Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

ript vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.



Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:8/28/2015)... , Aug. 28, 2015 /PRNewswire/ - RepliCel Life ... regenerative medicine company focused on the development of ... the quarter ended June 30, 2015, corporate highlights, ... management report are available at ,  ... "RepliCel expects to launch its ...
(Date:8/28/2015)... ... August 28, 2015 , ... ... orthopedic surgeon, Wade McKenna, DO, announced today that the use of sterile, dehydrated ... in complete healing of an otherwise non-healing surgical knee wound. , The case ...
(Date:8/28/2015)... ... ... Since the initial launch of FireflySci Inc. (FFS) in early 2015, the company continues to ... such as the Fonz in a lab coat and Large Marge have been posted on ... , FireflySci is proud to be the only cuvette manufacturer is the world ...
(Date:8/27/2015)... ... August 27, 2015 , ... The Kansas City Animal ... and animal health companies to hear from animal health companies with the newest ... received licensing agreements or distribution contracts. This meeting is one of the ...
Breaking Biology Technology:RepliCel Reports Second Quarter 2015 Financial Results 2RepliCel Reports Second Quarter 2015 Financial Results 3RepliCel Reports Second Quarter 2015 Financial Results 4RepliCel Reports Second Quarter 2015 Financial Results 5Dallas-Fort Worth Stem Cell Researchers Use Amniotic Tissue To Successfully Treat Non-Healing Surgical Wound 2Dallas-Fort Worth Stem Cell Researchers Use Amniotic Tissue To Successfully Treat Non-Healing Surgical Wound 3Dallas-Fort Worth Stem Cell Researchers Use Amniotic Tissue To Successfully Treat Non-Healing Surgical Wound 4Cuvette Manufacturer FireflySci Launches Back to School Deals with Complimentary Shipping On All Orders 2VetStem Biopharma, Inc. Among Seventeen Companies Selected to Present at the KC Animal Health Investment Forum on September 1st 2015 2VetStem Biopharma, Inc. Among Seventeen Companies Selected to Present at the KC Animal Health Investment Forum on September 1st 2015 3
... Longer-term Phase 2 Switching Study, CRANBURY, ... company developing small-molecule, orally administered,pharmacological chaperones for ... that the Company will present positive results ... (isofagomine tartrate) for Gaucher disease,at the American ...
... on the strangeness of the nanoworld, researchers at the ... University of Maryland-College Park have discovered that materials such ... behave as ductile as gold at the nanoscale. Their ... NIST scientists Pradeep Namboodiri and Doo-In Kim and colleagues ...
... Calif., March 12 ,Exelixis, Inc. (Nasdaq: EXEL ) ... executive officer of Exelixis, will present at the,Cowen and ... / 1:00 p.m.,PT on Monday, March 17, 2008. Dr. ... corporate strategy., The presentation will be webcast and ...
Cached Biology Technology:Amicus Therapeutics Presents Positive Data from Phase 2 Clinical Trial of Plicera(TM) for Gaucher Disease 2Amicus Therapeutics Presents Positive Data from Phase 2 Clinical Trial of Plicera(TM) for Gaucher Disease 3Amicus Therapeutics Presents Positive Data from Phase 2 Clinical Trial of Plicera(TM) for Gaucher Disease 4Nanomaterials show unexpected strength under stress 2
(Date:8/26/2015)... 26, 2015 The report "Multi-Factor Authentication ... Factor), Application (Travel & Immigration, Government, Banking, Defense, Commercial ... to 2020", published by MarketsandMarkets, Multi-Factor Authentication Market is ... at a CAGR of 17.7% between 2015 and 2020. ... igures spread through 169 P ...
(Date:8/25/2015)... and BELLEVUE, Wash. , ... in advanced robotic systems, announced today it will unveil ... ground vehicle (UGV), at the National Tactical Officers Association ... The Guardian S is the first-ever commercially ... of years of research and in-field trials and is ...
(Date:8/24/2015)... CAPE TOWN, South Africa , August 24, 2015 /PRNewswire/ ... awarded Germany ,s largest biometrics manufacturer DERMALOG ... with the "2015 African Biometrics Company of the ... installation in Nigeria .   ... ) and - On Thursday ...
Breaking Biology News(10 mins):Multi-Factor Authentication Market Worth 9.60 Billion USD by 2020 2Multi-Factor Authentication Market Worth 9.60 Billion USD by 2020 3Multi-Factor Authentication Market Worth 9.60 Billion USD by 2020 4Multi-Factor Authentication Market Worth 9.60 Billion USD by 2020 5Sarcos to Debut First-of-its-Kind Snake Robot 2Sarcos to Debut First-of-its-Kind Snake Robot 3Frost & Sullivan Honors DERMALOG with Biometrics Prize for Achievements in Africa 2Frost & Sullivan Honors DERMALOG with Biometrics Prize for Achievements in Africa 3
... been selected as a 2010-2014 Harold Amos Medical Faculty Development ... is a national program of the Robert Wood Johnson Foundation. ... University of North Carolina at Chapel Hill School of Medicine, ... receive the award. Harold Amos scholars are selected based on ...
... April 7, 2010 Add insect-feeding birds, bats and ... global climate change. Summarizing the results of more ... ecologist Kailen A. Mooney and colleagues found that these ... of plant-feeding insects and the damage they do to ...
... have been discovered that live their entire lives without ... the open access journal BMC Biology report ... group Loricifera), showing that they are alive, metabolically active, ... of oxygen. Roberto Danovaro, from the Polytechnic University ...
Cached Biology News:First animals to live without oxygen discovered 2
... microarrays are derived from frozen embedded tissue ... control procedures to ensure the highest quality. ... in one block, sectioned at a thickness ... slides. Sections are large (3-5 mm in ...
... tissue microarrays are derived from frozen embedded ... quality control procedures to ensure the highest ... assembled in one block, sectioned at a ... slides. Sections are large (3-5mm in diameter) ...
... Zyagen tissue microarrays are derived from Paraffin ... rigorous quality control procedures to ensure the ... manually assembled in one block, sectioned at ... on coated slides. Sections are large (3-5mm ...
... , CapSure HS and CapSure Macro LCM ... of populations of pure cells from tissue ... Microdissection., Ensure the Integrity of Microdissected ... CapSure LCM Caps have a patented transfer ...
Biology Products: