Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

ript vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

Th
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:3/27/2015)... 2015 WuXi PharmaTech (Cayman) Inc. (NYSE: ... and technology platform company serving the global pharmaceutical, ... an Investigational New Drug (IND) application for WuXi ... has been accepted for review by the China ... In September 2012, MedImmune, the global biologics research ...
(Date:3/26/2015)... 26, 2015 /PRNewswire/ - SQI Diagnostics Inc. ("SQI" or ... dealing with certain matters, including the appointment of auditors, ... March 26, 2015 (the "Meeting") was adjourned, as previously ... at 11:00 a.m. ( Toronto time). ... from that previous disclosed. The Meeting will reconvene at ...
(Date:3/26/2015)... PAREXEL International Corporation (Nasdaq: ... organization , announced today that the Company ... all of the business assets of privately-owned Quantum ... specialized pharmacovigilance services, based in Chandigarh, India.  ... monitoring, and prevention of adverse effects with ...
(Date:3/25/2015)... is one of the most attractive in the emerging ... a growing economy and increasing government investment in healthcare, ... Russian market is set to grow at twice the ... around 10-15% annually reaching an approximate market value of ... Green Cross provides total healthcare solutions that ...
Breaking Biology Technology:Investigational New Drug Application for WuXi MedImmune's Monoclonal Antibody Accepted for Review by CFDA 2Investigational New Drug Application for WuXi MedImmune's Monoclonal Antibody Accepted for Review by CFDA 3SQI Diagnostics Inc. Announces Adjournment of Meeting 2PAREXEL Announces Execution of Definitive Agreement to Acquire Quantum Solutions India, Strengthening Leadership In Pharmacovigilance Services 2PAREXEL Announces Execution of Definitive Agreement to Acquire Quantum Solutions India, Strengthening Leadership In Pharmacovigilance Services 3PAREXEL Announces Execution of Definitive Agreement to Acquire Quantum Solutions India, Strengthening Leadership In Pharmacovigilance Services 4
... Tandem Labs, a leading contract,research organization ... services to the pharmaceutical,industry, announced that it ... 4000(TM) LC/MS/MS systems for its New England ... facility,s current triple,quadrupole LC/MS/MS capacity, allowing it ...
... Identify Pathways and ... Metabolomic Data, REDWOOD CITY, Calif., Oct. 9 ... to help life science researchers,generate insights from biological ... within Ingenuity,Pathways Analysis to help researchers understand metabolomics ...
... SAN DIEGO, Oct. 8 SGX Pharmaceuticals, Inc.,(Nasdaq: ... on October 11,2007, at 1:00 p.m. Pacific Daylight Time. ... will provide an overview of the,Company,s oncology pipeline. The ... the Palace Hotel in San Francisco. A live ...
Cached Biology Technology:Tandem Labs' New England Facility Doubles Discovery Support Capacity - Increasing Foothold in New England 2Ingenuity Systems Launches New Metabolomics Solution Within IPA 2
(Date:3/23/2015)... Conn. , Mar. 23, 2015 NXT-ID, Inc. (NASDAQ: ... company focused on the growing mobile commerce market, announces its ... new advertising campaign on CNBC television starting March 30 th ... will commence airing in New York ... Officer said: "We are excited about our new ad campaign ...
(Date:3/19/2015)... , March 19, 2015  NXT-ID, Inc. (NASDAQ: ... company focused on the growing mobile commerce market, announces its ... a news clip that aired this week on ... . In a segment "The Next Great Thing", ... ,a new way to pay, and ,a really big breakthrough ...
(Date:3/16/2015)... , March 16, 2015 ... Systems GmbH will present groundbreaking innovations in biometric ... Hanover, Germany .      (Photo: ... latest biometric innovation is well at the forefront: ... generation e-gate made in Germany ...
Breaking Biology News(10 mins):NXT-ID's Wocket Smart Wallet to Launch New CNBC Regional TV Ad Campaign 2NXT-ID's Wocket Smart Wallet to Launch New CNBC Regional TV Ad Campaign 3NXT-ID's Wocket Smart Wallet Featured on Fox News Segment, "The Next Great Thing" 2NXT-ID's Wocket Smart Wallet Featured on Fox News Segment, "The Next Great Thing" 3DERMALOG Presents its Latest Biometric Innovations at the Hannover CeBIT Exhibition, 16 - 20 March 2015 2DERMALOG Presents its Latest Biometric Innovations at the Hannover CeBIT Exhibition, 16 - 20 March 2015 3
... from space for the first time using optical radiance ... Envisat. The ability to monitor Sargassum globally will allow ... ocean and better predict climate change. Credit: ESA ... in its dense floating vegetation, has been detected from ...
... E. Fox, NIH/NRSA postdoctoral fellow at the University of Oregon, ... legumes to recruit soil bacteria needed to provide a natural ... applying pesticides to boost crop yields may instead be contributing ... , According to years of research both in the test ...
... ovarian tissue, blood vessels, even whole organs available when ... directly comparing slow-freezing techniques, used successfully for decades to ... of cryopreservation that transforms tissues into durable glass-like structures. ... Medical College of Georgia are comparing the two approaches ...
Cached Biology News:Envisat captures first image of Sargassum from space 2Pesticides choke pathway for nature to produce nitrogen for crops 2Pesticides choke pathway for nature to produce nitrogen for crops 3Studies to find better ways to preserve human eggs, ovarian tissue under way 2Studies to find better ways to preserve human eggs, ovarian tissue under way 3Studies to find better ways to preserve human eggs, ovarian tissue under way 4Studies to find better ways to preserve human eggs, ovarian tissue under way 5
Dual adapter for phosphotyrosine and 3-phosphotyrosine and 3-phosphoinositide...
Raised to arginine vasopressin coupled to bovine thyroglobulin with carbodiimide ....
Chicken polyclonal to DCTD ( Abpromise for all tested applications). Antigen: Full length protein (Human) Entrez GeneID: 1635 Swiss Protein ID: P32321...
...
Biology Products: