Navigation Links
Cat in Biological Technology

China Agro-Technology Appoints New CEO

... 2008. Mr. Cantonnet is based in New York. cat is a leading agro-biotechnology company listed on ... of US$35 million and net income of US$32 million. cat promotes ecologically sustainable technology to ... the acute demands for paper products. cat is primarily involved in the ownership, ...

Biomerica Introduces a New 15 Minute Home Test for Allergies to Cats and Receives CE Mark Approval for Home Use

... 10 million people in the U.S. are allergic to cat dander, the most common pet allergy. cat allergies are about twice as common as ... various European countries." Biomerica's Fortel cat allergy test utilizes an advanced technology that ...

One Year On, ALLERCA Hypoallergenic Cats Bring 'Sneeze Free' Companionship to Allergy and Asthma Sufferers

... time have allowed severely allergic and asthmatic cat lovers to enjoy the companionship of a furry friend. For Jill Skibba of Los Angeles, an ALLERCA cat was her only option to own anything but a pet ... of Connecticut was one of the first allergic cat lovers to sign up with ALLERCA, placing her order ...

Scientists say sabercat bit like a pussycat

... In public imagination, the sabre-toothed cat Smilodon ranks alongside Tyrannosaurus rex as the ... and to apply the technique to a fossil big cat required some tricks engineers usually have to ... have seriously limited the big toothed fossil cat cat to a very specific range of killing ...

New Discoveries on a Fingertip Test for Screening Silent Heart Disease Promising Results of Recent Clinical Studies to be Presented during the 2009 American College of Cardiology Conference, March 29th - April 1st in Orlando

... factor measurements as well as advanced, structural imaging tests, such as cat scan and MRI. "I acknowledge that it doesn't seem logical that ... as high cholesterol) or advanced, non-invasive imaging techniques such as cat scan and MRI. While traditional risk factors are good for long-term ...

New Innovation Set to Revolutionise Spray Technology - Used to Protect Against the Scottish Biting Midge & Help Fight MRSA in the NHS

... and is endorsed by Allergy UK for helping to remove house dust mite and cat allergen from the air. Test show that once removed, particles are ... Cleanaer is endorsed by Allergy UK for the removal of house dust mite and cat allergen, for a room up to seventeen cubic meters. This size is the ...

Time Clocks Technology Catches Up With Crooks

... you are, from anywhere on the web, at anytime! Sydney, NSW (PRWEB) July 24, 2009 -- Technology is putting an end to the cat and mouse game of sneaking in late to work - the mouse is caught at the door, in the back room, or on pay day! We rounded up a group of intuitive ...

Diagnostic Imaging - Enters Purchase Agreement to Acquire Teleradiology Company

... a purchase agreement to acquire Canadian Teleradiology Services (CTS). CTS specializes in Teleradiology, the remote readings of MRI's, CT, PET, cat and X-rays. This service allows hospitals in remote areas to provide radiology services to its indigenous community 24hrs per day. In large ...

Humanitarian Offers $75 Million for Single Dose Sterilization of Cats and Dogs

... introduction of methods to non-surgically sterilize dogs and cats and to support the distribution and promotion of these products to humanely control cat and dog populations worldwide. ACC&D's Board of Advisors include leading scientists, veterinarians and animal health industry experts as well as ...

UA optical scientists add new, practical dimension to holography

... be for medicine. "Three-dimensional imaging techniques are already commonly used in medicine, for example, in MRI (Magnetic Resonance Imaging) or cat scan (Computerized Axial Tomography) techniques," Tay said. "However, the huge amount of data that is created in three dimensions is still being ...

Circassia Raises GBP11 Million ($21.8 Million) in Oversubscribed Second Round Funding

... 2007. During the last year the company has finalised preparations to complete the phase II clinical testing programme for its lead product against cat dander allergy, and finalised the acquisition of its ToleroTrans organ anti-rejection technology. Following this second investment round, Circassia ...

What To Do When a Holiday Guest Shows Up With a Pet

... surroundings? -- Where would the animal stay? Indoors or outdoors? Confined or allowed to roam? -- What if the dog barks too much or the cat scratches furniture? -- Will anyone participating in the holiday festivities have pet allergies? -- Are you willing to risk a friendship if ...

Make way for the real nanopod

... design and construction of the radio. We started out by making an exceptionally sensitive force sensor, Jensen said. Nanotubes are like tiny cat whiskers. Small forces, on the order of attonewtons, cause them to deflect a significant amount. By detecting this deflection, you can infer what ...

AstraZeneca Bolsters Its Worldwide Biologics Division Through Integration of Cambridge Antibody Technology Into MedImmune

... site head in Cambridge. Dr. Stageman commented, "AstraZeneca's biologics capabilities have been enhanced significantly by the acquisitions of cat and MedImmune to create a more robust, highly competitive and fully integrated biotechnology business. The scientific, technical and ...

2006: A mixed blessing for Midwest life science companies

... Islam does not ring any bells, try this name: cat Stevens . As we have heard a lot from Clapton ... and virtually nothing for almost 30 years from cat Stevens, I will focus my comments on the latter ... of the anti-Vietnam War movement in the U.S., cat Stevens' music seemed to be a dominant force in ...

Monitoring Receptor-Mediated Changes in [Ca2+]i Using Single-Wavelength and Dual-Wavelength Indicators on the FlexStation Workstation

... FlexStation Calcium Assay Kit (Molecular Devices, cat # R8041), ATP (Adenosine 5'-triphosphate disodium salt, Sigma, cat # A2383), probenecid (Sigma, cat # P8761), DMSO, low water content ...

Dual-Luciferase Quantitation in the LMax Microplate Luminometer (MaxLine Application Note #39)

... 1. Dual-Luciferase Reporter Assay System kit, cat #E1960; Promega Corporation. The contents ... (E194A). 2. Firefly Luciferase, Sigma cat # 9506. 3. Recombinant Renilla luciferase; Novalite, cat #4400; Chemicon International; 800-437-7500. ...

Transgenic Zebrafish by Electroporation

... 9, 1989) in 6x SSC for 2 hours at 68 C. The cat gene (1.6 kb) is cut out of a plasmid ... and the soluble proteins tested for cat enzyme activity (Neumann, J. R., et al., ... Figure 3 shows the results of a cat enzyme assay of the soluble proteins ...

Translate High Yields of Active Protein

... Autoradiograph of 35 S-labeled GFP and cat proteins that were in vitro ... the method described by Shaw [1] to evaluate cat activity. ... total protein yields were calculated. cat activity was measured using methods described by ...

pSilencer 4.1-CMV: Versatile Vectors for Expression of siRNA, miRNA, and mRNA

... correlation between luciferase or cat gene transcript levels and the enzymatic activity ... carrying either a firefly luciferase cDNA or a cat cDNA. (A) Relative luciferase ... after transfection. (B) Relative cat activity 48 hours after transfection. NT = not ...

Transfection Reagent Selector Kit Handbook

... cells transfected with -gal or cat reporter constructs are typically incubated for ... A to chloramphenicol. In the common cat assay, cell lysates prepared from ... chromatography. A qualitative estimate of cat activity can be obtained simply by ...

Genetic Reporter Systems

... A to chloramphenicol. With the cat assay, the CAT-containing lysates of transfected ... increasingly common, non-radioactive alternative, cat expression is quantified by an ELISA via immunological detection of the cat enzyme which has been expressed. ...

Genetic Reporter Systems

... A to chloramphenicol. With the cat assay, the CAT-containing lysates of transfected ... increasingly common, non-radioactive alternative, cat expression is quantified by an ELISA via immunological detection of the cat enzyme which has been expressed. ...

RNAi: Get the Whole Story

... RNA probe transcribed from pTRI-GAPDH human (Ambion cat #7430). For the Western blot, anti-GAPDH antibody (Ambion cat #4300) was used. Figure 2 also ...

The Role of Engineering in Health Science and Technology

... and associated increase in transistor-switching speed, in integrated circuits provides the computing power to enable real-time three-dimensional cat (computer-aided tomography) scans to check for diseased or abnormal organs. A similar exponential growth in communication bandwidth provides the ...

Wisconsins insurance companies use advanced IT to speed relief

... sustains itself as a mini-office, said Wendy Scheper, catastrophe claims manager for American Family. They can be there in a matter of hours. The cat Trailer has responded to large-scale weather events in the past, including the Ladysmith Wisconsin tornado in 2002, which heavily damaged much of the ...

Google delves deep within your computer with new desktop tool

... within your very own computer rather than just the puny recesses of the rest of the world. Sure, you can find 60 million instances of the word cat within the 4.2 billion Web pages currently spidered by Google , but how easy is it to find that special phone number you typed in 1997 and stored ...

Wisconsin doctors pinpoint cancer with TomoTherapy radiation treatment

... to treat by normal means. In the TomoTherapy system, patients lie on a table that goes through a rotating tunnel, similar to the procedure for a cat scan. As they pass through the system, the tunnel walls rotate in a spiral pattern, sending radiation beams at an infinite number of angles to reach ...

Living the sweet life... in IT?

... call and some project planning, I couldn't help but notice the yellow finches zipping in and out from the feeder and one particularly spoiled cat stretched out in the sun to the fullest extent of the law. In the middle of this good day I picked up on a story comparing our U.S. lifestyle to the ...

Debate over `intelligent design' is a not-so-wise diversion from science education

... Madison, Wis. - The day an archeologist finds a fossil cat or dog in Precambrian rock is the day Charles Darwin's evolution theory is disproved. But that hasn't happened. In fact, the Earth's fossil records ...

Is Google's cafeteria a competitive weapon?

... de rigueur fashion at Google Labs), taking short naps to enhance the information processing capacity of the brain (Google Labs' engineers can take cat naps whenever necessary as long as they "refrain from drooling on their keyboards"), exercising to increase blood flow to the brain (Google's campus ...

Luciferase Reporter Gene Cells and Recombinant Luciferase Dilutions Studied with the CLIPR Luciferase Assay Kit and the LMax Microplate Luminometer (MaxLine Application Note #38)

... 1. Lmax microplate luminometer with SOFTmax PRO for Lmax (Molecular Devices Corp.) 2. Recombinant Firefly Luciferase, Sigma cat # 9506. 3. CLIPR Luciferase Assay Kit, Cat. No. R 8032; Molecular Devices Corporation; 1-800-635-5577. The kit contains luciferin (lyophilized) ...

High Sensitivity, Wide Dynamic Range, Horseradish Peroxidase (HRP) ELISA Using the LMax Microplate Luminometer (MaxLine Application Note #41)

... LMax microplate luminometer with SoftMax Pro for LMax (Molecular Devices Corp.) 2. QuantiGlo Human TNF-α Immunoassay kit (R&D Systems1, cat #QTA50). The kit contains all reagents and standards needed for the assay, including the polystyrene microplate (12 strips of 8 wells@) pre-treated ...

Quantitative Analysis of the Cell Cycle in Imaging Applications

... metabolic inhibitors, aphidicolin (Sigma-Aldrich, A0781), a DNA topoisomerase alpha inhibitor (G1/S blocker) for two hours or colcemid (Sigma-Aldrich cat # D7385) a (G2/ M blocker for two hours. During drug treatment, cells were cocultured with 20 μM BrdU (Calbiochem, 203806) (a thymidine analogue ...

Detection of K-ras Point Mutations in the Pancreas by Constant Denaturing Gel Electrophoresis Using the DCode System

... 0.2 mM each dNTP and 2 mM MgCl 2 . The reactions contained in a total volume of 25 l 50 ng of 3-primer (cta ttg ttg gat cat att cg), 100 ng of 5-primer (cgccgccgcgccccgcgcccgtcccgccgcccc cgcccc ctg aat ata aac ttg tgg), and 0.5 U of Taq DNA polymerase ...
Other Contents
(Date:7/28/2014)... South Pole in 1911, but new research shows that ... Using data from 16 ice cores collected from widely ... Pole, a group led by Joe McConnell of the ... most accurate and precise reconstruction to date of lead ... in an article published today in the online edition ...
(Date:7/28/2014)... and organic compounds in hydrothermal environments are critical components ... for the deep biosphere, and may have implications for ... about how minerals influence organic reactions. A team ... a common mineral acts as a catalysts for specific ... solvents or expensive reagents. , At the heart of ...
(Date:7/28/2014)... A study of juvenile rat brain cells suggests that ... the connections between brain cells are temporary. , The ... PLOS ONE , was conducted by biologists at ... Medical College in New York in response to concerns, ... decade, that exposing children to general anesthetics may increase ...
Breaking Biology News(10 mins):Lead pollution beat explorers to South Pole, persists today 2Lead pollution beat explorers to South Pole, persists today 3Mineral magic? Common mineral capable of making and breaking bonds 2Mineral magic? Common mineral capable of making and breaking bonds 3Study suggests disruptive effects of anesthesia on brain cell connections are temporary 2Study suggests disruptive effects of anesthesia on brain cell connections are temporary 3
(Date:7/29/2014)... TN (PRWEB) July 29, 2014 The ... the reimbursement model of all hospitals. Studies show that ... One simple, easy, low cost tool that great ... performance by 20 to 25%. , Their secret? Debriefing ... one anther at the end of an operational event. ...
(Date:7/29/2014)... to a more streamlined process for obtaining stem cells, which ... tissue for failing body parts, according to UC San Francisco ... Cell . , The work builds on a strategy ... in which they again have the potential to become any ... may soon increase thanks to the scientists, identification of biochemical ...
(Date:7/29/2014)... 2014 On Friday, the United States ... week of October 12-18, 2014, as "National Case Management ... improving healthcare outcomes for patients. The resolution was introduced ... (R-AR), with support by the Case Management Society of ... case management professionals for their contributions to healthcare. , ...
(Date:7/29/2014)... July 29, 2014 The Eleventh Annual ... Summit concluded with the $10,000 prize being presented to ... http://www.bikanta.com ) , The 11th Annual Summit was held ... entrepreneurs who can bring innovative products and services for ... pleased to have had such excellent array of young ...
(Date:7/29/2014)... Lean and Lovely, an affordable and short program, claims ... wear a bikini in the near future. This has caught ... , “Our Lean and Lovely review shows that ... levels. Neither your age nor your body shape matters, which ... the beginning, you will achieve the results that you have ...
Breaking Medicine News(10 mins):Health News:One Brilliant Economic Survival Tool You Can Steal from the World's Best Hospitals 2Health News:One Brilliant Economic Survival Tool You Can Steal from the World's Best Hospitals 3Health News:Stem cell advance may increase efficiency of tissue regeneration 2Health News:Stem cell advance may increase efficiency of tissue regeneration 3Health News:CMSA Supports National Case Management Week Resolution Introduced in US Senate 2Health News:Silicon Valley Boomer Venture Summit Names Bikanta Competition Winner 2Health News:Lean and Lovely: Review Examining Neghar Fonooni’s Program Released 2
Other TagsOther Tags