Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning


Produce PCR amplicons that are easily cloned with high efficiency

pfuturbo DNA Polymerase:
A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

Jeff Braman Holly Hogrefe
Stratagene

A chloramphenicol resistance (CAM) gene generated from pfuturbo DNA polymerase *, was cloned into the PCR-Script vector with greater than 85% efficiency. PfuTurbo DNA polymerase not only creates high-fidelity products, it also generates blunt-end PCR products, which eliminates the need for polishing. PfuTurbo DNA polymerase enhances PCR product yield without altering the fidelity of DNA replication, making it the enzyme of choice for reliable PCR product amplification and subsequent cloning.

Stratagene recently introduced PfuTurbo DNA polymerase,1 a special formulation of cloned Pfu DNA polymerase and a novel thermostable factor** that enhances PCR product yield without altering the fidelity of DNA replication. PfuTurbo DNA polymerase can be used to amplify complex genomic DNA targets up to 10 kb in length and vector targets up to 15 kb in length. It also amplifies complex targets in higher yield than Taq DNA polymerase or other commercially available proofreading PCR enzymes. Because Pfu DNA polymerase is known to generate blunt-end amplicons that can be easily cloned using the PCR Script cloning kit2 we assumed PfuTurbo DNA polymerase would also possess this characteristic.

Cloning blunt-end amplicons generated with enzymes such as PfuTurbo DNA polymerase is significantly more convenient than cloning amplicons produced with Taq DNA polymerase. Taq DNA polymerase creates amplicons with 3 overhangs.3,4 These molecules are cloned with low efficiency using the TA Cloning vector,2 or with high efficiency using the blunt-end PCR-Script vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

The amplicon generated by PfuTurbo DNA polymerase was also purified using the StrataPrep PCR kit method prior to the ligation reaction. The CAM amplicons were ligated to the PCR-Script vector, and the products were transformed into Epicurian Coli XL1-Blue MRF Kan supercompetent cells according to instructions in the PCR-Script Amp SK(+) cloning kit manual. The transformation mixtures were plated on LB ampicillin (50 g/ml) plates containing 0.5mM IPTG and 40 g/ml X-gal. Following overnight incubation at 37C, recombinant (white) and nonrecombinant (blue) colonies were counted. White colonies containing the putative insert were replica plated onto LB plates containing chloramphenicol (35 g/ml) to determine the percentage of CAM-resistant positives.

Figure 1

The mean percentage of recombinant clones per plate (white colony number divided by blue colony number multiplied by 100) and the mean percentage of white colonies that were also CAM-resistant are presented in Figure 1: PfuTurbo DNA polymerase produced CAM amplicons cloned with high efficiency (85%). Amplicons generated from Taq DNA polymerase were also cloned with greater than 85% efficiency, if the amplicons were polished prior to ligation to the PCR Script vector. The cloning efficiency of Taq-generated product was less than 10% in these experiments if no polishing reaction was performed (data not shown).

Conclusions

PfuTurbo DNA polymerase is a high-performance, high-fidelity enzyme formulation ideal for generating blunt-end PCR amplicons that are easily cloned with high efficiency using the PCR-Script cloning kit. Amplicons generated with Taq DNA polymerase not only require polishing prior to ligation to the PCR Script vector but also possess six-fold greater errors. When compared to Pfu DNA polymerase, PfuTurbo DNA polymerase allows the use of shorter extension times, fewer PCR cycles, and lower concentrations of DNA template.1 PfuTurbo DNA polymerase couples enhanced PCR performance and product yield with high-fidelity while eliminating the need for polishing, making it the enzyme of choice for fast, reliable, and accurate PCR cloning.

REFERENCES
  1. Hogrefe, et al. (1997) Strategies 10: 93-96.

  2. Sanchez, T., Zheng, C.-F., and Bauer, J. (1996) Strategies 9: 44-46.

  3. Clark, J.M. (1988) Nuc. Acids Res. 16: 9677-9686.

  4. Hu, G. (1993) DNA and Cell Biol. 12: 763-770.

  5. Costa, G. and Weiner, M.P. (1994) Strategies 7: 47-48.

  6. Pearson, S. and Bauer, J.C. (1996) Strategies 9: 26-27.

  7. Cline, J., Braman, J.C., and Hogrefe, H.H. (1996) Nuc. Acids Res. 24: 3546-3551.

  8. Braman, J. and Basehore, S. (1997) Strategies 10 (2): 84-86.

* U.S. Patent No. 5,545,552 and patents pending.
** Patents pending.


