Navigation Links
Lambda in Medical News

Ric Weiland Leaves $65 Million to Support Gay Rights and HIV/AIDS Organizations

... -- Gay, Lesbian, and Straight Education Network (GLSEN) -- In The Life -- International Gay and Lesbian Human Rights Commission (IGLHRC) -- lambda Legal -- National Gay and Lesbian Task Force -- Parents, Families and Friends of Lesbians and Gays (PFLAG) -- Project Inform -- Servicemembers ...

Lesbian Sues Doctors

... Doctors, who refused a woman IVF on the grounds that she was a lesbian, have been sued by her before California's Supreme Court. According to lambda Legal lawyer Jennifer Pizer the doctors' behavior went against established medical ethics //and violates California civil rights law. The suit was ...

Debate Rages over firing of HIV infected health care workers

... of their positions takes away the notion that this is just a self-interested party arguing his case," attorney Stephen R. Scarborough, of the lambda Legal Defense Fund's Atlanta office, who is representing Waddell, says. Scarborough said that this case is the first to follow the 1998 US Supreme ...
Lambda in Medical Products

Free Lambda Light Chains (Bence Jones Protein), Urine by Immunofixation Electrophoresis, Quantitative

Description: ARUP Laboratories is a national reference laboratory and a worldwide leader in innovative laboratory research and development. ARUP offers an extensive test menu of highly complex and unique medical tests in clinical and anatomic pathology. Owned by the University of Utah, ARUP Laboratories' ...
Company:ARUP Laboratories

Free Kappa & Lambda Light Chains (Bence Jones Protein), Urine by Immunofixation Electrophoresis, Qua

Description: ARUP Laboratories is a national reference laboratory and a worldwide leader in innovative laboratory research and development. ARUP offers an extensive test menu of highly complex and unique medical tests in clinical and anatomic pathology. Owned by the University of Utah, ARUP Laboratories' ...
Company:ARUP Laboratories

Bence Jones Protein, Quantitative Free Kappa & Lambda Light Chains, Urine

Description: ARUP Laboratories is a national reference laboratory and a worldwide leader in innovative laboratory research and development. ARUP offers an extensive test menu of highly complex and unique medical tests in clinical and anatomic pathology. Owned by the University of Utah, ARUP Laboratories' ...
Company:ARUP Laboratories

Bence Jones Protein, Quantitative Free Lambda Light Chains, Urine

Description: ARUP Laboratories is a national reference laboratory and a worldwide leader in innovative laboratory research and development. ARUP offers an extensive test menu of highly complex and unique medical tests in clinical and anatomic pathology. Owned by the University of Utah, ARUP Laboratories' ...
Company:ARUP Laboratories

Bence Jones Protein, Qualitative Free Kappa & Lambda Light Chains, Urine

Description: ARUP Laboratories is a national reference laboratory and a worldwide leader in innovative laboratory research and development. ARUP offers an extensive test menu of highly complex and unique medical tests in clinical and anatomic pathology. Owned by the University of Utah, ARUP Laboratories' ...
Company:ARUP Laboratories

Corning Lambda Single Channel Pipettor, 0.1-2.5 ul

Description: This CLS number is a new product number, created to easily match Cornings product number. If showing no availability yet, please order under the old Sigma-Aldrich number (Z71,407-0) or contact customer service for assistance. Mfr Desig: Corning ...

Corning Lambda Single Channel Pipettor, 10-100 ul

Description: This CLS number is a new product number, created to easily match Cornings product number. If showing no availability yet, please order under the old Sigma-Aldrich number (Z71,410-0) or contact customer service for assistance. Mfr Desig: Corning ...

Corning Lambda Single Channel Pipettor, 0.5-10 ul

Description: This CLS number is a new product number, created to easily match Cornings product number. If showing no availability yet, please order under the old Sigma-Aldrich number (Z71,408-9) or contact customer service for assistance. Mfr Desig: Corning ...

Corning Lambda Single Channel Pipettor, 2-20 ul

Description: This CLS number is a new product number, created to easily match Cornings product number. If showing no availability yet, please order under the old Sigma-Aldrich number (Z71,412-7) or contact customer service for assistance. Mfr Desig: Corning ...

Corning Lambda Single Channel Pipettor, 20-200 ul

Description: This CLS number is a new product number, created to easily match Cornings product number. If showing no availability yet, please order under the old Sigma-Aldrich number (Z71,411-9) or contact customer service for assistance. Mfr Desig: Corning ...
Lambda in Biological News

Study reveals how viruses collectively decide the fate of a bacterial cell

... "In the case of perhaps the most extensively studied bacteriophage, lambda phage, experimental evidence indicates that a single infecting phage leads ... the complex gene regulatory dynamics of the lysis-lysogeny switch for lambda phage. They tracked the dynamics of three key genes cro, cI and cII and ...

Brown-Harvard team solves mobile DNA's surgical sleight-of-hand

... protein responsible for this DNA doctoring in the lambda virus, which infects and lives off Escherichia ... bacteria. The findings are important because lambda is a model virus used to understand mobile DNA, ... this work represents a major leap." When the lambda virus inserts its DNA into E. coli, λ-INT is the ...

Norovirus, AIDS vaccine and Hepatitis Virus

... the researchers. "These results suggest the possibility that interferon lambda may be therapeutically useful in the treatment of chronic HBV or HCV infection." (M.D. Robek, B.S. Boyd, F.V. Chisari. 2005. lambda interferon inhibits hepatitis B and C virus replication. Journal of ...

Brown scientists map structure of DNA-doctoring protein complex

... that allows mobile DNA to cut into a chromosome, insert its own genes, and then sew the chromosome back up. That work was conducted using the lambda virus, which infects Escherichia coli (E. coli) bacteria and serves as a model that scientists use to understand mobile DNA. Now scientists in ...

Gene Bridges And Covalys To Develop Restriction-Enzyme-Free SNAP-tag Gene Fusion Kits

... biotech company, which develops and commercialises innovative DNA engineering technologies. Its patented Red/ET Recombination, also known as lambda mediated cloning, enables cloning and precise manipulation and modification of DNA molecules regardless of restriction sites and is particularly ...
Lambda in Biological Technology

Inactivation of Contaminating Templates in PCR Using High Intensity Ultraviolet Light

... of DNA was performed using genomic DNA from lambda phage and purified amplified human ... amplification of a 500 bp fragment of lambda phage contained 50 ng of total lambda genomic DNA suspended in 5 l of distilled water. ...

Real-Time Quantification of Genomic DNA Using DyNAzyme II DNA Polymerase and SYBR Green I Dye

... Real-time quantification was performed for lambda and human genomic DNA on the DNA Engine Opticon ... for ranges of 100 to 1x10 8 initial copies of lambda DNA and 75 to 7.5x10 4 initial copies of human DNA. Precision of the assay was measured with lambda template and standard deviations of 0.3 cycles ...

TURBO DNase: Hyperactive, Salt Tolerant DNase

... TURBO DNase reduces the input 50 kb lambda DNA to digested fragments that are ... Comparison of DNase Activity. lambda DNA (4 g) was either left intact (Unt, ... (Figure 2). Briefly, 4 g of lambda DNA was digested with 12 ng of the various DNases ...

DNA Removal for Bioprocessing Applications

... After a 15 minute equilibration period at 37C, lambda genomic DNA was introduced at 200 ... used in real-time PCR with primer-probe sets for lambda genomic DNA (Figure 1). For viability ... real-time PCR cycle thresholds (C t ) of residual lambda DNA detection using the conditions ...

TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates

... PFG Marker (NEB, Beverly, MA, USA) and lambda Hind III Marker (Worthington, ... Lane 2: lambda Hind III Marker ... Lane 1: lambda Hind III Marker ...

TripleMaster PCR System: Direct Comparison with Competitors

... and competitors T, R, and AB in lambda DNA amplification. Very stringent cycling ... Lane M: lambda Hind III Marker ... 40 kb target amplification from lambda DNA ...

HotMasterAn innovative Hot Start/Cold Stop technology for better PCR* results

... gradient using human genomic DNA or Phage lambda DNA (New England BioLabs, USA) as ... 2: Processivity A 5.0 kb Phage lambda target was amplified using Eppendorf HotMaster ... CAGCATAAGCGGCTACATGA Template: 10 ng lambda DNA ...

Efficient and Reliable PCR Setup Using Eppendorf MasterMix

... and a 10-kb fragment from the genome of the phage lambda was amplified. The target DNA used was human genomic DNA, genomic DNA or lambda DNA. The PCR reaction volumes were each 50 l. 30 ... thermophilus HB8 genomic DNA or 25 ng lambda DNA; 20 pmol per primer). The reaction took place ...

Lambda DNA Extraction Protocol

... at 37C. Dilute lambda phage stock to l05 pfu per 0.1 ml in SM buffer ... Gelatin), then mix 0.1 ml of the lambda dilution with 0.1 ml plating bacteria in a ... Collect phage-containing lambda diluent to a centrifuge tube and centrifuge ...

Lambda DNA Extraction Protocol

... at 37C. Dilute lambda phage stock to l05 pfu per 0.1 ml in SM buffer ... Gelatin), then mix 0.1 ml of the lambda dilution with 0.1 ml plating bacteria in a ... Collect phage-containing lambda diluent to a centrifuge tube and centrifuge ...


Lambda in Biological Products

Mouse Anti-Lambda Free Light Chain Monoclonal Antibody, Unconjugated, Clone 3D12 from GeneTex

Description:... Mouse monoclonal [3D12] to lambda Free Light Chain Immunogen: Mixture of light ... for independent constantly expressed epitope of lambda chain. Reacts with monomer and dimer forms of free lambda chains but not ...

Lambda Control Kit from ABgene

Description:... The lambda Control Kit contains lambda DNA and two 25mer primers, which can be used to amplify a 500bp fragment. The lambda DNA is purified by CsCl gradient centrifugation ...

Lambda 10-2 Filter Wheel from AutoMate Scientific, Inc

Description:... The lambda 10-2 is a microprocessor controlled, high speed ... with exceptionally smooth operation make the lambda 10-2 ideal for research applications involving ... rapid and accurate aperture positioning. The lambda 10-2 controller which has both serial and ...
Company:AutoMate Scientific, Inc

cDNA Library Construction Services from Bio S&T

Description:... In plasmid or lambda vector. Please inquire for more ...
Company:Bio S&T

Mouse Anti-Rat Kappa, Lambda Light Chain Monoclonal Antibody, Horseradish Peroxidase Conjugated from AbD Serotec

Description:... MOUSE ANTI RAT KAPPA/LAMBDA:HRP Immunogen: MARK-1: Rat kappa light chains (IR202 and IR968)MARL-15: Rat lambda light chains (RH58, ...
Company:AbD Serotec

High Molecular Weight DNA Markers from Invitrogen

Description:... from 9 to 48 kb on low-percentage agarose gels. The 13 bands consist of 8.3- to 48.5-kb fragments generated from restriction endonuclease digests of lambda DNA (cIind1ts857 Sam7). Ethidium bromide staining causes the four bands identified by an asterisk (8271 bp 8612 bp 12220 bp and 19399 bp) to show ...

Lambda GT11 Forward DNA Sequencing Primer from EPICENTRE Biotechnologies

Description:... primers are designed for sequencing inserts cloned into M13/pUC-based plasmids, plasmids containing the SP6, T7, or T3 RNA polymerase promoters, or lambda gt10 and gt11 vectors. They are supplied at a concentration of 0.1 µg/µl in water. The primers are functionally tested in DNA sequencing ...
Company:EPICENTRE Biotechnologies

Lambda GT11 Reverse DNA Sequencing Primer from EPICENTRE Biotechnologies

Description:... primers are designed for sequencing inserts cloned into M13/pUC-based plasmids, plasmids containing the SP6, T7, or T3 RNA polymerase promoters, or lambda gt10 and gt11 vectors. They are supplied at a concentration of 0.1 µg/µl in water. The primers are functionally tested in DNA sequencing ...
Company:EPICENTRE Biotechnologies

pWEB::TNC Deletion Cosmid Transposition Kit from EPICENTRE Biotechnologies

Description:... DNA is ligated into the supplied linearized and dephosphorylated pWEB::TNC Cosmid Vector, packaged using ultra-high efficiency MaxPlax™ lambda Packaging Extracts (>10 9 pfu/ m g for phage lambda), also in the kit, and plated on the supplied EPBOS™ plating ....
Company:EPICENTRE Biotechnologies

Lambda Protein Phosphatase from New England Biolabs

Description:... lambda Protein Phosphatase ( l-PPase) is a Mn2+-dependent protein phosphatase ... 221 amino-acid product of the ORF221 open reading frame on bacteriophage lambda ....
Company:New England Biolabs


Lambda in Biological Definition

Lambda phage

... Enterobacteria phage λ ( lambda phage ) is a temperate phage that lives in E. ... the resulting protein encoded by that gene. The lambda repressor gene system consists of (from left to ... cI gene OR3 OR2 OR1 cro gene The lambda repressor is a dimer also known as the cI ....


... the wave-like properties of a photon, it is also worth remembering that the speed of a wave, v , is given by the equation: where ( lambda ) is the wavelength f is the frequency (the symbol ( nu ) is often used instead, but f is used here to avoid ambiguity with v ). This ...


... The wavelength is the distance between repeating units of a wave pattern. It is commonly designated by the Greek letter lambda (λ). In a sine wave, the wavelength is the distance between peaks: The x axis represents distance, and I would be some ...
Lambda in Biological Dictionary

Lambda phage

... lambda phage is a virus particle consisting of a ... ... The repressor found in the phage lambda is a notable example of the level of ... lambda phage DNA is either linear, circular, or ...


... lambda is the 11th letter of the Greek alphabet. In the ... letter Lamed . Letters that arose from lambda include the Roman L and the ... In mathematical logic and computer science, lambda calculus, also written as λ-calculus, is a ...

Bacteriophage lambda

... Bacteriophage lambda binds to the target E. coli cell, the J ... of the insertion of the bacteriophage lambda . ... Let us remember the split life cycle of the temperate bacteriophage lambda : ... To understand the life cycle of ...

RecA protein

... promotes the autodigestion of the lexA repressor, umuD protein and lambda repressor. ... Can the RecA Protein be heat inactivated? ... RecA promotes the autodigestion of the lexA repressor, umuD protein and lambda repressor. ... What buffer should be used with RecA Protein ? ... ...

Genomic library

... ... The first Mt genomic libraries were constructed in phage lambda derivatives in the 1990s. ... [While gel is running, you will be ... population of host bacteria, each of ... ... size (use 20 kb for a lambda phage genomic library ), and the size of the genome ... A genomic ...


... develops and manufactures reagents and kits for genomics, proteomics, ... lambda Exonuclease is a highly processive 5'3' exodeoxyribonuclease that ... ... to 3' direction, ... Exonuclease Reaction ... affinity chromatography, lambda Exonuclease is cleaved from the ... Definition of exonuclease from ...


... plasmid that contains cos sequences, DNA sequences originally from the lambda phage. Cosmids can be used to build genomic libraries. cosmid n. ... has been spliced with plasmid DNA for cloning large ... · plasmid · lambda phage · cosmid · P1 phage · fosmid · BAC ... Information about ...

Restriction enzymes

... ... Some Fermentas restriction enzymes show optimum activity at temperatures other ... Restriction enzymes without recognition sites on lambda DNA are assayed with ... 1 Restriction Enzyme Definition. 2 Fragment complementarity and splicing ... Image:SmaI restriction enzyme ...


... of repressor from the Merriam-Webster Online Dictionary with audio pronunciations, thesaurus, Word of the Day, and word games. Isolation of lambda Phage Repressor ... No one, however, had isolated the repressor nor did they know any of its physical properties. ... Lac Repressor Binding ...


... issues. ... Hierarchical classifications of Prophage ... ... kb) of prophages and prophage remnants on the Streptococcus pyogenes ... phage lambda and the eleven lambda-like prophage elements Sp3 to Sp15 from the E. ... We found 15 dictionaries with English definitions that include the ...


Other Contents
(Date:5/3/2015)... May 03, 2015 NuevaCare announced today ... two upcoming area seminars. The first event will take ... Regional Stroke Conference to be held at The Magnolia ... Wednesday, May 13 during the Dementia Conference to be ... “These seminars offer an excellent opportunity to learn about ...
(Date:5/3/2015)... HealthPostures, a pioneering ergonomics company that ... the , May 5 - 7, 2015 Minnesota Safety ... the conference include its bestselling TaskMate sit stand solutions. ... 6100 TaskMate Executive. Features of the 6100 TaskMate Executive ... extended platform work surface and supply holders. Weighing 50 ...
(Date:5/2/2015)... May 02, 2015 Vancouver fencing company, QS ... provide valuable advice to prospective clients related to their questions ... to install railings around their decks and patios. While that ... that pop up once the person rolls up their sleeve ... installing a railing in finding a gate that matches it. ...
(Date:5/2/2015)... (PRWEB) May 02, 2015 It’s a ... deadly natural disaster strikes anywhere on this planet, cyber ... human sympathy and compassion for their own personal gain. ... Computer Emergency Readiness Team) issued an alert titled ... potential email scams citing the earthquake in Nepal. The ...
(Date:5/2/2015)... Ohio (PRWEB) May 02, 2015 On ... Liverpool City Hospital (ELCH) gathered to celebrate improvements in ... River Valley Health Partners (RVHP), had zero acquired ventilator ... urinary catheter associated infections. ELCH was also recently named ... The management team at ELCH credited the teamwork of ...
Breaking Medicine News(10 mins):Health News:NuevaCare Introduces MnemeTherapy® Approach to Care for Elderly Patients with Alzheimer’s, Stroke and Other Types of Neurodegenerative Conditions 2Health News:HealthPostures to Appear at the Minnesota Safety and Health Conference 2Health News:HealthPostures to Appear at the Minnesota Safety and Health Conference 3Health News:Professional Staff at QS Fencing Company Now Provides Advice on Railings and Gates 2Health News:Cyber Aftershocks from Nepal’s Earthquake Can Cripple Businesses Right Here at Home 2Health News:Cyber Aftershocks from Nepal’s Earthquake Can Cripple Businesses Right Here at Home 3Health News:Cyber Aftershocks from Nepal’s Earthquake Can Cripple Businesses Right Here at Home 4Health News:East Liverpool City Hospital Celebrates Patient Care Improvements 2
(Date:3/30/2015)... and Markets ( ) has announced ... in Automotive Sector 2014-2018" report to their offering. ... market in Automotive Sector to grow at a CAGR ... recognition is the ability of a device to identify ... recognition technology can be 2D-based or 3D-based. It uses ...
(Date:3/24/2015)... Markets ( ) has announced the addition of ... report to their offering. This report analyzes the ... the following Segments: Face Biometrics, and Voice Biometrics. The report provides ... Japan , Europe , ... Africa , and Latin America ...
(Date:3/23/2015)... March 23, 2015 SoundView Technology Group issues a ... NXTD ) Wocket smart wallet. SoundView was one of the ... their experience with the Wocket in multiple scenarios and outlets. ... Foods and other retailers, making both debit and credit card ... also says, "If the company meets their plans in 2015, ...
Breaking Biology News(10 mins):Global Gesture Recognition Market in Automotive Sector Report 2015 - Growing Number of Partnerships 2Face and Voice Biometrics - Global Strategic Business Report 2015: Face Recognition Gains Prominence in Immigration Control 2Face and Voice Biometrics - Global Strategic Business Report 2015: Face Recognition Gains Prominence in Immigration Control 3Face and Voice Biometrics - Global Strategic Business Report 2015: Face Recognition Gains Prominence in Immigration Control 4Face and Voice Biometrics - Global Strategic Business Report 2015: Face Recognition Gains Prominence in Immigration Control 5Face and Voice Biometrics - Global Strategic Business Report 2015: Face Recognition Gains Prominence in Immigration Control 6Technology Research Note Update from SoundView; Real-World Usage and Feedback of Wocket Smart Wallet at CVS, Whole Foods and other Retailers 2Technology Research Note Update from SoundView; Real-World Usage and Feedback of Wocket Smart Wallet at CVS, Whole Foods and other Retailers 3Technology Research Note Update from SoundView; Real-World Usage and Feedback of Wocket Smart Wallet at CVS, Whole Foods and other Retailers 4
Other TagsOther Tags