transferase in Biological Technology

Study Finds Noninvasive Blood Test for Liver Fibrosis May Alleviate Need for Liver Biopsies for Some Patients with Chronic Hepatitis C

... assessments of hyaluronic acid (HA), a biomarker specific to liver fibrosis, with assessments of the nonspecific biomarkers bilirubin, gamma-glutamyl transferase (GGT), alpha2 macroglobulin (A2M), and age and gender. Previous studies of Hepascore in populations in France and Australia have showed it is ...

VIA Pharmaceuticals' DGAT1 Inhibitors Featured in American Diabetes Association Poster Presentation

... of compounds for the treatment of cardiovascular and metabolic disease, announced today that preclinical data related to diacylglycerol acyl transferase - 1 (DGAT1) inhibitors will be presented in a poster presentation at the 69th Scientific Sessions of the American Diabetes Association June 6, 2009 ...

High-Fidelity PCR with a Novel Polymerase Mixture

... date. Pfu DNA polymerase also lacks terminal transferase activity and produces only blunt-ended ... be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures ... be bridged by polymerases lacking terminal transferase activity 19 and template secondary structures ...

Detection of Morphine and Morphine-Glucuronide in Saliva or Urine with a Rapid and Simple Method Without Derivatization on the Varian 500-MS

... Discussion The structures of morphine and one of its metabolites are shown in Figure 1. Glucuronidation (catalyzed by uridine-glucuronic transferase or UGTs) is a Phase II metabolism reaction which involves the addition of glucuronic acid from uridine-diphosphoglucuronide to the xenobiotic being ...

Transgenic Zebrafish by Electroporation

... 79 , 6777-6781, 1982). This plasmid uses the Rous sarcoma virus (RSV) promoter to effectively drive expression of chloramphenicol acetyl transferase (CAT) in numerous eukaryotic cell types. Methods Fish Maintenance and Egg Collection ...

In Situ Cell Death Detection Kit

... strand breaks ("nicks") into the high-molecular-weight DNA. These processes can be identified by labeling the free 3-OH termini with terminal transferase (TdT), which attaches labeled nucleotides to all 3OH-ends (TUNEL reaction; TdT-mediated dUTP nick end labeling). This labeling is more ...

Housekeeping Genes: Universal Positive Controls in siRNA Knockdown Experiments

... Results siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 ...

Brilliant Core Reagent Kits for QPCR and QRT-PCR

... the sensitivity of the Brilliant two-step QRT-PCR kit to detect a low-abundance target by amplifying and detecting hypoxanthine phosphoribosyl transferase (HPRT) mRNA from human brain total RNA. For the real-time analysis of the RT-PCR amplification, we used the primers and linear hydrolysis probe ...