Navigation Links


concentration at biology technology

Purified Single-Stranded M13 DNA for Automated Sequencing

... the spin cup with a lowionic strength buffer. The concentration of the highly purified DNA that resultsis ideal fo...trataPrep method yielded 7.5 g of DNA at a concentration of 25 ng/l, as judged by gel electrophoresis. Figure 1 Quality Automated S...

Highest Transfection Efficiency of an Endotoxin-Sensitive Mammalian Cell Line

...lative light units (RLU) were normalized toprotein concentration and expressed as RLU/mg of protein. The transfection efficiency of StrataPrep-purified DNA, measured as total RLU/mg of protein for stimulated cells, was 1.3-, 3.4-, and 2340-fold higher than stimulated cells transfected with C...

Brilliant Core Reagent Kits for QPCR and QRT-PCR

...reference dye. Our data show that for each concentration of target DNA, the threshold cycle (Ct; th...s: 1X Brilliant Plus QPCR core buffer; the optimal concentration of MgCl 2 (3.0 to 5.5 mM); sequence-specific primers (300 to 600 nM); probe (200 to 400 nMmolecular ...

Versatile Vectors for Ponasterone A- Inducible Control of Gene Expression in Mammalian Cells

...ly assess the sensitivity of the system, both ponA concentration and induction time were varied. As the res...ved from 80 nM ponA (four fold: the lowest concentration tested) to 10 M. To more directly assess the control of protein expression in this cell ...

Genotyping Single Nucleotide Polymorphisms with Molecular Beacons

... were likely caused by a difference in DNA concentration between the samples. From the distribution of data, the three genotypes were easily distinguishedfrom one another with either of the two molecular beacons. The advantage ofhaving both molecular beacons is to clearly differentiate a homozygote fr...

Simple, Sensitive, and Rapid Detection of FLAG -Tagged Fusion Proteins

...der inducible conditions and prepared at a concentration of 40 g/ml of total protein, we observed a strong positive signal on the test strip. However, samples derived from cells grown under repressed conditions emitted no signal. When samples containing FLAG-tagged fusion proteins w...

Safe Production of High-Titer Retrovirus

...e protein allows the viral supernatants to reach a concentration of several thousand-fold by simple ultacen...d supplemented with DEAE-Dextran(Sigma) to a final concentration of 10 g/ml. Culture media was removed fromsix-well tissue culture plates containing 2 x 10 5 NIH3T3...

Novel PCR Enhancing Factor Improves Performance of Pfu DNA Polymerase

...ith PfuTurbo DNA polymerase. When the DNA template concentration was varied, PfuTurbo DNA polymerase generated the same amount of PCR product as Pfu DNA polymerase using approximately 75% less genomic DNA. These results suggest that PfuTurbo DNA polymerase is useful for both high-fi...

Optimizing Transfection Conditions for Studying Signal Transduction Pathways

...onfor decreased luciferase expression was that the concentration of the GAL4-ATF2fusion protein exceeded the level ...lasmid, into HeLa cells. While holding the concentration of the pAP1-Luc plasmid constant, we varied the amount of the pFC-MEKK plasmid ( Figure ...

Efficiently Insert Unique Restriction Sites into Plasmid Vectors

...on buffer (5 l), primers (1 l of each at a concentration of 125 ng/l), and water (40.7 l) were combined and placed in Block 1 of a RoboCycler temperature cycler, at 95C for 2 minutes. The thermal cycler was turned off to allow the samples to cool slowly to room temperature. The re...

Pfu DNA Polymerase as a Hot Start Alternative

... cloned Taq or cloned PfuDNA polymerase to a final concentration of 10 U per 200-l reaction. (Unitconcentrations of Taq and Pfu DNA polymerases were determined inthe same assay by measuring nucleotide incorporation into activated calf thymusDNA at 72C.) After 10 minutes, polymerization was stopped by transferring ...

Comparing Fidelity and Performance of Proofreading PCR Enzymes

...Increasing dNTPs (to 500 M) and PCR buffer concentration (to 1.5X) was sufficient to allow PfuTurbo DNA polymerase to synthesize complex genomic targets up to 19 kb in length. In comparison, Pfx DNA polymerase could not successfully amplify the 17-kb and 19-kb targets in the presenc...

New Protocols for Isolating High- Molecular-Weight Genomic DNA

...cal density at260 nm was used to determine the DNA concentration for each sample. The concentration wasmultiplied by the volume recovered to give the DNA yield. c DNA (8 l)was packaged per the Tr...

High-Throughput Isolation of Total RNA

...er (C t ) is inversely proportional to the concentration of target sequence in the reaction. 6 Thi...kit because Stratagenes kit yields RNA at a higher concentration withno detectable DNA contamination. Acknowledgments The authors thank Gothami Padmabandu and Rein...

High-Level Protein Expression, One-Column Purification, and FLAG Epitope Tagging in E. coli

...pHusing gentle buffer conditions. A relatively low concentration of Ca 2+ ions is required for binding (0.2 to 2.0 mM CaCl 2 ), and proteins areefficiently eluted upon removal of the calcium with 2 mM EGTA. The CBP tag issmall, (4 kDa) and therefore less likely than some of the larger tags[e.g., the 26-kDa glutath...

Easily Amplify Genomic DNA with Long-Distance PCR

...priate upstream and downstream primers (to a final concentration of0.25 M each) were added to each tube]. In the se...rom all 14 samples. Because the DNA concentration in ear clip preparations may vary, we checked the reliability of the procedure using differe...

Enzyme Immunoassay for Studying Intracellular Levels of cAMP

...ds to the antibody is inversely proportionalto the concentration of added, unlabeled cAMP in the sample. In this en... although 2.0 g/ml seems to be the optimal concentration for elevating values of cAMP. A 5-fold increase in the AC toxin concentration to 10 ...

Randomize Gene Sequences with New PCR Mutagenesis Kit

...-prone PCR enzyme and varying DNA template concentration to achieve the desired mutation frequency.... obtained simply by varying the initial target DNA concentration in the PCR reaction. For the same PCR yield, targets amplified from low amounts of t...

Unique DNA Polymerase Formulation Excels in a Broad Range of PCR Applications

...ter than 30 kb, werecommend adding DMSO to a final concentration of 3% to 7%, depending upontemplate source, templa...ontent, and amplicon length. Since the optimalDMSO concentration varies with each primer-template system, providing DMSO as asupplement rather than including it in t...

Enhanced Amplification of Long Targets with PfuTurbo DNA Polymerase

... Figure 1 shows the effects of buffer concentration on amplifications of 17- and 19-kb genomic...t not entirely, due to the 50% increase in MgSO 4 concentration (data not shown). PCR buffer titration experiments, carried out with additional PCR ...

High-Titer Retroviral Vectors for Gene Delivery

...viate the need for scale-up production and tedious concentration steps when large numbers of virus particles are required (e.g., production of cDNA expression libraries). In addition, the relatively high expression levels achieved with these vectors will facilitate library screening and enhance general-purpose gen...

Imaging Chemiluminescent Western Blots

...ions of the analysis areas are kept constant, band concentration is directly proportional to integrated den... experimental conditions, bands of the same concentration will have equivalent integrated density measurements and vice versa. Densitometric analysis ...

Identification of Differentially Expressed Gene Products with the CastAway System*

...phorbol myristate acetate (PMA) at a final concentration of 16 ng/ml. We sought to detect immediate-early genes whose expression was modulated in response to this treatment. Messenger RNA was isolated from the control (nonstimulated) cells and the PMA-stimulated cells and was used i...

RT-PCR Primers for the Study of Apoptosis

...resent in the cDNA library. Increasing the concentration of template in the reaction by 50% did not result in a significant increase of PCR products. Figure 3 The ICE-Lap-3 and Fas antigen primer sets did not amplify the expected PCRproduct from the human muscle cDNA libra...

High-Throughput System Generates Ultra-Pure PCR Products Suitable for All Applications

...followed by centrifugation to collect the DNA at a concentration that issuitable for many applications. Fig.1 For many disciplines, including molecular biology, biochemistry, neuroscience, and clinical diagnostics, the need to screen and process many PCR products simultaneously ha...

Keys to Successful Densitometry

...rchers to determine integrated density and concentration information from stained nucleic acids or ... To achieve more precise integrated density and concentration determinations, researchers using Eagle Sight software should understand how pixel saturatio...

A Comparison Study of Lipid Tranfection Reagents in A549, NIH 3T3 and COS-7 Cell Lines

...imize the amount of lipid, we compared the concentration of cell proteins after transfections (data...20 l of LipoTAXI transfection reagent, the concentration of cell protein was constant. For the other transfection agents, toxicity to cells increased...

Versatile Transfection Reagent Offers Low Toxicity and Consistent Performance

...l intensity ofa reporter gene and cellular protein concentration across a matrix ofconditions. Using this approach,...higher DNA concentrations. However, as the concentration of DNA increased, cellular protein levels decreased ( Figure 1 B), indicating cytotoxicity. ...

Mammalian and Bacterial Expression in One Vector

...was then induced by adding IPTG to a final concentration of 0.2 mM. The induced and uninduced cultures were... by standard methods, 6 and the total protein concentration was determined by Bradford assay. Equal amounts of protein from IPTG induced and uni...

Low-Toxicity, Lipid-Mediated Transfection of Mammalian Cells

...achieving optimaltransfection efficiencies are the concentration of DNA and the volume ofLipoTAXI transfection reag... 1 ). These data show that an increase in the concentration of DNA results in greater signal production from the reporter gene. As the volume of ...

Fast Isolation of Total RNA from Small Numbers of Cells

...er (C t ) is inversely proportional to the concentration of target sequence in the reaction. 8 The Mx4000 molecular beacon GAPDH expression analysis kit specifically detects GAPDH mRNA sequences but not genomic DNA or pseudogene sequences. 9 Detecting as little as 1 pg o...

Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit

...parison. To guarantee the initial bacteria concentration was identical in all experiments, a starter culture was grown in LB media overnight. After this initial growth, 10 l of the culture was inoculated at mid log phase (A595 = 0.643) in 1.5 ml of each media. The Eppendorf T...

A membrane-lid tube for bacteria cultivation and freeze-drying

...sks. To ensure an identical initial bacteria concentration in the different test tubes, LB (Luria Bertani) ...btilis 168 (strictly aerobic) were inoculated at a concentration of 1% into the LB medium. 1 ml of this medium was then transferred into each 1.5 ml Lid ...

Quantification made easy

...ns (e.g. TE buffer) are ideal for this method. The concentration is determined by measuring at 260 nm against... factor. Normally, the user has to calculate the concentration of the measured sample using according factors. In contrast, the BioPhotometer can change ...

Sample Preparation for Microinjection

... the capillary exchange depends on the concentration and clarity of substance injected. ...inity purification is recommended. The concentration of the material injected should be 10 to 20 times higher than that required for the opti...

Restriction Digests of DNA Isolated with the Perfectprep Gel Cleanup Kit

... parentheses represent the final amount or concentration of the reagent in each reaction.): Template DNA (50 ng) 10 x Taq DNA Polymerase Buffer (1x) dNTP Mix (0.2 mM) 25 mM MgCl2 (0.5 mM) 10 mM dNTP Mix (0.2 mM) Taq DNA Polymerase (0.05 U/l) Mo...

Eppendorf Perfectprep Gel Cleanup Kit

...ts. The numbers in parentheses represent the final concentration or amount of the component in each reactio... Eppendorf Gel Cleanup Kit and eluted in 30 l. DNA concentration was determined by A260 readings. Shrimp Alkaline Phosphatase Treatment: The ...

Eppendorf Perfectprep Gel Cleanup Kit

...(5'-TCCCCAGCGACCAGATGATCACACT-3'). A final concentration of 40 pg/l template was added to each reaction. Cycling parameters specific to the primers were used. Sequencing Sequencing was performed on 5 l of purified PCR products in triplicate. and Brand Q's Gel Extraction K...

Chemical Stability of Disposables

...so subject to the influences of temperature, concentration level, period of exposure, and any synergistic effects of solvent mixtures. The following classification is therefore only able to provide information of a general nature. In case of any doubt, you must conduct a test. Please also n...

TripleMaster PCR System

...d 4 Enzyme concentration 5 Enzyme ...m 11.3 Enzyme concentration 11.4 Concentrations of dNTPs and Mg 2+ ...

Efficient Transfection of Neurospora Crassa

... to a 2 ml Eppendorf microcentrifuge tube. The concentration of the suspension was determined using a hemacytometer. The optimal concentration is approximately 2.5 x 10 9 /ml. It may be necessary to concentrate or dilute the sa...

M13/Phagemid DNA Extraction Protocol

...per phage M13K07 is added to a final concentration of 2 x 107 pfu/ml and the culture is incubated for 1.5 hours at 37C with sufficient agitation. Recover resultant supernatant to a fresh tube or bottle and re-centrifuge as above. ...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

... gene were used for all reactions at a final concentration of 0.1 M. 536 bp fragment Forward: 5 GCAGCTACACAGCTACCATTCTGC 3 Reverse: 5 GCAGCCTCACCTTCTTTCATGGAGT 3 2 kb target: Forward: 5 GAAGAGCCAAGGACAGGTAC 3 Reverse: ...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

...use the gDNA isolated from buffy coat is higher in concentration and yield than the corresponding whole blo...ditional step, the benefits of higher gDNA concentration and yield out-weigh the extra effort. Materials ...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

...andard application. In some instances, the concentration of the resulting gDNA may be more importan... With a decrease in elution volume, an increase in concentration of contaminants may be expected. Restriction digests were performed to test the purity of ...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

... gene were used for all reactions at a final concentration of 0.3 M. 536 bp target: Forward: 5 GCAGCTACACAGCTACCATTCTGC 3 Reverse: 5 GCAGCCTCACCTTCTTTCATGGAGT 3 2 kb target: Forward: 5 GAAGAGCCAAGGACAGGTAC 3 Reverse: ...

TripleMaster PCR System

...d 4 Enzyme concentration 5 Enzyme ...m 11.3 Enzyme concentration 11.4 Concentrations of dNTPs and Mg 2+ ...

Efficient Transfection of Neurospora Crassa

... to a 2 ml Eppendorf microcentrifuge tube. The concentration of the suspension was determined using a hemacytometer. The optimal concentration is approximately 2.5 x 10 9 /ml. It may be necessary to concentrate or dilute the sa...

Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit

... gene were used for all reactions at a final concentration of 0.1 M. 536 bp fragment Forward: 5 GCAGCTACACAGCTACCATTCTGC 3 Reverse: 5 GCAGCCTCACCTTCTTTCATGGAGT 3 2 kb target: Forward: 5 GAAGAGCCAAGGACAGGTAC 3 Reverse: ...

M13/Phagemid DNA Extraction Protocol

...per phage M13K07 is added to a final concentration of 2 x 107 pfu/ml and the culture is incubated for 1.5 hours at 37C with sufficient agitation. Recover resultant supernatant to a fresh tube or bottle and re-centrifuge as above. ...

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume

...andard application. In some instances, the concentration of the resulting gDNA may be more importan... With a decrease in elution volume, an increase in concentration of contaminants may be expected. Restriction digests were performed to test the purity of ...

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit

...use the gDNA isolated from buffy coat is higher in concentration and yield than the corresponding whole blo...ditional step, the benefits of higher gDNA concentration and yield out-weigh the extra effort. Materials ...

Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

... gene were used for all reactions at a final concentration of 0.3 M. 536 bp target: Forward: 5 GCAGCTACACAGCTACCATTCTGC 3 Reverse: 5 GCAGCCTCACCTTCTTTCATGGAGT 3 2 kb target: Forward: 5 GAAGAGCCAAGGACAGGTAC 3 Reverse: ...

An Optimal DNA Microarray Substrate for the Identification of Fetal and Somatic Liver Stem Cells of the Rat

... were dissolved in water and adjusted to a concentration of 100 M. Prior to printing, they were mixed 1:1 ...y remove the free nucleotides and attain a concentration of the cDNA. Hybridization For the hybridization reaction, the labeled cDNA was mixe...

Optimizing electroporation parameters

... acid concentration, but only within a limited concentration range. Tests with various different cell l...n NIH-3T3 cells in relation to the DNA concentration (g/ml). The cells were electroporated with different concentrations of the pEGFP-N1 ...

Isolation of Cosmids using Eppendorf's Perfectprep Plasmid Mini Kit

...oculated in 3 mls of LB with kanamaycin at a final concentration of 50 mg/ml. The cultures were placed in 14 ml snap cap tubes and allowed to grow at 300 rpm and 37C for 1416 hours, optimal growth will give OD 600 readings of an 1.52.0. Purification Cells were ha...

Agrobacterium tumefaciens

... Resuspend the cells in 10% glycerol to a final concentration of 4-6 x 10 11 cell/ml and store frozen at 70 C. For electroporation frozen cells were thawed in ice and diluted with sterile water to a density of 1 x 10 10 cells/ml prior to use. Electroporation...

Efficient Recovery of Ultrapure Plasmid DNA

... Fig. 2: The concentration of plasmid DNA obtained with the plasm...nd maxi-prep scale). In each case, the concentration was determined spectrophotometrically. Midi-Prep 1 (25 ml preparation): Vector pEGFP-N1;...

Brucella abortus

... Resuspend the cells in 10% glycerol to a final concentration of 4-6 x 10 11 cell/ml and store frozen at 70 C. For electroporation frozen cells were thawed in ice and diluted with sterile water to a density of 1 x 10 10 cells/ml prior to use. ...

