Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

ript vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

Th
'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:12/24/2014)... , Dec. 24, 2014   BioLife Solutions ... developer, manufacturer and marketer of proprietary clinical grade ... and precision thermal shipping products for cells ... it will hold its 2015 Annual Meeting of Stockholders ... Because the expected date for the Annual Meeting represents ...
(Date:12/24/2014)... MA (PRWEB) December 23, 2014 ... webinar series is designed to introduce cutting ... inform users and partners of platform upgrades. ... and benefits; empowering users in their quest ... powerful tools. , According to SoundConnect’s Marketing ...
(Date:12/24/2014)... Nashville Fertility Center announced that ... the American Society for Reproductive Medicine (ASRM), a leading ... reproductive medicine. In his new role as treasurer, ... board and will have a voice in furthering the ... supported ASRM since 1984 when he joined while conducting ...
(Date:12/24/2014)... AUSTIN, Texas , Dec. 23, 2014 /PRNewswire/ ... solutions company focused on gynecologic disease, announced today ... W. Schuler , Birchview Fund LLC and several ... million of unregistered shares of Vermillion,s common stock ... common stock in a private placement.  ...
Breaking Biology Technology:BioLife Solutions Sets Date for Annual Meeting of Stockholders 2SoundConnect Launches Leading Edge Business Communications Webinar Series 2SoundConnect Launches Leading Edge Business Communications Webinar Series 3Nashville Fertility Center Announces Dr. George A. Hill Selected to Serve as ASRM Treasurer for 2014-15 2Nashville Fertility Center Announces Dr. George A. Hill Selected to Serve as ASRM Treasurer for 2014-15 3Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 2Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 3Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 4Vermillion Announces Equity Financing of up to $18.9 Million; Suspends ATM Program 5
... the nanoworld. In possession of alluring properties, they are ... On the plus side, they can withstand incredibly high ... Yap, an associate professor of physics at Michigan Technological ... barbecue at half of those temperatures," he says. And ...
... LAUDERDALE, Fla. , Jan. 15 InfoSpi (OTC Bulletin ... further investment for the company,s growth in the coming years. , ... Chris Hamilton views this decision. "Funding change is the ... Carbon Emissions feature so highly on the agenda of every Government, ...
... , , ANTONY, France, January 14 , - Strong Sales Growth in Q4: Up 15%, Million EUR ... MEUR %Sales Var.% ... 14 42.4 74 16, Other EU countries (2) 11.3 ... 2.0 4 45 1.5 ...
Cached Biology Technology:Harnessing the divas of the nanoworld 2InfoSpi to Create $500m Green Hedge Fund Focusing on the Carbon Credit Market 2STALLERGENES : Sales Guidance Exceeded : EUR193 Million, up 13% 2STALLERGENES : Sales Guidance Exceeded : EUR193 Million, up 13% 3
(Date:12/22/2014)... Research and Markets ( ... the "The Global Watermarking and Fingerprinting ... http://photos.prnewswire.com/prnh/20130307/600769 ... the global digital media watermarking and fingerprinting ... piracy by securely and invisibly embedding identifiable ...
(Date:12/19/2014)... Dec. 18, 2014   LaunchKey , the first ... post-password and Internet of Things era, today announced the ... venture round was led by Metamorphic Ventures with participation ... Partners, VegasTechFund, and others.  LaunchKey has raised $4 million ... expand its team and bring LaunchKey to market in ...
(Date:12/17/2014)... , Dec. 16, 2014 Research and ... the addition of the "Global Chemical Sensor ... http://photos.prnewswire.com/prnh/20130307/600769 ... the increasing demand for medical sensors in biomedical ... data for quick and correct diagnosis during surgical ...
Breaking Biology News(10 mins):The Global Watermarking and Fingerprinting Markets 2LaunchKey Raises $3 Million in Additional Funding Led by Metamorphic Ventures 2LaunchKey Raises $3 Million in Additional Funding Led by Metamorphic Ventures 3Global Chemical Sensor Market 2015-2019: Key Vendors are Abbott Laboratories, Bayer, Hoffmann La-Roche, Johnson & Johnson, NGK Spark Plugs and Robert Bosch 2
... A group of scientists at the Instituto Gulbenkian de Cincia, ... skeleton and organ size. The team, led by Florence Janody, ... the proteins that regulates the skeleton of the cell also ... and proliferation. Their findings have implications for cancer research, as ...
... University of Missouri study shows that the exposure to the ... by previous lab tests. In the study, researchers compared BPA ... with BPA throughout the day, compared to the more common ... and accumulation of BPA in the blood of mice. ...
... 5, 2011 Moisture and heat fluctuations from the ... between surface hydrology and atmospheric processes, especially those relevant ... moisture has had a positive impact on precipitation, there ... team of researchers from Columbia Engineering, Geophysical Fluid Dynamics ...
Cached Biology News:Scientists uncover role for cell scaffold in tumor formation 2Exposure to BPA has been underestimated, new MU research says 2Columbia Engineering team makes major step in improving forecasts of weather extremes 2
... derived from Paraffin embedded tissue blocks, which ... to ensure the highest quality. Tissues of ... block, sectioned at a thickness of 5 ... are large (3-5mm in diameter) in comparison ...
... Precision-designed for Optimal Microdissection , CapSure ... the precise and rapid extraction of populations ... cytology samples with Laser Capture Microdissection., ... Downstream Molecular Analysis , All CapSure LCM ...
... The new MyiQ real-time PCR detection ... detection of common green fluorescent dyes such ... system interfaces directly with the iCycler thermal ... gradient and Peltier-effect driven performance. The MyiQ ...
... are highly sensitive laser confocal systems designed ... advanced scanners that meet your expectations, differentiating ... and optimizing the signal on the bottom ... the range for increased sensitivity. Results with ...
Biology Products: