Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

ript vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

Th
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:7/30/2014)... Vycom announces the addition of Thermax ... meet Factory Mutual (FM) 4910 fire propagation and smoke ... benches, process tools, fume hoods, furniture and cabinetry. These ... semiconductor wafers used in electronic chip manufacturing. , ... with excellent workability and superior aesthetics. It is available ...
(Date:7/30/2014)... , July 30, 2014 Researchers often ... interrogate biology, but such devices can do much ... As such, researchers have looked to patterned ... vitro metabolic engineering to characterize – and ... New devices are envisioned to recreate animal and ...
(Date:7/30/2014)... NCERC at Southern Illinois University Edwardsville ... on corn stover pretreatment methods at a U.S. ... D.C. , “Arun’s selection for presentation at ... to the success of our postdoctoral fellowship program,” ... foresight and vision of SIUE and the Illinois ...
(Date:7/30/2014)... Immunology Summit-2014 will ... Investigators, scientists in the field, which includes prominent ... Case Western Reserve University School of Medicine, USA, ... “The effects of recombinant human IL-6 and ... Arya Biragyn, a Senior investigator at National Institute ...
Breaking Biology Technology:Vycom Announces Flametec® Thermax PVC (FM4910 Listed) For a Variety of Clean Room Applications with Excellent Workability and Aesthetics 2UMD Researchers Bridge Gap between Microelectronics, Biological Systems 2UMD Researchers Bridge Gap between Microelectronics, Biological Systems 3UMD Researchers Bridge Gap between Microelectronics, Biological Systems 4NCERC at SIUE Researcher Takes Stage at Department of Energy Conference 2NCERC at SIUE Researcher Takes Stage at Department of Energy Conference 3Unveiling Breakthroughs in Clinical & Cellular Immunology 2Unveiling Breakthroughs in Clinical & Cellular Immunology 3
... FRANCISCO, Calif., Jan. 4 Cerimon,Pharmaceuticals, Inc. announced ... Counsel, a newly established position, and Vice President ... global life sciences,executive and corporate attorney with broad ... in the US and,Europe. In the business development ...
... efficacy in treatment of multi-drug ... resistant infections -, ... "Company"), a biopharmaceutical company focused on the,development of novel antibiotics for ... patients in two,separate Phase 2 clinical trials. The studies will evaluate ...
... and biotechnology ... expertise, BOSTON, Jan. 3 Observant LLC has ... for research excellence,and a commitment to client service. John ... firm as Vice President. Dr. Hartman,s,research has focused on ...
Cached Biology Technology:Cerimon Pharmaceuticals Names Matthew J. Meyer its General Counsel and Vice President of Business Development and Licensing 2Rib-X Pharmaceuticals Initiates Two Phase 2 Studies for Novel Antibiotic Compound RX-1741 2Rib-X Pharmaceuticals Initiates Two Phase 2 Studies for Novel Antibiotic Compound RX-1741 3Observant LLC Expands Senior Management Team 2
(Date:7/30/2014)... July 30, 2014 NexID Biometrics ... liveness detection solutions for the biometric authentication industry, ... consortium revolutionizing online authentication with standards for strong ... , "The decision to join FIDO Alliance stems ... pervasive in use. We believe the FIDO Alliance ...
(Date:7/30/2014)... Scientists are searching through a massive collection of 20-million-year-old ... years ago, and the effort is yielding fresh insights ... , When the collection is fully curated, a task ... largest unbiased Dominican amber collection in the world, the ... thus far is that of a pygmy locust, a ...
(Date:7/30/2014)... in cancer treatment has been shown to relieve ... for neural transmission between the peripheral and central ... Institute of Radiation Medicine, Chinese Academy of Medical ... into rat dorsal root ganglia (DRG) to provide ... radioactivity (0, 14.8, 29.6 MBq) were implanted separately ...
Breaking Biology News(10 mins):NexID Biometrics Joins the FIDO Alliance 2Decades-old amber collection offers new views of a lost world 2
... 21 February 2011 Elsevier, a world-leading publisher ... services, and TAIR - The Arabidopsis Information Resource, ... elements of scientific research. All articles on Elsevier,s ... genes and use AGI codes (e.g. AT4G32520) will ...
... Researchers at Albert Einstein College of Medicine ... to protect against an increasingly common and particularly deadly form ... tested in an animal model, are reported in a paper ... Pneumococcal pneumonia can occur when the lungs are ...
... heart diseases affect approximately one in 100 patients, making ... number-one cause of pediatric deaths. Now a new ... cardiac muscle damage in a mouse model of the congenital ... treatment for this rare condition, but also demonstrates the importance ...
Cached Biology News:Vaccine made with synthetic gene protects against deadly pneumonia 2Vaccine made with synthetic gene protects against deadly pneumonia 3Study shows rapamycin reverses myocardial defects in mouse model of LEOPARD syndrome 2Study shows rapamycin reverses myocardial defects in mouse model of LEOPARD syndrome 3
... Ion Channel Cell Lines ,High Quality, Functionally-Validated, ... are well known for having a critical ... consequently have a key function in pain, ... ion channels have been investigated in therapeutic ...
... from frozen embedded tissue blocks, which are ... ensure the highest quality. Tissues of each ... sectioned at a thickness of 7 microns ... large (3-5 mm in diameter) in comparison ...
... Ideal for hand-held applications or for use ... with a hand-held eight-port disposable manifold provides ... a multi-channel pipette. The StatMatic II can ... sizes and can completely fill a microplate ...
... Zyagen tissue microarrays are derived from Paraffin ... rigorous quality control procedures to ensure the ... manually assembled in one block, sectioned at ... on coated slides. Sections are large (3-5 ...
Biology Products: