Navigation Links
Dynein in Medical News

Key factor in brain development revealed, offers insight into disorder

... the movement of a molecular motor known as dynein to the surface of both sides of the cell membrane. There, dynein takes a fixed position and, like a molecular ... of the cell toward it. Just like a pulley, dynein draws the microtubules through it and that, in ...

Alzheimer's molecule is a smart speed bump on the nerve-cell transport highway

... an important role in Alzheimers disease. dynein and kinesin proteins transport cellular cargo ... system goes awry. The transport performed by dynein and kinesin is required for continuously ... microtubules are abundantly decorated with tau. dynein and kinesin encounter the tau molecules on their ...

Tug of war in the cells

... over a cargo - for example, some of the kinesin type and some of the dynein type. The kinesin motors move to the end of the microtubule that biologists call the positive end, while the dynein motors move to the minus end. The findings of the Potsdam-based scientists ...

Can you hear me now? How the inner ear's sensors are made

... particles accumulated at the proper location to form the inner ear's crystalline sensors. "We next blocked expression of a gene that controls dynein a tiny molecular motor that drives cilia movement," said Hill. "When we examined the embryos, we saw that cilia movement came to a halt. As a ...

Discovery of Agile Molecular Motors Could Aid in Treating Motor Neuron Diseases

... rather than in one direction, as previously thought. They report their findings in a recent issue of Nature Cell Biology. The proteins in this motor, dynein and dynactin, are the “long-distance truckers” of the cell: working together, they are responsible for transporting cellular cargo from the periphery ...
Dynein in Medical Dictionary

Bronchi

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. Bronchi tis , laryngitis or croup . Measles may lead to laryngitis ( inflammation of the voice box), ... ...

Cilia

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. Cilia ry Body Melanoma Note: Some citations in the text of this section are followed by a level of evidence. Cilia ...

Movement

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. We attack this problem by asking three questions: (1) What are the structures of the macromolecular assemblies that drive cell ...

Otitis

... Overcoming dental anxiety ... nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The disorders manifest as KARTAGENER SYNDROME , chronic respiratory disorders , chronic sinusitis , and/or chronic otitis ...

Paranasal sinuses

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The URI causes inflammation of the nasal passages that can block the opening of the paranasal sinuses , and result in a ...

Respiratory disorders

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The disorders manifest as KARTAGENER SYNDROME , chronic respiratory disorders , ... ...

Sinus

... cilia ry movement in the nose, paranasal sinus es , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. Rhinitis is an inflammation of the nasal mucosa (the mucous membrane that lines the nose and the sinus ), often due to ...

Sinusitis

... ; ... cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The disorders manifest as KARTAGENER SYNDROME , chronic respiratory disorders , chronic sinusitis , ... El atomizador ...

Sperm

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. A pair of ducts opening at one end into the uterus and at the other end into the peritoneal cavity , over the ovary . Each ...

More>>

Dynein in Biological News

Scientists deconstruct cell division

... of Embryology have found that two proteins dynein and Nudelinvolved in other cell-division ... isolated the spindle matrix. Interestingly, both dynein and Nudel are components of the spindle matrix. ... brings it to microtubules where both Nudel and dynein then help the lamin-B assemble into the spindle ...

Mutation may cause inherited neuropathy

... in only one copy of a gene coding for one part of dynein protein have severe defects in proprioception, ... neuropathies. Mutations in the gene for dynein heavy chain 1, Dync1h, led to movement defects in ... deformities and various anatomic features. dynein appears to be a likely suspect, the authors ...

Media highlights in the January issues of Biophysical Journal

... by monitoring their phosphorylation status. Likewise numerous biophysical studies have explored the mechanics of single motor proteins of the myosin, dynein and kinesin families involved. Here, a biomechanical approach is taken, where in living cells the tension of the cytoskeletal network is ...

UNC scientists solve mystery of how largest cellular motor protein powers movement

... helps solve a scientific mystery: how the protein dynein fuels itself to perform cellular functions vital ... or cell division into identical cells. dynein uses energy derived from ATP, or adenosine ... and detailed molecular structure for dynein has kept scientists largely in the dark about how ...

Molecular Motors Cooperate In Moving Cellular Cargo, Study Shows

... "We discovered that two molecular motors -- dynein and kinesin -- do not compete for control, even ... individual motors measured outside the cell." dynein and kinesin are biomolecular motors that haul cargo from one part of a cell to another. dynein moves material from the cell membrane to the ...

Discovery of agile molecular motors could aid in treating motor neuron diseases

... than in one direction, as previously thought. They report their findings in a recent issue of Nature Cell Biology. The proteins in this motor, dynein and dynactin, are the "long-distance truckers" of the cell: working together, they are responsible for transporting cellular cargo from the periphery ...

A new way of looking at molecular motors

... employ all three types of motors at the same time, but in different proportions. For example, yeast uses six kinesins, five myosins, and one dynein while mammals have genes for more than 40 kinesins, 40 myosins and more than a dozen dyneins. Genetic and acquired defects in the motors cause ...

Marathon of nano-sprinters

... along filaments of the cytoskeleton, consuming energy provided by the hydrolysis of ATP, which can be considered the fuel of the cell. Kinesin and dynein motors move along microtubules and myosins move along actin filaments. The step sizes of these motors are of the order of 10 nm. By stepping in a ...

More>>

Dynein in Biological Technology

cMaster RTplusPCR System for increased sensitivity and product length in RT-PCR

... (hTSF) mRNA, 5.3 kb fragment Mouse dynein mRNA, 12.3 kb fragment Protocol: ... Three step cycling program used for hTSF and dynein ... reverse: TATTTCACTGACAGGCAATACCGTCCAAGG dynein forward: CGGCGCTGGAGGAGAA ...
Dynein in Biological Definition

Dynein

... dynein is a class of protein found in biological ... can be divided into two groups: cytoplasmic dynein and axonemal dynein. The axonemal dynein acts to activate a sliding within flagellar ...

Cilium

... nine pairs of microtubule doublets and other associated proteins. Motile cilia have a central core with two additional microtubule singlets and dynein motor proteins which are attached to the outer microtubule doublets. Biologists refer to this organization as a cononical "9 + 2" structure. The ...

Flagellum

... the interior of the flagellum is accessible to the cell's cytoplasm . This is necessary because the flagellum's flexing is driven by the protein dynein bridging the microtubules all along its length and forcing them to slide relative to each other, and ATP must be transported to them for them to ...

List of gene families

... proteins Major histocompatibility complex (MHC) Related protein families Motor proteins Myosin Kinesin dynein Signal transducing proteins Receptor tyrosine kinases G-proteins Transporters ABC proteins ...
Dynein in Biological Dictionary

Dynein

... dynein is a motor protein in cells which converts ... in ATP into the mechanical energy of movement. dynein transports various cellular cargo by ... cytoskeletal microtubules towards ... dynein , light chain, Tctex-type 3, also known as ...

Pseudogene

... Currently, none of these pseudogene detection methods is available as a ... Human genome project: advanced genome annotation tutorial. ... dynein pseudogene consisting solely of 3' UTR. KIAA1628: annotation of unfinished contigs ... Human genome project: advanced genome annotation ...
Other Contents
(Date:1/22/2015)... Glendale, AZ (PRWEB) January 22, 2015 Padre ... a long supporter of Pro Player Health Alliance ... with Padre Murphy's in getting everyone, including NFL greats, treated ... one of the leading groups supporting the cause in the ...
(Date:1/22/2015)... AngelWeddingDress, the premier women’s dress supplier, ... dresses. View website of AngelWeddingDress.com to find ... wedding dresses online for a bridal party. AngelWeddingDress offers ... for them. Its maternity wedding dresses are specially designed ...
(Date:1/22/2015)... Autocarinsurancebest.com has released a new blog post explaining the ... . , Auto insurance quotes help many drivers find ... necessary to call an agent or visit an agency for ... single website: http://autocarinsurancebest.com/ . , Every business who relies ...
(Date:1/22/2015)... 2015 Yesterday, Senator Holly Mitchell ... Kristin Olsen (R-Modesto) were honored by the California ... biotechnology, biomedical science, medical device and pharmaceutical innovation ... the “2014 Life Sciences Champion” award from CHI ...
(Date:1/22/2015)... Mass. (PRWEB) January 22, 2015 EBSCO ... (AMA) are expanding their relationship in an effort to ... around the world. While EBSCO has long made AMA journals ... a sales agent for The JAMA Network. , ...
Breaking Medicine News(10 mins):Health News:Padre Murphy's Holds NFL Retired Players Association Party Star Studded Event With Bud Light and Pro Player Health Alliance Sponsoring 2Health News:Padre Murphy's Holds NFL Retired Players Association Party Star Studded Event With Bud Light and Pro Player Health Alliance Sponsoring 3Health News:AngelWeddingDress Has Recently Released Its Collection Of 2015 Maternity Wedding Dresses 2Health News:Commercial Auto Insurance Provides Several Important Features! 2Health News:California Biomedical Community Honors Senator Holly Mitchell, Assemblymembers Susan Bonilla & Kristin Olsen 2Health News:California Biomedical Community Honors Senator Holly Mitchell, Assemblymembers Susan Bonilla & Kristin Olsen 3Health News:EBSCO Expands Partnership with the American Medical Association 2Health News:EBSCO Expands Partnership with the American Medical Association 3Health News:EBSCO Expands Partnership with the American Medical Association 4
(Date:1/22/2015)... and POINT ROBERTS, Washington , January ... covering leading sectors including technology and tech stocks, releases video ... featuring master pickpocket and security consultant Apollo Robbins . ... and talks about the Wocket™ biometric smart wallet, a product ...
(Date:1/22/2015)... has launched its new NXG series of time clocks with ... higher standard for collecting attendance and labor data and complements ... touch screen interface and seamless connection to cloud-based iSolved, the ... for the small to mid-size employer. The G2 ...
(Date:12/19/2014)... , Dec. 18, 2014 Research and Markets ... "iPhone 5S Fingerprint Sensor - Apple/AuthenTec TMDR92 & ... http://photos.prnewswire.com/prnh/20130307/600769 ... introduced the fingerprint reading feature with the iPhone 5S. ...
Breaking Biology News(10 mins):Apollo Robbins Talks about the Illusion of Personal Safety and How Easily Your Wallet is Stolen; If a Wocket Wallet is Stolen the Thief Can't do Anything With it! 2Apollo Robbins Talks about the Illusion of Personal Safety and How Easily Your Wallet is Stolen; If a Wocket Wallet is Stolen the Thief Can't do Anything With it! 3Infinisource's NXG series sets new time clock standard 2iPhone 5S Fingerprint Sensor - Apple/AuthenTec TMDR92 & Sapphire - Technology Report 2
Other TagsOther Tags