Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

ript vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

Th
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:7/6/2015)... Navitas, a leading Regulatory Service provider, today announced that it ... Bogota, Colombia . Navitas, expansion into Latin ... Colombia , the third largest economy in ... Logo - http://photos.prnewswire.com/prnh/20150703/228239LOGO ... to communicate with Navitas regulatory professionals in close to or the same ...
(Date:7/3/2015)... ... July 03, 2015 , ... The Alexander Group, a 30-year ... industries alike-- typically known for its consummate professionalism-- embarks each year in a ... break from their day jobs. , "Our motto has always been work hard ...
(Date:7/3/2015)... Forskere kan ansøge ... http://www.openinnovationinscience.at om efteruddannelsesprogrammet "Lab for Open ... Wien .  ... og videnskabsmænd foretaget af Ludwig Boltzmann Gesellschaft ... sundhedsvidenskaben manglen på incitamenter til at undersøge ...
(Date:7/2/2015)... Calif. (PRWEB) , ... July 02, 2015 , ... Sleepless ... improve an individual’s quality of sleep, launched its Indiegogo campaign on June 23. Sound ... Luzi's voice command technology makes it effortless to use, while the integration of the ...
Breaking Biology Technology:Navitas Launches Latin American Regulatory Operations Hub in Bogota, Colombia 2Navitas Launches Latin American Regulatory Operations Hub in Bogota, Colombia 3The Alexander Group Declares Their Independence with a Bit of Levity 2Lancering af verdens første åbne innovationsprogram til uddannelse af forskere 2Lancering af verdens første åbne innovationsprogram til uddannelse af forskere 3Luzi Smart Lamp Recently Launched Indiegogo Campaign 2Luzi Smart Lamp Recently Launched Indiegogo Campaign 3
... - Oncothyreon Inc. (Nasdaq: ONTY ) announced ... Officer, will present at the 5th Annual JMP Securities ... 2010, at 10:30 a.m. Eastern Time. A ... be accessible by visiting the Oncothyreon website www.oncothyreon.com ...
... 27 Cellectis bioresearch, the specialist in genome customization ... announce the launch of its e-store, with approximately one ... new functional and intuitive website. Launched in ... of targeted integration kits, which offer a simple, effective ...
... Inspire MD Announce the MASTER (MGUARD for Acute ST Elevation Reperfusion)... -- TCT 2010, WASHINGTON, September 24, ... ... if (typeof(lpUnit)==,undefined,) var lpUnit=,PRN,; --> ... BitlyCB.alertResponse = function(data) { var s = ,; var first_result; // Results are keyed by longUrl, so ...
Cached Biology Technology:Cellectis Bioresearch Announces Availability of Research Kits Through New Online E-Store 2Cellectis Bioresearch Announces Availability of Research Kits Through New Online E-Store 3Inspire MD Announce the MASTER (MGUARD for Acute ST Elevation Reperfusion) Randomized Trial in TCT2010. Study Chairman Will be Dr. Gregg Stone 2Inspire MD Announce the MASTER (MGUARD for Acute ST Elevation Reperfusion) Randomized Trial in TCT2010. Study Chairman Will be Dr. Gregg Stone 3Inspire MD Announce the MASTER (MGUARD for Acute ST Elevation Reperfusion) Randomized Trial in TCT2010. Study Chairman Will be Dr. Gregg Stone 4Inspire MD Announce the MASTER (MGUARD for Acute ST Elevation Reperfusion) Randomized Trial in TCT2010. Study Chairman Will be Dr. Gregg Stone 5Inspire MD Announce the MASTER (MGUARD for Acute ST Elevation Reperfusion) Randomized Trial in TCT2010. Study Chairman Will be Dr. Gregg Stone 6Inspire MD Announce the MASTER (MGUARD for Acute ST Elevation Reperfusion) Randomized Trial in TCT2010. Study Chairman Will be Dr. Gregg Stone 7
(Date:7/2/2015)... 25, 2015 Research and ... "Next Generation Biometrics Market by Application, Technology, Function ... to their offering. The next generation biometrics ... at a CAGR of 17.9% between 2015 and 2020 ... for the market. Safran SA ( ...
(Date:6/29/2015)... 2015 Research and Markets( ... "Latin America Biomedical Sensors Market - Growth, Trends & ... The Latin America Biomedical Sensors market is estimated at ... over the period 2014-2020 The near future ... genetic formulation of each individual. These sensors can be ...
(Date:6/25/2015)... N.J. , June 25, 2015  TAKE Solutions ... a patent by the United States Patent and Trademark ... Standardization". This process leverages TAKE Solutions, Clinical Accelerators to ... over 50% (when compared to standardization without the accelerators), ... At the heart of ...
Breaking Biology News(10 mins):Next Generation Biometrics Market 2015 - Global Forecast to 2020 with Safran, NEC, 3M Cogent, Fujitsu & Suprema Dominating the $24 Billion Market 2Next Generation Biometrics Market 2015 - Global Forecast to 2020 with Safran, NEC, 3M Cogent, Fujitsu & Suprema Dominating the $24 Billion Market 3Latin America Biomedical Sensors Market Report 2015-2020 2TAKE Solutions Awarded Patent By USPTO 2
... new and environmentally friendly process for producing biodiesel fuel ... pounds of poultry industry waste that accumulate annually in ... the July 22 issue of ACS, Journal of ... In the study Mano Misra, Susanta Mohapatra, Narasimharao Kondamudi, ...
... Applying biological molecules from cell membranes to the ... the very basics of cell-to-cell interaction. Two ... biophysicist and colleagues suggest that putting lipids and ... lead to new classes of self-assembling materials for ...
... defective mitochondrial protein called MCLK1 produce elevated amounts of ... according to a study in this week,s JBC these ... longer than normal mice. Mitochondrial oxidative stress is ... reactive oxygen species produced by mitochondria while they make ...
Cached Biology News:New windows opened on cell-to-cell interactions 2New windows opened on cell-to-cell interactions 3
...
Normal Hamster Serum...
... The P5T Series Short Stroke Thrust ... stroke applications where mounting envelopes are limited ... wear bands and internal bumpers provide millions ... applications., Choice of composite bushings or ...
Alkaline Phosphatase (E. coli C75), 100 units. Removes 5'-phosphates from DNA. Category: Nucleotides & Enzymes & Biochemicals, Modifying Enzymes, Alkaline Phosphatases....
Biology Products: