( ript vector following treatment with P...)pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

ript vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.^2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,⁷ a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide^3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit⁸ to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

Th
'"/>

Source:

Page: All 1 2 3 4
Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes