Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

ript vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

Th
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:8/27/2014)... California (PRWEB) August 27, 2014 ... (LLNL), through Lawrence Livermore National Security LLC ... to develop and deliver a state-of-the-art laser system ... facility (ELI Beamlines), under construction in the Czech ... performance, the laser system, called the " High ...
(Date:8/27/2014)... is how plants survive impact by the huge ... while using this energy for photosynthesis. The hypothesis ... blades quickly dissipate the energy throughout the entire ... DTU Physics have now managed to successfully ,film, ... contain light-absorbing proteins which play a role in ...
(Date:8/27/2014)... , Aug. 27, 2014 ... the "Global Lactic Acid  (Biodegradable Polymer, Food ... Trends & Forecasts to 2019" report to ... simplest hydroxyl-carboxylic acid with an asymmetrical carbon atom. ... the biodegradable polymer, food and beverage, personal care ...
(Date:8/27/2014)... “We are honored to be named ... Thangaraj, CEO of Radiant Sage. “We are offering truly ... imaging corelab market to a different level. We ... to efficiently and effectively manage the massive amounts of ... analyzed and read by trained physicians. Being recognized by ...
Breaking Biology Technology:LLNL Synchs up with ELI Beamlines on Timing System 2LLNL Synchs up with ELI Beamlines on Timing System 3DTU researchers film protein quake for the first time 2Global Lactic Acid (Biodegradable Polymer, Food & Beverage, Personal Care & Pharmaceutical) Market - Trends & Forecasts to 2019 2Radiant Sage Named to CIOReview List of 100 Most Promising Technology Companies 2
... , , , , , Scott ... , , , , , ... PCR* technology has been widely used in molecular biology research, providing , ... sequencing, and PCR cloning for gene expression. However, under standard , ...
... , , , The programming example given below shows a , typical Gradient PCR program, and provides ... , , , , ... , , , ... Temperature control for the , block., , ...
... , , , , , , ... The temperature increment, which can be programmed as desired with every , ... a defined value with every cycle. , ... of the PCR by changing , the the annealing temperature in succession ...
Cached Biology Technology:TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR 2TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR 3TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR 4TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR 5TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR 6TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR 7TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR 8TripleMaster PCR SystemThe Ideal Choice for Long-Range PCR 9Title 2
(Date:8/27/2014)... invasive grass species frequently found in forests has created ... on American toads, a new University of Georgia study ... to the U.S. in the early 1900s, is one ... to more than a dozen states in the past ... and in forests, it can survive in widely diverse ...
(Date:8/27/2014)... The IEEE Engineering in Medicine and Biology Society (EMBS) ... (EMBC,14), this year being held at the Sheraton Chicago ... , from Tuesday, August 26 through Saturday, August 30. ... in science, medicine, and engineering are registered to attend. ... This year,s conference theme is Discovering, Innovating, ...
(Date:8/27/2014)... belief that a deficiency in serotonin a chemical ... in depression. In the journal ACS Chemical Neuroscience ... make serotonin in their brains (and thus should have ... symptoms. , Donald Kuhn and colleagues at the ... University School of Medicine note that depression poses a ...
Breaking Biology News(10 mins):More wolf spiders feasting on American toads due to invasive grass, UGA study shows 2More wolf spiders feasting on American toads due to invasive grass, UGA study shows 3Global Leaders In Science, Medicine, And Engineering Gather For The 36th Annual International Conference Of The IEEE Engineering In Medicine And Biology Society, August 26-30 In Chicago 2Global Leaders In Science, Medicine, And Engineering Gather For The 36th Annual International Conference Of The IEEE Engineering In Medicine And Biology Society, August 26-30 In Chicago 3New study throws into question long-held belief about depression 2
... lethal form of brain cancer and the disease that ... efforts, even when attacked simultaneously on several fronts. One ... flexibility, discovered researchers at the Salk Institute for Biological ... glioblastoma cells can shift gears and morph into blood ...
... HOUSTON, Jan. 24, 2011 More than a dozen ... ranging from robot-assisted surgery techniques to improving heart and ... in computational surgery Jan. 26-28. The symposium will be ... Houston. Held at the Methodist Institute ...
... A research effort designed to prevent the introduction of viruses ... helping Chesapeake Bay watermen improve their bottom line by reducing ... market. The findings, published in the journal Diseases of ... virus in diseased and dying crabs likely occurs after the ...
Cached Biology News:Conversion of brain tumor cells into blood vessels thwarts treatment efforts 2Conversion of brain tumor cells into blood vessels thwarts treatment efforts 3Forum to focus on using robotics, imaging and simulation in surgeries 2Forum to focus on using robotics, imaging and simulation in surgeries 3Blue crab research may help Chesapeake Bay watermen improve soft shell harvest 2
The DNA DipStick Kit is ideal for estimating nucleic acid concentrations and approximate yields. Works with ss- and ds-DNA, RNA, and oligonucleotides at concentrations as low as 0.1 ng/l....
Tris-Hepes kit of BG-163 & BG-165 (order number BG-166)...
... Immunogen: Synthetic peptide derived from ... WNT1 protein. Specificity: Reacts with ... Reactivity: Human Mouse (positive controls: ... cell lysates and mouse Mouse-1 cell ...
... The new StrepMAB-Immo coated microplates can ... immobilization of SerAla-Strep-tag II fusion proteins for ... Also small amounts of such proteins are ... (see graphic on the left) and will ...
Biology Products: