Navigation Links
Dynein in Medical News

Key factor in brain development revealed, offers insight into disorder

... the movement of a molecular motor known as dynein to the surface of both sides of the cell membrane. There, dynein takes a fixed position and, like a molecular ... of the cell toward it. Just like a pulley, dynein draws the microtubules through it and that, in ...

Alzheimer's molecule is a smart speed bump on the nerve-cell transport highway

... an important role in Alzheimers disease. dynein and kinesin proteins transport cellular cargo ... system goes awry. The transport performed by dynein and kinesin is required for continuously ... microtubules are abundantly decorated with tau. dynein and kinesin encounter the tau molecules on their ...

Tug of war in the cells

... over a cargo - for example, some of the kinesin type and some of the dynein type. The kinesin motors move to the end of the microtubule that biologists call the positive end, while the dynein motors move to the minus end. The findings of the Potsdam-based scientists ...

Can you hear me now? How the inner ear's sensors are made

... particles accumulated at the proper location to form the inner ear's crystalline sensors. "We next blocked expression of a gene that controls dynein a tiny molecular motor that drives cilia movement," said Hill. "When we examined the embryos, we saw that cilia movement came to a halt. As a ...

Discovery of Agile Molecular Motors Could Aid in Treating Motor Neuron Diseases

... rather than in one direction, as previously thought. They report their findings in a recent issue of Nature Cell Biology. The proteins in this motor, dynein and dynactin, are the “long-distance truckers” of the cell: working together, they are responsible for transporting cellular cargo from the periphery ...
Dynein in Medical Dictionary

Bronchi

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. Bronchi tis , laryngitis or croup . Measles may lead to laryngitis ( inflammation of the voice box), ... ...

Cilia

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. Cilia ry Body Melanoma Note: Some citations in the text of this section are followed by a level of evidence. Cilia ...

Movement

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. We attack this problem by asking three questions: (1) What are the structures of the macromolecular assemblies that drive cell ...

Otitis

... Overcoming dental anxiety ... nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The disorders manifest as KARTAGENER SYNDROME , chronic respiratory disorders , chronic sinusitis , and/or chronic otitis ...

Paranasal sinuses

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The URI causes inflammation of the nasal passages that can block the opening of the paranasal sinuses , and result in a ...

Respiratory disorders

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The disorders manifest as KARTAGENER SYNDROME , chronic respiratory disorders , ... ...

Sinus

... cilia ry movement in the nose, paranasal sinus es , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. Rhinitis is an inflammation of the nasal mucosa (the mucous membrane that lines the nose and the sinus ), often due to ...

Sinusitis

... ; ... cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The disorders manifest as KARTAGENER SYNDROME , chronic respiratory disorders , chronic sinusitis , ... El atomizador ...

Sperm

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. A pair of ducts opening at one end into the uterus and at the other end into the peritoneal cavity , over the ovary . Each ...

More>>

Dynein in Biological News

Scientists deconstruct cell division

... of Embryology have found that two proteins dynein and Nudelinvolved in other cell-division ... isolated the spindle matrix. Interestingly, both dynein and Nudel are components of the spindle matrix. ... brings it to microtubules where both Nudel and dynein then help the lamin-B assemble into the spindle ...

Mutation may cause inherited neuropathy

... in only one copy of a gene coding for one part of dynein protein have severe defects in proprioception, ... neuropathies. Mutations in the gene for dynein heavy chain 1, Dync1h, led to movement defects in ... deformities and various anatomic features. dynein appears to be a likely suspect, the authors ...

Media highlights in the January issues of Biophysical Journal

... by monitoring their phosphorylation status. Likewise numerous biophysical studies have explored the mechanics of single motor proteins of the myosin, dynein and kinesin families involved. Here, a biomechanical approach is taken, where in living cells the tension of the cytoskeletal network is ...

UNC scientists solve mystery of how largest cellular motor protein powers movement

... helps solve a scientific mystery: how the protein dynein fuels itself to perform cellular functions vital ... or cell division into identical cells. dynein uses energy derived from ATP, or adenosine ... and detailed molecular structure for dynein has kept scientists largely in the dark about how ...

Molecular Motors Cooperate In Moving Cellular Cargo, Study Shows

... "We discovered that two molecular motors -- dynein and kinesin -- do not compete for control, even ... individual motors measured outside the cell." dynein and kinesin are biomolecular motors that haul cargo from one part of a cell to another. dynein moves material from the cell membrane to the ...

Discovery of agile molecular motors could aid in treating motor neuron diseases

... than in one direction, as previously thought. They report their findings in a recent issue of Nature Cell Biology. The proteins in this motor, dynein and dynactin, are the "long-distance truckers" of the cell: working together, they are responsible for transporting cellular cargo from the periphery ...

A new way of looking at molecular motors

... employ all three types of motors at the same time, but in different proportions. For example, yeast uses six kinesins, five myosins, and one dynein while mammals have genes for more than 40 kinesins, 40 myosins and more than a dozen dyneins. Genetic and acquired defects in the motors cause ...

Marathon of nano-sprinters

... along filaments of the cytoskeleton, consuming energy provided by the hydrolysis of ATP, which can be considered the fuel of the cell. Kinesin and dynein motors move along microtubules and myosins move along actin filaments. The step sizes of these motors are of the order of 10 nm. By stepping in a ...

More>>

Dynein in Biological Technology

cMaster RTplusPCR System for increased sensitivity and product length in RT-PCR

... (hTSF) mRNA, 5.3 kb fragment Mouse dynein mRNA, 12.3 kb fragment Protocol: ... Three step cycling program used for hTSF and dynein ... reverse: TATTTCACTGACAGGCAATACCGTCCAAGG dynein forward: CGGCGCTGGAGGAGAA ...
Dynein in Biological Definition

Dynein

... dynein is a class of protein found in biological ... can be divided into two groups: cytoplasmic dynein and axonemal dynein. The axonemal dynein acts to activate a sliding within flagellar ...

Cilium

... nine pairs of microtubule doublets and other associated proteins. Motile cilia have a central core with two additional microtubule singlets and dynein motor proteins which are attached to the outer microtubule doublets. Biologists refer to this organization as a cononical "9 + 2" structure. The ...

Flagellum

... the interior of the flagellum is accessible to the cell's cytoplasm . This is necessary because the flagellum's flexing is driven by the protein dynein bridging the microtubules all along its length and forcing them to slide relative to each other, and ATP must be transported to them for them to ...

List of gene families

... proteins Major histocompatibility complex (MHC) Related protein families Motor proteins Myosin Kinesin dynein Signal transducing proteins Receptor tyrosine kinases G-proteins Transporters ABC proteins ...
Dynein in Biological Dictionary

Dynein

... dynein is a motor protein in cells which converts ... in ATP into the mechanical energy of movement. dynein transports various cellular cargo by ... cytoskeletal microtubules towards ... dynein , light chain, Tctex-type 3, also known as ...

Pseudogene

... Currently, none of these pseudogene detection methods is available as a ... Human genome project: advanced genome annotation tutorial. ... dynein pseudogene consisting solely of 3' UTR. KIAA1628: annotation of unfinished contigs ... Human genome project: advanced genome annotation ...
Other Contents
(Date:12/25/2014)... 25, 2014 Residents at ... recently showed their generous spirit by providing holiday ... County Parenting Network- Grandparents Raising Grandchildren program. , ... around the largest Christmas tree on the campus ... by residents of the Abernethy Village Association (AVA). ...
(Date:12/24/2014)... 2014 Over 700 toys, that’s what ... communities. That is 700 smiling little faces this holiday ... over $6000 in monetary donations was given to the ... the expenses they incur through the year. Some of ... A Child's Haven , Shrine's Children's Hospitals, Toys for ...
(Date:12/24/2014)... (PRWEB) December 24, 2014 Risperdal lawsuit ... a mass tort litigation currently underway in Pennsylvania’s Philadelphia ... As of December 24, 2014, court documents indicate that ... behalf of individuals who developed gynecomastia (male breast growth) ... from the Court indicates that this represents an increase ...
(Date:12/24/2014)... 2014 Today, UWDress.com, the famous women’s dress ... gowns, and launched a site-wide wedding gown promotion. ... gowns in a more unexpected way, the collection should be ... in the global market, and they are available with custom ... offered at discounted prices, up to 75% off; most of ...
(Date:12/24/2014)... a famous bamboo flooring company offering bamboo flooring products ... its multiple layer bamboo panel board collection , and ... Bamboo panel is the product made from 100 percent ... features high quality selective bamboo and eco-friendly adhesives that ... consists of multiple layers of bamboo. , According to ...
Breaking Medicine News(10 mins):Health News:Retirement Community Residents Make Impact During Holiday Season 2Health News:AlignLife Donates Over 700 Toys This Year 2Health News:Risperdal Lawsuits Continue to Climb, as Claims in Pennsylvania Litigation Exceed 1,180 Filings, Bernstein Liebhard LLP Reports 2Health News:Risperdal Lawsuits Continue to Climb, as Claims in Pennsylvania Litigation Exceed 1,180 Filings, Bernstein Liebhard LLP Reports 3Health News:Risperdal Lawsuits Continue to Climb, as Claims in Pennsylvania Litigation Exceed 1,180 Filings, Bernstein Liebhard LLP Reports 4Health News:Buy Cheap Long Sleeve Wedding Gowns At UWDress.com 2Health News:Bamboo Flooring Company Bambooindustry.com Introduces Its Multiple Layer Bamboo Panel Board Collection 2
(Date:12/19/2014)... 18, 2014  23andMe, Inc., the leading personal genetics ... pinpoints fine-scale differences in genetic ancestry of individuals from ... Since immigrants first arrived more than four hundred ... has served as a meeting place for peoples from ... the ongoing mixing of peoples with African, European, and ...
(Date:12/17/2014)... , Dec. 16, 2014 Valencell, a leader ... PerformTek biometric technology to industry leaders such as Intel, ... clinically validated, biometric wearable products. These products will be ... Las Vegas . ... accurate, flexible and robust – with the clinical data ...
(Date:12/11/2014)... --Research and Markets , ... ) has announced the addition of the ... their offering. One major trend ... multimodal biometric systems. Multimodal biometric systems utilize more ... and identification purposes. This helps to reduce the ...
Breaking Biology News(10 mins):23andMe Study Sketches Genetic Portrait of the United States 223andMe Study Sketches Genetic Portrait of the United States 323andMe Study Sketches Genetic Portrait of the United States 4Valencell PerformTek Biometrics Power the Most Accurate Wearables at CES 2015 2Biometrics Market in India 2015-2019: Key Vendors are 3M Cogent, NEC, Safran and Suprema 2
Other TagsOther Tags