Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

ript vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

Th
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:7/11/2014)... BCC Research ( http://www.bccresearch.com ) reveals in its ... TECHNOLOGY: GLOBAL MARKETS , the global market for digital ... in 2013. This is estimated to grow to $490 ... rate (CAGR) of 28.6%. , New digital PCR technology ... within the broader PCR field. The opportunities presented by ...
(Date:7/11/2014)... , July 11, 2014  Researchers have ... three-dimensional images. The new technology, called Virtual Finger, ... small structures like neurons and synapses using the ... unique technology makes 3D imaging studies orders of ... at an unprecedented level across many areas of ...
(Date:7/10/2014)... 2014 Product and process impurities ... abundance and are often “lost in the noise,” ... Join presenters Dr. Rowel Tobias, Senior Scientist, Protein ... Head of Quality at Nanotherapeutics, Inc., to lear ... speed detection and quantitation while achieving the required ...
(Date:7/10/2014)... Mass. (PRWEB) July 10, 2014 Terascala, ... today announced that Alan Swahn, a former vice president ... executive team as vice president of marketing. Terascala’s software ... Dell and NetApp create the highest performance and most ... been appointed to guide Terascala’s channel expansion and broaden ...
Breaking Biology Technology:Global Market for Digital Polymerase Chain Reaction Technology to Reach $490 Billion by 2018; Equipment Sector Accounts for the Fastest Growing Segment With 33% CAGR 2Global Market for Digital Polymerase Chain Reaction Technology to Reach $490 Billion by 2018; Equipment Sector Accounts for the Fastest Growing Segment With 33% CAGR 3Virtual Finger Enables Scientists To Navigate And Analyze 3D Images Of Complex Biological Structures 2Virtual Finger Enables Scientists To Navigate And Analyze 3D Images Of Complex Biological Structures 3Novel Ms Techniques Speed Detection of Biopharmaceutical Product and Process Impurities, New Webinar Hosted by Xtalks 2Terascala Expands Executive Team 2Terascala Expands Executive Team 3
... Research Council (BBSRC) have taken a step towards producing ... livestock - after successfully assembling the virus outside a ... the journal Proceedings of the National Academy of ... develop vaccines with useful new properties. Professor Polly ...
... are closer to reality with the creation of graphene-based ... Rice chemist James Tour lab has created thin films ... lighting. The research was reported in the online edition ... screens may be the "killer app" that finally puts ...
... DIEGO, Aug. 1, 2011 Optimer Pharmaceuticals, Inc. (Nasdaq: ... will present at the Canaccord Genuity Annual Growth Conference ... at the InterContinental Hotel in Boston. (Logo: ... of this presentation will be accessible in the Investors ...
Cached Biology Technology:Scientists take a step towards developing better vaccines for bluetongue 2Scientists take a step towards developing better vaccines for bluetongue 3Dream screens from graphene 2Dream screens from graphene 3
(Date:7/11/2014)... There is evidence that under the normal ... and development, maintain neuronal environment, and exhibit ... and neurodegenerative disease. Previous studies have found ... cells after chemical induction have reduced viability, ... application. Prof. Xiaodong Yuan, Kailuan General Hospital, ...
(Date:7/11/2014)... to study the proteins that let nerve cells send ... stumbled upon a biological tactic that may offer a ... a safe and environmentally responsible way. , Their ... one species and harmless for a closely related onesuggests ... without harming beneficial species like bees. A summary of ...
(Date:7/10/2014)... Colo. , June 27, 2014  The ... the National Institute of Standards and Technology (NIST) ... of its academic research and forensic science expert ... The Board is an element of the NIST,s ... members are among the first appointments made to ...
Breaking Biology News(10 mins):Potent spider toxin 'electrocutes' German, not American, cockroaches 2Potent spider toxin 'electrocutes' German, not American, cockroaches 3Ten Members of the American Academy of Forensic Sciences Appointed to Forensic Science Standards Board (FSSB) 2Ten Members of the American Academy of Forensic Sciences Appointed to Forensic Science Standards Board (FSSB) 3
... in the field of protein crystallography and a Nobel laureate, was ... His life story, wonderfully told by Georgina Ferry, was recently ... not just a scientist, wrote Dr. Richard E. Dickerson of UCLA ... [H]e was a fine human being with strong family ties ...
... an international symposium in Carolina, Puerto Rico, in conjunction ... Planning on April 29-May 2 so natural resource managers ... of suppressing wildland fires. The Symposium on Fire Economics, ... include economists, policy analysts and fire managers from more ...
... KAN. -- Anyone who has seen Kansas prairies in late ... sunflowers decorating fields and lining roadways, giving Kansas the well ... sunflower is more than just a pretty flower. To scientists, ... Biology at Kansas State University, it is a prime example ...
Cached Biology News:International symposium explores fire suppression economics 2Kansas state flower receives scientific attention 2
Rabbit anti-T-box 6...
...
... The PowerEase 500 Power Supply ... electrophoresis. It offers extensive programming ... four custom methods for you ... preferences. The simple intuitive PowerEase ...
... The Z-Competent E. coli Transformation Buffer ... of competent E. coli cells for simple ... method completely eliminates the requirement for heat ... transformation can be performed by adding DNA ...
Biology Products: