermine acetyl transferase (SSAT), which starts oxidation of polyamines, rose markedly when prostate cancer cells were treated with androgen. Polyamines are small molecules produced in large quantity by the prostate gland and are secreted in the seminal fluid. Oxidation of p...

transferase at Biology Products

pET GST Fusion System 42 plus Competent Cells from Novagen

...luble GST fusions is also possible by assaying the transferase activity. In order to further enhance the utility of GST as a fusion tag, Novagen has designed two new multi-frame pET vectors, pET-41a-c(+) and pET-42a-c (+). In addition to featuring the powerful T7lac promoter, these vectors encode the GSTTag (220...

pET GST Fusion System 42 from Novagen

...luble GST fusions is also possible by assaying the transferase activity. In order to further enhance the utility of GST as a fusion tag, Novagen has designed two new multi-frame pET vectors, pET-41a-c(+) and pET-42a-c (+). In addition to featuring the powerful T7lac promoter, these vectors encode the GSTTag (220...

pET GST Fusion System 41 plus Competent Cells from Novagen

...luble GST fusions is also possible by assaying the transferase activity. In order to further enhance the utility of GST as a fusion tag, Novagen has designed two new multi-frame pET vectors, pET-41a-c(+) and pET-42a-c (+). In addition to featuring the powerful T7lac promoter, these vectors encode the GSTTag (220...

pET GST Fusion System 41 from Novagen

...luble GST fusions is also possible by assaying the transferase activity. In order to further enhance the utility of GST as a fusion tag, Novagen has designed two new multi-frame pET vectors, pET-41a-c(+) and pET-42a-c (+). In addition to featuring the powerful T7lac promoter, these vectors encode the GSTTag (220...

PR Competitor Assay Green from Invitrogen

... homogenous assay utilizes a fusion of glutathione transferase to the ligand binding domain of human progesterone receptor [PR-LBD(GST)] and a proprietary, fluorescently-tagged progesterone ligand, Fluormone PL Green or PL Red. Intrinsic background fluorescence from library compounds is substantially reduced uti...

More>>

transferase at Biology Technology

Brilliant Core Reagent Kits for QPCR and QRT-PCR

...mplifying and detecting hypoxanthinephosphoribosyl transferase (HPRT) mRNA from human brain total RNA. For thereal-time analysis of the RT-PCR amplification, we used the primers and linearhydrolysis probe from the TaqMan pre-developed assay reagents (PE Biosystems) inthe Brilliant Plus two-step QRT-PCR kit. We i...

High-Fidelity PCR with a Novel Polymerase Mixture

... date. Pfu DNA polymerase also lacks terminal transferase activity and produces only blunt-ended PCR...t cannot bebridged by polymerases lacking terminal transferase activity 19 andtemplate secondary structures 20 such as GC-rich hairpins. The TaqPlus Long PCR sy...

Housekeeping Genes: Universal Positive Controls in siRNA Knockdown Experiments

...r the housekeeping gene hypoxanthinephosphoribosyl transferase (HPRT siRNA, sensesequence 5′CUGUCAUUAGUGAAACUGGAA, antisensesequence 5′CCAGUUUCACUAAUGACACAA) was usedfor a knockdown in PC3 cells. The mRNA was isolated72 hours after transfection, transcribed into cDNA andanalyzed using the LightCycler...

In Situ Cell Death Detection Kit

...ed by labeling the free 3-OH termini with terminal transferase (TdT), which attaches labeled nucleotides to all 3OH-ends (TUNEL reaction; TdT-mediated dUTP nick end labeling). This labeling is more sensitive than other methods, and is the method used by the Roche Applied Science In situ Cell Death Detection Kits...

Transgenic Zebrafish by Electroporation

...ctively drive expression of chloramphenicol acetyl transferase (CAT) in numerous eukaryotic cell types. Methods Fish Maintenance and Egg Collection Zebrafish (Brachydanio rerio, Figure 1) are obtained from the local pet store and maintained in a 20 gallon aquar...

More>>

transferase at Biology Dictionary

Peptidyl transferase

Peptidyl transferase : An enzymatic activity of the ribosome responsi...l article >>> The enzyme peptidyl transferase forms a peptide bond between the adjacent amino acids . As this happens, the amino acid on the...

transferase at Medicine News

No data found

Search transferase medicine news at Google

Search transferase medicine news at Yahoo

Search transferase medicine news at Msn

transferase at Medicine Products

GGT Reagent

...or the quantitative determination of gammaglutamyl transferase activity in serum or plasma. Single vial, dry powder reagent. Readily soluble at room temperature. Reaction: Kinetic. Wavelength: 405 nm. Linearity: 500 U/L at 30C....

Gamma GT (CARBOXY)

...quantitative in vitro determination of K-glutamyl transferase (K-GT) in serum or plasma....

Gamma GT (Modified IFCC)

...d for the quantitative determination of g-glutamyl transferase activity in serum and plasma...

transferase at Medicine Technology

Vion Presents Data on Cloretazine (VNP40101M) at the 100th Annual Meeting of the American Association of Cancer Research (AACR)

...tled "Low levels of pre-treatment O6- alkylguanine transferase (AGT) in patients with AML correlatewith response to Cloretazine(R) (VNP40101M) induction therapy" willbe presented on Monday, April 16 from 1 to 5 p.m. Sinceoverexpression of AGT has been associated with drug resistancepreclinically, these data were...