Navigation Links
Mouse in Biological Dictionary

Transgenic mouse

... ... Explanations about transgenic mouse and the history of biological experimentations ... mice - TOP 100 BIOLOGY SITES ... Trangenic mouse Facility - Home Page ... The UC Irvine Transgenic mouse Facility is a core facility that provides ... ...

Synteny

... Steve Fischer at the ... ... the genomes of mouse and humans - synteny ... 1. Synteny between the mouse and human genomes ... function, but it is not ... on ... Synteny map. Human NCBI build 31 vs. mouse NCBI build 30. Conserved ... ...

Mouse

... A mouse (plural mice) is a small mammal belonging to the order of rodents. The best known mouse species is the common house mouse (Mus musculus). It is also a popular pet. The ...

His tag

... #2365. pathway. more ... 2276 Myc- Tag (9B11) mouse mAb. 2372 β-Gal (14B7) mouse mAb. 2396 MBP (8G1) mouse mAb ... Product Pathways - Related Products. ...

Gene knockout

... function. Researchers ... A knockout mouse is a genetically engineered mouse in which one or more genes have been turned off ... Molecular ... ... example, the p53 knockout mouse is named after the p53 gene , which codes for a ...

Dysgenic

... have been studied in animals such as the mouse and the fruit fly. ... For an environment ... What is dysgenic cross? Why would a dysgenic mouse die shortly ... "David Starr Jordan on the ... from the homozygous dysgenic (mdg/mdg) mouse cell line GLT ... Differentiated GLT dysgenic ...

CDNA clone

... sequences by following links from the Gene ... mouse protein-coding gene. Represented by 73 ESTs from ... PROTEIN SIMILARITIES ... How can I view NIA mouse cDNA Clone Set(s) verification results? ... NIA mouse cDNA Clones numbered? We are interested in ...

Blastomeres

... publishes full-length research ... from single mouse blastomeres ... Nature is the international ... organs ... Blastomeres of the early mouse embryo are thought to be equivalent in their ... embryos and isolated blastomeres derived from mouse 2 cell embryos were investigated. ... used for ...

Sequencing

... to bacteria. ... Danio rerio Sequencing Project: ... C57BL/6J mouse Sequencing : 5 times coverage of the genome of mouse strain C57BL/6J using the shotgun sequencing approach ... Research ...

Satellite DNA

... A purification scheme for satellite DNA containing chromatin from mouse liver ... Satellite DNA content of chromatin fractions isolated from Eco R1-digested mouse ... Satellite DNA sequences are known to be highly variable and to ...

Promoter

... utitlity, link checker, html validator, ranking utility and more! The mouse Promoter 1.0R Array is a single array comprised of over 4.6 million probes tiled to interrogate over 28,000 mouse promoter regions. Compare Cheap Prices for Adhesive Promoter at ...

Olfactory bulb

... — Johns ... Johns Hopkins researchers have found that transplants of mouse stem cells taken from the adult brain's olfactory bulb can delay symptoms and death in a mouse ... Cell death and differentiation is a monthly research journal ...

Mammary gland

... topics related to the " ... 4.1 Programmed Cell Death in the Involuting mouse Mammary Gland ... Joomla - Dinamil içerik yönetim sistemi ... The ... 3.0 Human Breast Cancer. 3.1 Breast cancer risk factors ... Emice > mouse Models > Organ Site Models > Mammary Gland Cancer Models : ... ...

Kinetochore

... ... GO:0000776 : kinetochore [243 gene products] ... Buy quality mouse ZW10 antibody (interacts with human), anti-ZW10, ZW10, kinetochore associated, homolog (Drosophila) (ZW10) antibody, mouse monoclonal antibody, ... Definition of kinetochore from the ...

Gene map

... Terminology. ... Database of gene expression patterns in the mouse brain. ... mouse Diversity Study characterizes gene expression across genetic ...

Exon

... 5. agcaggaggaggcagcggaagaggatgctg aagcagaggctgagaccgag ... GeneChip® mouse Exon 1.0 ST Array offers new insight and powerful key information for ... computing dictionary. ... the two motifs are conserved in mouse orthologous genes that undergo exon skipping. ... For example, ...

Cytogenetics

... the University of Washington and the Department of Patholgy. ... Finally, mouse cytogenetics provides a link to information about the mouse genome. ... Cytogenetics Laboratory. Neoplastic Studies. Pre-natal ...

C Terminus

... Images ... VR1- C (TRPV1- C Terminus ) VR1-N. VR1 C-Terminus (TRPV1) - mouse specific ... VR1- C (TRPV1- C Terminus ) IHC Images from Various Labs. ... as a query to build the position-specific ... In the C terminus of mouse -ENaC, it included Ser640. ... The C terminus of the -subunit, on the ...

Zona pellucida

... to WikiDoc. ... The zona pellucida is seen as a thick clear girdle surrounded by ... tered in discussions on the mechanism of loss of the mouse zona pellucida in ... stained with Mallory's trichrome, which stains the zona pellucida blue. Space within ... Complete information for ...

