A Positive Selection Assay for Mutation Analysis in Big Blue Animals
...spack lambda packaging extract** for 50 packaging reactions and l cII control mutants. REFERENCES Mirsalis, J.C., Monforte, J.A., and Winegar, R.A. (1995) Annu. Rev. Pharmacol. Toxicol. 35: 145-164. Gorelick, N.J., and Mirsalis, J.C. (1996) Environ. Mol. Mutagen. 28: 434-442. ...New Kit Generates Exceptionally Pure Total RNA for RT-PCR
...highly pure total RNA qualified for RT-PCR reactions from 5 to 40 mg of tissue and 10 5 to 10... kit 3 , cDNA was synthesized, and control reactions were run in the absence of reverse transcriptase. A 1-l aliquot of each of these reactions w...Automated Fluorescent-Tag Cycle Sequencing
...erlays that hinder the loading of cycle sequencing reactions ontopolyacrylamide gels. With unmatched well-to-we...ing buffer. Two-microliteraliquots of both sets of reactions were loaded onto a 4.8% Gene Page Plus urea polyacrylamide gel and run on an ABI PRISM 377 DNA sequ...Effects of Thermal Cycler Well-To-Well Temperature Uniformity on PCR Results
...rature uniformity allows for better control of PCR reactions Michelle Cayouette Jane Moores Jason Capodanno...s prepared large enough to accommodate six reactions for each of the two thermal cyclers tested. The 50-l aliquots from this master mix were plac...Brilliant Core Reagent Kits for QPCR and QRT-PCR
...assive Reference Dye Number of reactions U.S. List Price ...assive Reference Dye Number of reactions U.S. List Price U.S. List Price/ reaction ...Control RT-PCR Primers for Human Gene Transcripts with Varying Abundance
...derived from the liver was used as template in all reactions ( Figure 3 ). The amount of PCR product was measured using quantitative densitometry and signal intensity expressed relative to the cycle number ( Figure 4 ). Based on results using real-time PCR, 6,7 we expected ...Innovative Tissue Array Technology for High-Throughput Screening of Gene Expression
...ation, prehybridization, and hybridization reactions (Methods). Fig.4 Conclusions The Complete View tissue array slide kits permit wide- spread use of tissuearray technology. With the single-slide format and convenient configuration oftissues, these innovative array slides simplify scr...New Temperature Cycler Features Interchangeable Blocks
...ll paddle of the Hot Top Assembly. A second set of reactions was prepared and cycled using identical PC...tion. As in the first experiment, multiple reactions were aliquoted from the same master mix and positioned throughout the blocks during each run...The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
...ific product. In high-throughput applications, PCR reactions are robotically assembled in multiple 96-well dishes and then stored for varying periods of time prior to temperature cycling. Nonspecific primer extension can occur frequently during prolonged storage, leading to high ...Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
... Each prep yields enough DNA for up to 50 PCR reactions with 1 ml to 5 ml of DNA, providing suffic...ing 980-bp and 5.2K-bp PCR targets) in PCR reactions with 1 ml al of genomic DNA. Genomic DNA isolated using the DNA Stat kit is suitable for amp...Novel PCR Enhancing Factor Improves Performance of Pfu DNA Polymerase
...om 0.5 to 5 U) of each DNA polymerase. The reactions shown in Figure 1 (lanes 8-14) are those that exhibited the highest yields of PCR products (for PfuTurbo and Taq DNA polymerases) or those that were carried out using the highest possible number of polymerase units b...Oil-Free PCR Using the Hot Top Assembly
...o be sensitive to smallamounts of liquid lost from reactions during cycling because this amount makesup a large...e. figure 3 Duplicate cycle sequencing reactions were set up and performed under identical cycling parameters on a RoboCycler 96 temperature ...Efficiently Insert Unique Restriction Sites into Plasmid Vectors
...r usingthe QuikChange mutagenesis kit. Mutagenesis reactions and transformation can becompleted in less than one day so putative positive clones may be examined thefollowing day. And, because high-fidelity PfuTurbo DNA polymerase isused, random mutations are minimized, rendering this the preferred method foref...Pfu DNA Polymerase as a Hot Start Alternative
...mer-extensionreactions. These mismatched extension reactions result in the synthesis ofundesirable artifactual ...s should result in fewermispaired primer-extension reactions than occur with Taq DNA polymerase,which exhibits significantly higher activity at temperatures used...Comparing Fidelity and Performance of Proofreading PCR Enzymes
...ed PCR extension times. In Figure 5 , PCR reactions were carried out as described above, except that ...PCR buffer, asrecommended by the manufacturer. PCR reactions were conducted in a RoboCycler Gradient 96 temperature cycler (Stratagene), fitted with a Hot Top a...PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
... eacholigonucleotide primer per 50 l reaction. PCR reactions were conducted inStratagenes RoboCycler Gradient 96temperature cycler fitted with a Hot Top assembly, using 200 l thin-walled PCRtubes. The temperature cycling parameters for all targets incorporated thefollowing: one cycle at 95C for one minute,...prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
...oning and RNA detection/analysis. Methods RT-PCR reactions were carried out using the recommended protocols f...r 30minutes (targets >2 kb). PCR amplification reactions (50 l) contained 1XUltra-HF PCR buffer, 200 M each dNTP, forward and reverse gene-specificprimers (2...Production of Full-Length, Biologically Active MEK1WT and MEK1CA
...o each reaction as indicated in figure 2 , and the reactions were incubated at 30C for 15 minutes and then mixed with 40 l of 2x SDS-PAGE sample buffer. REFERENCES Crews, C.M., Alessandrini, A., and Erickson, R.L. (1992) Science 258: 478-480. Zheng, C.F., and Guan, K.L. (1993) J. Biol.Chem...Performance Comparisons of Commercial RT-PCR Systems
...on systems/kits from other vendors. RT-PCR reactions were carried out under similar conditions,...on systems/kits from other vendors. RT-PCR reactions were carried out under similar conditions, according to each manufacturers recommendations. ...Map and Link Human Genetic Disorders with SSLP Analysis
...ide gels. PCR amplifications wereperformed in 25-l reactions containing 50-ng of genomic DNA; 2 units of TaqDNA polymerase; 2.5 pMol of each primer; 200 M of dCTP, dTTP, and dGTP; 2.5M dATP; 2 mM MgCl2; 10 mM Tris-HCl pH 8.3; 50 mM KCl; and 2 Ci of a -[35S]dATP.Amplification conditions consisted of an initial...High-Efficiency Site-Directed Mutagenesis of Large Plasmid Vectors
... (MMLV) gag-pol fusion protein. QuikChange reactions were performed with components of the stan...priate size (10.1-kb) were only evident in reactions performed with components of the QuikChange XL kit ( Figure 2, lane 1 ). Moreover, t...New Protocols for Isolating High- Molecular-Weight Genomic DNA
... per reactionmultiplied by the number of estimated reactions achievable from the total volume of DNArecovered. e The pfu/ugDNA was determined by dividing the total recoverable pfu by the total yield of DNA. f NR: nonerecovered. g The averageof all samples for mice, rats, and tissues combined (f...High-Throughput Isolation of Total RNA
... 3 ). The absence of bands for negative control reactions shows that the PCR reactions are not contaminated with the target sequence. Fig.3 Detecting Low-Abundance RNA Usi...A New PCR-based Mycoplasma Detection Method
... PCR using the same procedure described above. PCR reactions were conductedeither with or without a limiting amount of an internal control template(provided in the kit). When the internal control template was amplified, itgenerated a 1-kB PCR product that was easily resolved from any sampleamplification produc...Restriction Endonucleases Undergo Rigorous QC Testing to Ensure Optimal Performance
...ly interfere witheither DNA cleavage or subsequent reactions that use digested DNA (i.e.,ligation or sequencing... fragments, and phosphatases that inhibit ligation reactions byremoving the 5 phosphate from DNA ends. To ensurethat Stratagenes enzymes consistently meet the ...Functional Cloning Using ViraPort Retroviral cDNA Expression Libraries
...d with the receptor-specific antibody. PCR reactions were performed using vector-specific primers, which flank the cloning site, and genomic DNA was isolated from either uninfected NIH3T3 cells or from the sorted population as template. Figure 4B shows a prominent 1.7-kb band ...RT-PCR Primer Sets for Human and Mouse Mismatch Repair Genes
...mismatch repair were used in amplification reactions containing either cDNA template from the human pro...the human genomic DNA was used in 50-l PCR reactions using RoboCycler temperature cyclers. Each reaction was performed in 1X Taq polymerase buf...High-Level Protein Expression, One-Column Purification, and FLAG Epitope Tagging in E. coli
...ted insert; thus,enough insert for several cloning reactions may be generated with as little as10 cycles of PCR amplification. 4 There is an inherent drawback to the use of CBP fusions for certaindownstream applications for which purified proteins are employed to probeprotein-protein interactions. The ubiqui...Greater Amplification Specificity with New Hot Start PCR Enzyme
...st, background was dramatically reduced in reactions carried out with SureStart Taq DNA polymerase (Fig...late, nonspecific products predominated in reactions using 5, 50, and 500 copies (Figure 2). In contrast, SureStart Taq DNA polymerase produced s...CastAway Precast Gels for Rapid Automated DNA Sequence Analysis
...cer that can detect the products of two sequencing reactions inparallel by generating two separate gel images, ...P loci are detected in each lane (four multiplexed reactions per channel). Expect 1,440 genotypes (60 lanes x 4 loci x 2 channels x 3 loads) for ...Fluorescence-Based Single-Tube Assays to Rapidly Detect Human Gene Mutations
...me analysis) of the sample. Monitoring PCR reactions in real time produces a fluorescent signal during each cycle. Molecular beacon fluorescence is reported during each annealing step when the molecular beacon is bound to its complementary target ( Figure 3 and Figure ...Simple Isolation of RNA from Tissue and Cultured Cells
...y, follow thisprocedure to purify RNA after enzyme reactions (to remove RNA polymerase, DNase,etc.). Methods To isolate RNA, tissue or cultured cells are homogenized in lysis buffer,then the sample is passed through a prefilter by centrifugation. The prefilterremoves particulates and much of the DNA contamin...Efficient Cleavage of Fusion Proteins to Yield Native Amino Termini
...ity resin 4 (data not shown). A series of reactions containing various amounts of recombinant ...perature for 21 hours, and portions of the reactions were analyzed by SDS-polyacrylamide gel electrophoresis ((SDS-PAGE).). As the results in fi...Constructing Directional cDNA Libraries from Limited Amounts of RNA
...n cDNA library inserts were PCR amplified in 100-l reactions in0.75-ml, thin-walled PCR tubes; reaction components were as specified in the kitsmanual. These reactions were amplified using the RoboCycler 96temperature cycler and the following cycling conditions: 1 c...Randomize Gene Sequences with New PCR Mutagenesis Kit
... 5) was reamplified in two or three sequential PCR reactions (Figure 4, Lanes 8 and 9). The fr... in the lacZ gene was determined for numerous PCR reactions employing various concentrations of DNA template. PCR products were gel purified and...Gene-Specific Primers for NMDA Receptor Subunits
...for rat NMDA subunits were used for RT-PCR reactions to identify cell populations expressing th...m whole rat brain ( figure 1 ). (Data from reactions using human brain and human hNT cells as templates are not shown). PCR products resulting fr...Unique DNA Polymerase Formulation Excels in a Broad Range of PCR Applications
... a The results of numerous amplification reactions have been used to rank the PCR performance of...er in the presence of 3% DMSO, compared to reactions carried out in the absence of DMSO (data not shown). However, the mean error rate of the Her...Enhanced Amplification of Long Targets with PfuTurbo DNA Polymerase
... 1, Lanes 3 and 4; 1X buffer). In contrast, reactions carried out in 1.5X PCR buffer produced high yields of both genomic targets (Figure 1, Lanes 5 and 6). Increased performance in 1.5X buffer was partly, but not entirely, due to the 50% increase in MgSO 4 concentration ...HSVision Molecular Beacon Detection Module Rapidly Detects Herpes Simplex Virus DNA
...onserved in HSV-1 and HSV-2 genomes. 8 BecausePCR reactions are often susceptible to a variety of inhibitors in biologicalspecimens, an IAC is included in the HSV detection module to control for PCRfailure. The IAC is a plasmid encoding a sequence identical in size and GCcontent to the HSV target DNA. The HSV...Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
...proves the yield and specificity ofproblematic PCR reactions carried out with Taq DNA polymerase. Weinvestigate...oves the yield and specificity of PCRamplification reactions carried out with Taq DNA polymerase. 3,4,5 Perfect Match enhancer reduces or eliminates nonspecific ...Identification of Differentially Expressed Gene Products with the CastAway System*
...NA synthesis and further PCR amplification reactions in the presence of [a- 32 P]dATP. Following PCR amplification, an aliquot of the RAP-PCR products obtained with each cell population was resolved for 2 hours at 50 watts on a CastAway prepoured 6% polyacrylamide gel. The gel w...Unique Enhanced DNA Polymerase Delivers High Fidelity and Great PCR Performance
Improve reliability of PCR reactions with Herculase enhanced DNApolymerase Michael ...merase was compared to Taq DNA polymerasein RT-PCR reactions using a panel of targets ranging in length from 0.6 to 7.6kb. Reverse transcription of total RNA was...Tools for Detecting MSH2 Expression in Chinese Hamster Ovary Cells
...pected single 0.9-kb bandwas generated. One of the reactions was purified using the StrataPrep PCRpurification kit, and the other was purified with the StrataPrep DNA gelextraction kit. 7 Each of these fragments was labeled with a- 32 P-dCTPin a 5-minute reaction using Stratagenes Prime-It II random primer la...RT-PCR Primers for the Study of Apoptosis
...C for 2 minutes; 1cycle of 72C for 10 minutes. The reactions were stored at 6C. From each PCRamplification, 20 l was analyzed by electrophoresis on a 1.2% agarose gel inTAE buffer with 1 mg/ml of ethidium bromide for staining. The results werevisualized using Stratagenes Eagle Eye II still video system. Mou...High-Throughput System Generates Ultra-Pure PCR Products Suitable for All Applications
... binding solution is added directly to PCR reactions (with or without an oil overlay). The entire mixture is then transferred to a StrataPrep 96 Kit binding plate. After washing to remove contaminants, PCR products are eluted in a small volume of low-ionic-strength buffer and ar...Improve Amplification Specificity with Hot Start PCR Enzyme
...Taq (lane 4) DNA polymerase preparation. PCR reactions were assembled at room temperature and emplo...ureStart Taq DNA polymerase improves amplification reactions by reducing background and increasing yield of desired product. SureStart Taq DNA polymerase consis...Fast Isolation of Total RNA from Small Numbers of Cells
...as demonstrated by the lack of product for reactions in which reverse transcriptase was omitted. ...om only 10 cells ( Figure 5 ). For reactions where reverse transcriptase or cDNA template was omitted, no bands were detected; therefore,...New PCR Primers for Human Diseases
...from RNA isolated from infected cells. The control reactions were performed with DNA from both uninfect... single product of the appropriate size in reactions with DNA from infected serum samples ( figure 1 and figure 2 ), whereas amplificat......tent is usually achieved on the basis of the reactions shown by functional groups of the proteins to dye-forming reagents. The intensity of the dye correlates directly with the concentration of the reacting groups and can be measured exactly. Lowry assay 595nm Specia...Restriction Digests of DNA Isolated with the Perfectprep Gel Cleanup Kit
...of Lambda DNA was amplified in 96 30 l PCR reactions using the following Eppendorf PCR reagents. (The n... mix to the DNA samples so that all of the reactions began at the same time. All reactions were incubated at 37C for 2 hours. The reactions were ...Eppendorf Perfectprep Gel Cleanup Kit
...tly used as insert and vector in blunt-end cloning reactions which were performed in triplicate. Due to...d then loaded onto a gel. Several of these reactions were performed in order to obtain enough insert DNA for cloning. 10 g of the vector p...An Assessment of the Eppendorf twin.tec plate performance in PCR* applications
...ll twin.tec PCR plates, we carried out PCR reactions with twin.tec plates and PCR microplates f...ndorf Perfect gDNA Blood Mini Kit. All PCR reactions were performed in four sets on the Eppendorf Mastercycler gradient thermal cycler** using hu...Chemical Stability of Disposables
...ette tips are frequently exposed to chemical reactions and they must withstand the various kinds of...o ISO 9001. Chemical reactions on disposables Chemicals interact with disposables in a number of different ways.......g purposes rare and long cDNA from RT reactions GC-rich and other difficult templates. ...and chill them on ice. - Set up the complete reactions on ice. - Mix the final reaction by gently pipetting up and down (three times). Oil over...Efficient Transfection of Neurospora Crassa
...atum. 1941. Genetic control of biochemical reactions in Neurospora. Proc. Natl. Acad. Sci. USA, 27: 499-506. [2] Vann, D.C. 1995. Electroporation based transformation of freshly harvested conidia of Neurospora crassa. Fungal Genetics Newsleter. 42A, 53. [3] Davis, R.H., a...Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
...e human beta-globin gene were used for all reactions at a final concentration of 0.1 M. 536 bp ...se: 5 CCTCCAAATCAAGCCTCTAC 3 PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions...Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
...e human beta-globin gene were used for all reactions at a final concentration of 0.1 M. Forward... 5 GCAGCCTCACCTTCTTTCATGGAGT 3 PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions...Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
...e human beta-globin gene were used for all reactions at a final concentration of 0.3 M. Forwar... 5' GCAGCCTCACCTTCTTTCATGGAGT 3' PCR reactions were performed on the Eppendorf Mastercycler ** gradient using the following cycling cond...Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
...the human beta-globin gene were used for all reactions at a final concentration of 0.3 M. 536 bp ...se: 5 CCTCCAAATCAAGCCTCTAC 3 PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions......g purposes rare and long cDNA from RT reactions GC-rich and other difficult templates. ...and chill them on ice. - Set up the complete reactions on ice. - Mix the final reaction by gently pipetting up and down (three times). Oil over...