Navigation Links
Dynein in Medical News

Key factor in brain development revealed, offers insight into disorder

... the movement of a molecular motor known as dynein to the surface of both sides of the cell membrane. There, dynein takes a fixed position and, like a molecular ... of the cell toward it. Just like a pulley, dynein draws the microtubules through it and that, in ...

Alzheimer's molecule is a smart speed bump on the nerve-cell transport highway

... an important role in Alzheimers disease. dynein and kinesin proteins transport cellular cargo ... system goes awry. The transport performed by dynein and kinesin is required for continuously ... microtubules are abundantly decorated with tau. dynein and kinesin encounter the tau molecules on their ...

Tug of war in the cells

... over a cargo - for example, some of the kinesin type and some of the dynein type. The kinesin motors move to the end of the microtubule that biologists call the positive end, while the dynein motors move to the minus end. The findings of the Potsdam-based scientists ...

Can you hear me now? How the inner ear's sensors are made

... particles accumulated at the proper location to form the inner ear's crystalline sensors. "We next blocked expression of a gene that controls dynein a tiny molecular motor that drives cilia movement," said Hill. "When we examined the embryos, we saw that cilia movement came to a halt. As a ...

Discovery of Agile Molecular Motors Could Aid in Treating Motor Neuron Diseases

... rather than in one direction, as previously thought. They report their findings in a recent issue of Nature Cell Biology. The proteins in this motor, dynein and dynactin, are the “long-distance truckers” of the cell: working together, they are responsible for transporting cellular cargo from the periphery ...
Dynein in Medical Dictionary

Bronchi

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. Bronchi tis , laryngitis or croup . Measles may lead to laryngitis ( inflammation of the voice box), ... ...

Cilia

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. Cilia ry Body Melanoma Note: Some citations in the text of this section are followed by a level of evidence. Cilia ...

Movement

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. We attack this problem by asking three questions: (1) What are the structures of the macromolecular assemblies that drive cell ...

Otitis

... Overcoming dental anxiety ... nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The disorders manifest as KARTAGENER SYNDROME , chronic respiratory disorders , chronic sinusitis , and/or chronic otitis ...

Paranasal sinuses

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The URI causes inflammation of the nasal passages that can block the opening of the paranasal sinuses , and result in a ...

Respiratory disorders

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The disorders manifest as KARTAGENER SYNDROME , chronic respiratory disorders , ... ...

Sinus

... cilia ry movement in the nose, paranasal sinus es , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. Rhinitis is an inflammation of the nasal mucosa (the mucous membrane that lines the nose and the sinus ), often due to ...

Sinusitis

... ; ... cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. The disorders manifest as KARTAGENER SYNDROME , chronic respiratory disorders , chronic sinusitis , ... El atomizador ...

Sperm

... abnormal cilia ry movement in the nose, paranasal sinuses , respiratory tract, and sperm atozoa. Electron microscopy of the CILIA shows that dynein arms are missing. A pair of ducts opening at one end into the uterus and at the other end into the peritoneal cavity , over the ovary . Each ...

More>>

Dynein in Biological News

Scientists deconstruct cell division

... of Embryology have found that two proteins dynein and Nudelinvolved in other cell-division ... isolated the spindle matrix. Interestingly, both dynein and Nudel are components of the spindle matrix. ... brings it to microtubules where both Nudel and dynein then help the lamin-B assemble into the spindle ...

Mutation may cause inherited neuropathy

... in only one copy of a gene coding for one part of dynein protein have severe defects in proprioception, ... neuropathies. Mutations in the gene for dynein heavy chain 1, Dync1h, led to movement defects in ... deformities and various anatomic features. dynein appears to be a likely suspect, the authors ...

Media highlights in the January issues of Biophysical Journal

... by monitoring their phosphorylation status. Likewise numerous biophysical studies have explored the mechanics of single motor proteins of the myosin, dynein and kinesin families involved. Here, a biomechanical approach is taken, where in living cells the tension of the cytoskeletal network is ...

UNC scientists solve mystery of how largest cellular motor protein powers movement

... helps solve a scientific mystery: how the protein dynein fuels itself to perform cellular functions vital ... or cell division into identical cells. dynein uses energy derived from ATP, or adenosine ... and detailed molecular structure for dynein has kept scientists largely in the dark about how ...

Molecular Motors Cooperate In Moving Cellular Cargo, Study Shows

... "We discovered that two molecular motors -- dynein and kinesin -- do not compete for control, even ... individual motors measured outside the cell." dynein and kinesin are biomolecular motors that haul cargo from one part of a cell to another. dynein moves material from the cell membrane to the ...

Discovery of agile molecular motors could aid in treating motor neuron diseases

... than in one direction, as previously thought. They report their findings in a recent issue of Nature Cell Biology. The proteins in this motor, dynein and dynactin, are the "long-distance truckers" of the cell: working together, they are responsible for transporting cellular cargo from the periphery ...

A new way of looking at molecular motors

... employ all three types of motors at the same time, but in different proportions. For example, yeast uses six kinesins, five myosins, and one dynein while mammals have genes for more than 40 kinesins, 40 myosins and more than a dozen dyneins. Genetic and acquired defects in the motors cause ...

Marathon of nano-sprinters

... along filaments of the cytoskeleton, consuming energy provided by the hydrolysis of ATP, which can be considered the fuel of the cell. Kinesin and dynein motors move along microtubules and myosins move along actin filaments. The step sizes of these motors are of the order of 10 nm. By stepping in a ...

More>>

Dynein in Biological Technology

cMaster RTplusPCR System for increased sensitivity and product length in RT-PCR

... (hTSF) mRNA, 5.3 kb fragment Mouse dynein mRNA, 12.3 kb fragment Protocol: ... Three step cycling program used for hTSF and dynein ... reverse: TATTTCACTGACAGGCAATACCGTCCAAGG dynein forward: CGGCGCTGGAGGAGAA ...
Dynein in Biological Definition

Dynein

... dynein is a class of protein found in biological ... can be divided into two groups: cytoplasmic dynein and axonemal dynein. The axonemal dynein acts to activate a sliding within flagellar ...

Cilium

... nine pairs of microtubule doublets and other associated proteins. Motile cilia have a central core with two additional microtubule singlets and dynein motor proteins which are attached to the outer microtubule doublets. Biologists refer to this organization as a cononical "9 + 2" structure. The ...

Flagellum

... the interior of the flagellum is accessible to the cell's cytoplasm . This is necessary because the flagellum's flexing is driven by the protein dynein bridging the microtubules all along its length and forcing them to slide relative to each other, and ATP must be transported to them for them to ...

List of gene families

... proteins Major histocompatibility complex (MHC) Related protein families Motor proteins Myosin Kinesin dynein Signal transducing proteins Receptor tyrosine kinases G-proteins Transporters ABC proteins ...
Dynein in Biological Dictionary

Dynein

... dynein is a motor protein in cells which converts ... in ATP into the mechanical energy of movement. dynein transports various cellular cargo by ... cytoskeletal microtubules towards ... dynein , light chain, Tctex-type 3, also known as ...

Pseudogene

... Currently, none of these pseudogene detection methods is available as a ... Human genome project: advanced genome annotation tutorial. ... dynein pseudogene consisting solely of 3' UTR. KIAA1628: annotation of unfinished contigs ... Human genome project: advanced genome annotation ...
Other Contents
(Date:7/11/2014)... Utilizing the Keller Funnel, Quatela Center ... topped a record number of complication-free breast augmentations. ... successful procedures without the occurrence of a capsular contraction. ... the country for his expertise with the breast augmentation ... the foundation for numerous studies and research. Most ...
(Date:7/11/2014)... -- U.S. health officials have concluded that it,s highly ... during a safety mishap last month. But, the ... announced a moratorium on the transfer of any dangerous ... a report issued Friday, the CDC outlined several measures ... incident doesn,t occur again. Last month, as many as ...
(Date:7/11/2014)... According to a new market research ... Communication Technology (ZigBee, Z-Wave, Bluetooth, Wi-Fi, NFC, RFID), Application ... Transportation, Agriculture) & Geography - Global Trends & Forecasts ... Things market was worth $1029.5 Billion in 2013, and ... an estimated CAGR of 4.08% from 2014 to 2020. ...
(Date:7/11/2014)... As reported by the New ... a significant number of severe adverse events such as ... even death from the highly-promoted and costly immune-system drug, ... report , a regulatory filing revealed that the ... was almost 14% of prescriptions, up from 9.1% in ...
(Date:7/11/2014)... The Corn Farming industry experienced ... the heels of fresh biofuel demand. The Federal Renewable ... larger share of their farmland to cultivating high-value corn ... the mixing of 5.0% renewable content in gasoline across ... States created a key export market for Canadian corn, ...
Breaking Medicine News(10 mins):Health News:Rochester Surgeon Hits Milestone with Keller Funnel 2Health News:CDC Issues Tough Report on Anthrax Scare 2Health News:Internet of Things Technology & Application Market Worth $1423.09 Billion by 2020 – New Report by MarketsandMarkets 2Health News:Internet of Things Technology & Application Market Worth $1423.09 Billion by 2020 – New Report by MarketsandMarkets 3Health News:Internet of Things Technology & Application Market Worth $1423.09 Billion by 2020 – New Report by MarketsandMarkets 4Health News:Acthar’s Deadly Adverse Events Revealed 2Health News:Acthar’s Deadly Adverse Events Revealed 3Health News:Corn Farming in Canada Industry Market Research Report Now Available From IBISWorld 2Health News:Corn Farming in Canada Industry Market Research Report Now Available From IBISWorld 3
(Date:7/10/2014)... CORAL SPRINGS, Florida , July 1, 2014 ... smart wallets pave way for convenience and improved security: NXT-ID, ... Google Inc. (NASDAQ: GOOG ), Apple Inc. (NASDAQ: ... ) and MasterCard Corporation (NYSE: MA) NXT-ID, Inc., (OTCQB: ... market, is pleased to announce that the second series of ...
(Date:7/10/2014)... -- According to the new market research ... Material (Optical Prism, Pizeoelectric, Capacitive, and Adhesives), Application (Mobile ... Finance), and Geography - Global Trends & Forecasts to ... Sensors Market is projected to cross $14.35 Billion by ... 2014 to 2020. Browse more than 78 ...
(Date:7/10/2014)... Sweden , July 8, 2014 ... has won a new design win (DW). An Asian OEM ... date for mass production start in August 2014.   ... Asian smartphone OEM, which has a planned date for start ... an initial ramp order of SEK 5M, for delivery in ...
Breaking Biology News(10 mins):Advantages for Digital Wallets Eliminate Need to Carry Credit Cards - Large Scale CNBC Ad Campaign for Latest Smart Wallet to Commence July 7th 2Advantages for Digital Wallets Eliminate Need to Carry Credit Cards - Large Scale CNBC Ad Campaign for Latest Smart Wallet to Commence July 7th 3Advantages for Digital Wallets Eliminate Need to Carry Credit Cards - Large Scale CNBC Ad Campaign for Latest Smart Wallet to Commence July 7th 4Advantages for Digital Wallets Eliminate Need to Carry Credit Cards - Large Scale CNBC Ad Campaign for Latest Smart Wallet to Commence July 7th 5Fingerprint Sensors Market worth $14.35 Billion by 2020 2Fingerprint Sensors Market worth $14.35 Billion by 2020 3FPC Wins DW and Initial Ramp Order for FPC1021 Touch Sensor for Flagship Smartphone from Asian OEM 2
Other TagsOther Tags