Viral oncogene

... MYBL2 4605 v-myb myeloblastosis viral oncogene homolog (avian)-like 2. Cards. Atlas ... LS-C537 - This monoclonal antibody was raised in mouse and recognizes Human V-rel Reticuloendotheliosis Viral Oncogene Homolog A (RELA). Suggested uses include: ... This polyclonal antibody was ...

Ubiquitin

... roles of ubiquitin and the 26S proteasome in the life of plants. ... Proteolysis, the ubiquitin -proteasome system, and renal diseases. ... mouse protein-coding gene Ubc. Represented by 2568 ESTs from 329 cDNA libraries. ... Ubiquitin , becomes conjugated to proteins, marking them for ...

Transport protein

... Institute ... Organic cation transport proteins belong to this group. ... Organic cation transport protein . IPR011701. Major ... mouse protein -coding gene Vat1. Represented by 685 ESTs from 170 cDNA libraries. ... Mus musculus vesicle amine transport protein 1 homolog (T ...

Transmembrane proteins

... transmembrane proteins play an essential role in intercellular ... The Effects of Alternative Splicing on Transmembrane Proteins in the mouse Genome ... endoplasmic reticulum, and are frequently present in transmembrane proteins . ... Transmembrane Proteins ... Transmembrane ...

Translation

... ... Translate English, Spanish, French, German, Chinese, Japanese and more than 75 ... World leading translation software. Patented single mouse click activation ... Offers translation software, keyboards, and CD-ROM language dictionaries for Spanish, French, Chinese, Russian, and more. ...

Transgenic

... ... Transgenic - Definition of Transgenic at Dictionary.com a free online dictionary ... Tailored transgenic mouse. Knockout/knockin, RNAi mouse models Contact us ... Transgenic Organism, any microorganism, plant, or animal that has been genetically altered to contain a gene from ...

Transcription start site

... characterized the static structures of transcription start site usage within ... and demonstrate that start site selection within many mouse core promoters ... Transcription , start , site ,biological,biology dictionary,biology terminology,biology terms,biology abbreviations ... from ...

TATA box

... the most important transcription factor binding sites. ... In addition to the TATA Box elements, their extension sequences will also be ... mouse protein-coding gene Tbp. Represented by 157 ESTs from 81 cDNA libraries. ... Mus musculus TATA - box binding protein N-terminal domain splice ...

Synaptonemal complex

... complex in the Online Dictionary. Meaning of synaptonemal complex . ... synaptonemal complex . synaptosome. Synarchy. synartesis ... mouse protein-coding gene Sycp3. Represented by 58 ESTs from 25 cDNA libraries. ... Mus musculus synaptonemal complex protein 3, mRNA (cDNA clone ...

Structural gene

... the free encyclopedia. A structural gene is a gene that codes ... gene , the structural unit of inheritance in living organisms. ... mouse protein-coding gene Eif2s3x. Represented by 612 ESTs from 166 cDNA libraries. ... initiation factor 2, subunit 3, structural gene X-linked. M. ...

Spermatogonia

... from Wiktionary, a free dictionary. Jump ... Retrieved from "http://en.wiktionary.org /wiki/ spermatogonia " Category: English plurals ... In mouse testis, isolated A (single) spermatogonia (As) are believed to be the ... The Apr spermatogonia further divide to become chains of 4, 8, 16, or ...

Spermatogenesis

... database release 2009-08-02 ... Online Shopping at DirectTextBook.com - Save up to 80%, buy or rent. New and used books like Molecular Aspects of mouse Spermatogenesis Cytogenetic and ... Given that spermatogenesis relies on, among other things, the normal development ... Diagram of the ...

Simple Sequence Repeat

... primers has gained attention recently ... inheritance of inter- simple sequence repeat polymorphisms ... Comparison of the genomes of mouse and humans, repeat sequences ... There are four times more simple sequence repeats (caused by slippage during DNA ... Home > In the ...

Signal Sequence

... Ssr3. Represented by 164 ESTs from 65 cDNA libraries. ... Rattus norvegicus signal sequence receptor, gamma, mRNA (cDNA clone MGC:72411 ... mouse protein-coding gene Ssr4. Represented by 454 ESTs from 147 cDNA libraries. ... Mus musculus signal sequence receptor, delta, mRNA (cDNA clone ...

Selection

... over successive generations. It is a key ... ... we wish to work is making a selection . ... · Making a Selection - Use the mouse to point at something or to drag open a ... Selection Tools let us do this. ... Natural selection is the phrase Charles Darwin used in 1859 ...

RFLP

... forward 18S rDNA primer and ... Custom D4-labeled primers are ordered from Proligo.com. ... posted to therapeutic rflp recombinant mtdna mouse mitotarget mitochondria ... posted to rflp snp by guhjy on 2008-07-23 17:45:21 as along with 1 person and 2 ... I. Overview of T-RFLP method ...

Recombination nodules

... the site of ... (2) by the recombination nodules , RNs, which correlate with. 1611 ... recombination nodules . EM of late pachytene mouse SCs treated with anti-MLH1 ... ... seen in wild type, which may be precursors of early recombination nodules . ... it is hypomorphic in its ...