Escherichia coli C600

... Resuspend the cells in ice-cold water to a final concentration of approximately 2 x 10 11 cells/ml. ...ls in ice-cold 10% glycerol to a final concentration of approximately, 2 x 10 11 cells/ml. Aliquote 40-300 l cells into prechilled centrifug...
Other Contentsplanuslilylighteninglighterlighterlighterlighterlighterlinguarangerangerangerangerangerangerangerangerangerangelimitedlimitedlimitedlimitedlimitedlimitedlimitedlimitedlimitedlimited
(Date:8/20/2008)... HOUSTON (Aug. 20, 2008) The genetic code of a ...earn more about how groups of genes function in hu... week in the journal Nature breaks down the gene...ure that one might find anywhere in the world, eve...ing to identify, in the Trichoplax , genes that a...
(Date:8/20/2008)... PACEMAKERS are supposed to protect people from h...digital as well as biological security. , Earlier...d Medical School demonstrated how a commercial rad...mmunications from a pacemaker ( New Scientist, 22...to monitor and adjust the implanted device, but a ...
(Date:8/20/2008)..., It,s estimated that the red tide algae, Ka...bloom in economic damage off the coast of Florida ...nology have found that a diatom can reduce the lev... the same diatom can reduce red tide,s toxicity to...se this process to reduce the toxicity of red tide...
(Date:8/20/2008)... The Centre for Addiction and Mental Health (CAMH...5 million by the Canada Foundation for Innovation ...ding, intervention, treatment and prevention of me...cellence. , This funding from the Large-Scale I...h Hospital Fund will allow CAMH to leverage our sc...
Breaking Biology News(10 mins):Genome of saltwater creature could aid understanding of gene grouping 2How to stop a new type of heart attack 2Biologists find diatom to reduce red tide's toxicity 2Biologists find diatom to reduce red tide's toxicity 3Large-scale investment catapults CAMH's mental illness and addiction research forward 23rd Annual Conference on Pain Jointly Sponsored By Rehabilitation Institute of Chicago and MediCom Worldwide Inc 22643 13rd Annual Conference on Pain Jointly Sponsored By Rehabilitation Institute of Chicago and MediCom Worldwide Inc 22643 2One Year Later Millions are Losing Weight with alli 28R 29 22639 1One Year Later Millions are Losing Weight with alli 28R 29 22639 2One Year Later Millions are Losing Weight with alli 28R 29 22639 3Tolerx Named as One of the Fierce 15 Biotech Companies of 2008 6186 1Tolerx Named as One of the Fierce 15 Biotech Companies of 2008 6186 2Tolerx Named as One of the Fierce 15 Biotech Companies of 2008 6186 3Network science for eternal happiness and good business 3749 1
(Date:8/20/2008)...very -- that calorie-burning brown fat can be prod... mice -- raises the prospect of new ways to fight ...arber Cancer Institute. , Reporting in the Aug. ...demonstrated that brown fat, which is known as the...calories and releases energy, unlike "bad" white f...
(Date:8/20/2008)...spital (MGH) investigators have found that infusio...to protect gastrointestinal tissue from autoimmune...ed in the journal Stem Cells , the team from the ... mesenchymal stem cells (MSCs), known to control s...eration of the gastrointestinal lining in mice wit...
(Date:8/20/2008)...a to Launch Summit Conversations Series, WASHINGT...genda: Health,Care for All will be honoring Rep. R... leader, for his leadership and commitment to affo...Democratic National Convention,in Denver, Colorado...",America,s Agenda will also be launching its new ...
(Date:8/20/2008)...Newswire/ --You,re late for work, your toddler,spi.... How do you deal with,the rising anger? Whether y...ation, how you deal with anger affects not only yo...en your career., As hard as we may try to stay ca... While feeling anger isn,t a bad thing, it is impo...
Breaking Medicine News(10 mins):Health News:Making 'good' fat from muscle and vice versa 2Health News:Making 'good' fat from muscle and vice versa 3Health News:Bone marrow stem cells may help control inflammatory bowel disease 2Health News:Bone marrow stem cells may help control inflammatory bowel disease 3Health News:America's Agenda to Honor Former House Majority Leader Richard Gephardt at Democratic National Convention 2Health News:Taming Your Temper: Learning to Turn Down the Heat 2
Other TagsBankingAilingRegistrationOther Tagspolymer 2polymer 3links 2links 3links 4links 5links 6synthetic 2synthetic 3synthetic 4synthetic 5synthetic 6synthetic 7synthetic 8core 2core 3core 4core 5core 6core 7produced 2produced 3produced 4produced 5produced 6produced 7produced 8produced 9produced 10mass 2mass 3mass 4mass 5mass 6mass 7mass 8mass 9mass 10inexpensive 2inexpensive 3