Recombinase

... evolved recombinase efficiently excised integrated HIV proviral DNA from ... In particular, Cre recombinase , which has found widespread use in mouse genetics ... Recombinase . Definition(s) ... Definition from: Unified Medical Language System (MeSH) at the ... Lister Hill National Center ...

Recombinant DNA

... DNA technology in the 1970s was hailed as the ... Recombinant DNA and the transgenic technology that it spawned have already ... Move your mouse over each picture to see how recombinant DNA is made using GE. Isolate gene ... This process is called recombinant DNA technology. ... ....

Proto-oncogene

... proto - oncogene locus was shown to translocate from chromosome ... Characterization of the ret proto - oncogene products expressed in mouse L cells. ... The ret proto - oncogene ( proto -ret) encodes a receptor type tyrosine kinase with ... Proto - oncogene definition - ...

Probability

... . ... Maths & Computers for Biologists: Probability . Updated: January 28, 2007 ... Similarly, the probability of selecting a white mouse is now 200 ... These notes grew from an introduction to probability theory taught during ... Probability theory is a fundamental pillar ...
Other Contents
(Date:12/10/2014)... RALEIGH, N.C. , Dec. 9, 2014  Valencell, ... announced it is seeing a staggering demand from its ... demand, the Company revealed, is not solely coming from ... industries as well. "A wearable is only ... a result, accuracy is the ultimate driver in long-term ...
(Date:12/10/2014)... , Dec. 9, 2014 CIE San ... catalyst that provides the connective tissue that enhances care ... them to easily share client-level information; earned a second ... expand to organizations serving seniors aging in community and; ... partner on December 11 th 4-6p. ...
(Date:12/10/2014)... December 9, 2014   ... Platform   Jifflenow, ... scheduling solutions for business-to-business (B2B) events, today announced ... in mobile near-field communication (NFC), Bluetooth low energy ... (Logo: http://photos.prnewswire.com/prnh/20140612/691055) , Jifflenow will integrate ...
Breaking Biology News(10 mins):Wearable Technology Products Demand Highly Accurate Biometric Technology 2Community Information Exchange San Diego Launches Pilot, Secures $1 Million Expansion Grant, and Becomes a "Live Well San Diego" Partner 2Community Information Exchange San Diego Launches Pilot, Secures $1 Million Expansion Grant, and Becomes a "Live Well San Diego" Partner 3Community Information Exchange San Diego Launches Pilot, Secures $1 Million Expansion Grant, and Becomes a "Live Well San Diego" Partner 4Jifflenow And ITN International Bring Cutting-Edge Badge Scanning Technology To B2B Events 2Jifflenow And ITN International Bring Cutting-Edge Badge Scanning Technology To B2B Events 3
(Date:12/25/2014)... (PRWEB) December 26, 2014 The ... CAGR of 7.2% to reach $5,756.0 million by ... the microscopy market. The electron microscopes product segment ... the forecast period. , Rising focus on nanotechnology, ... growth of the microscopy market. , Get Full ...
(Date:12/25/2014)... The click strand woven bamboo flooring ... the business announces a click strand woven bamboo ... 2015. , Click strand woven bamboo flooring replicates ... well-known brand in the bamboo industry. It promises ... bamboo flooring supplier. , “We are happy to ...
(Date:12/25/2014)... 2014 The report “TS-1 (Colorectal Cancer) ... the current treatment landscape, unmet needs, current pipeline and ... an anti-cancer drug which is typically used for treating ... used for treating gastric cancer and pancreatic cancer. TS-1 ... drug was first approved in 1999 in Japan for ...
(Date:12/25/2014)... three months the trends for evening dresses shift ... one of the hottest styles in the next few months.” ... releases 26 A-line sweetheart evening dresses, and announces the availability ... are trying our best to help a lady to show ... affordable prices, we provide discounted delivery costs to our customers ...
(Date:12/25/2014)... Recently, Dylan Queen, a famous online company ... collection of discounted prom dresses, most of which are ... of the company, the promotion is valid until Jan. ... expand the UK market. , The prom dresses in ... and styles: A-line strapless, empire strapless chiffon, one shoulder, ...
Breaking Medicine News(10 mins):Health News:Microscopy Market Hit to $5,756.0 Million by 2019 - New Research Report by MarketsandMarkets 2Health News:Microscopy Market Hit to $5,756.0 Million by 2019 - New Research Report by MarketsandMarkets 3Health News:Microscopy Market Hit to $5,756.0 Million by 2019 - New Research Report by MarketsandMarkets 4Health News:BambooFlooringChina.com: click strand woven bamboo flooring promotion valid until Jan. 30, 2015. 2Health News:TS-1 Colorectal Cancer Market Analysis and Forecast to 2023 Report at RnRMarketReserach.com 2Health News:TS-1 Colorectal Cancer Market Analysis and Forecast to 2023 Report at RnRMarketReserach.com 3Health News:Dylan Queen: Cheap Prom Dresses for the UK Market 2
Other TagsOther Tags