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:7/29/2014)... 2014 G-CON Manufacturing Inc., the standard ... announced a new leadership appointment designed to drive the ... abroad. , Maik Jornitz, Chief Operating Officer of ... charged with leading the pioneering company through its next ... stage of development and look forward to providing our ...
(Date:7/29/2014)... Wendel – recipient of a Regional Top Doctor Award for ... Surgeon Specialists for Nashville, TN – has released a new ... Hydration Booster, Retexturing Night Crème, and Anti-aging C Complex, all ... radiant appearance while protecting them from the sun’s harmful UV ... Dr. J. J. Wendel Plastic Surgery, we have developed a ...
(Date:7/28/2014)... building materials using light, developed by researchers at the ... are often considered the realm of science fiction, such ... cloaked starships won,t be a reality for quite some ... materials with building blocks a few billionths of a ... that light flies through them, and works on large ...
(Date:7/28/2014)... According to a new market research report ... and Joint) Market (By Technology - Stem Cell ... Bone Graft Substitutes, Osteoarticular Diseases, Allogeneic Products, Autogenic ... Share, Growth, Trends and Forecast, 2013 - 2019" ... was valued at USD 2.6 billion in 2012 ...
Breaking Biology Technology:G-CON Manufacturing, Inc. Announces Maik Jornitz as President 2Dr. J. J. Wendel Launches New Line of Skin Care Products 2Building 'invisible' materials with light 2Regenerative Medicine Market: Global Industry Analysis, Size, Share, Growth, Trends and Forecast 2013 - 2019 2Regenerative Medicine Market: Global Industry Analysis, Size, Share, Growth, Trends and Forecast 2013 - 2019 3Regenerative Medicine Market: Global Industry Analysis, Size, Share, Growth, Trends and Forecast 2013 - 2019 4
... , BOTHELL, WA and VANCOUVER, BC, Dec. 20 /PRNewswire-FirstCall/ ... that the Company will host a conference call at 8:30 ... live webcast will be available through the Investor Relations page ... you may access the live conference call by dialing 888-747-4649 ...
... , , KNOXVILLE and ... Knoxville-Oak Ridge Innovation Valley ( www.knoxvilleoakridge.com ) see the successful test ... flight. , The Innovation Valley is home to Oak Ridge National ... itself at the forefront of applied carbon fiber research. ...
... , , NEW ... AOB ), ("the Company" or "AOBO"), a ... and,commercialization of a broad range of prescription and over ... Company,s drugs have been included,in China,s National (Medical) Insurance ...
Cached Biology Technology:OncoGenex Pharmaceuticals to Host Investor Conference Call at 8:30 a.m. ET, December 21, 2009 2Boeing Flight Boosts Carbon Fiber Hopes, Knoxville-Oak Ridge Innovation Valley Poised 2Boeing Flight Boosts Carbon Fiber Hopes, Knoxville-Oak Ridge Innovation Valley Poised 3American Oriental Bioengineering Announces the Inclusion of 158 Drugs in China's National Insurance Catalog 2American Oriental Bioengineering Announces the Inclusion of 158 Drugs in China's National Insurance Catalog 3
(Date:7/28/2014)... cure for Alzheimer,s disease and other forms of dementia, ... finding treatment. , University of Washington bioengineers have a ... changes of the body,s normal proteins into a state ... heart disease, Type 2 diabetes and Lou Gehrig,s disease. ... from their normal state into an abnormally folded form ...
(Date:7/28/2014)... New research has identified areas of the Earth that ... climate change. , Europe is particularly vulnerable, as it ... four per cent, of any continent in ,refugia, ... natural environmental conditions remain relatively constant during times of ... Europe are mostly in Scandinavia and Scotland. , ...
(Date:7/28/2014)... Jude Children,s Research Hospital study found that 73 percent ... their risk of developing metabolic syndrome and related health ... results appear in the current issue of the journal ... 1,598 adult survivors of childhood cancer in the study ... factors like high blood pressure, abdominal obesity, elevated triglyceride ...
Breaking Biology News(10 mins):New protein structure could help treat Alzheimer's, related diseases 2New protein structure could help treat Alzheimer's, related diseases 3Study finds Europe's habitat and wildlife is vulnerable to climate change 2Unhealthy habits more than double risk of metabolic syndrome in childhood cancer survivors 2Unhealthy habits more than double risk of metabolic syndrome in childhood cancer survivors 3
... the world's first phase 3 HIV vaccine efficacy trial are ... Infectious Diseases, now available online. Although the vaccine was ineffective ... the fight against HIV and offers the scientific community a ... trial, conducted in the United States and the Netherlands and ...
... a promising new target in their fight against a ... who receive medical implants such as catheters, artificial joints ... surface of Staphylococcus epidermidis has, for the first time, ... human defense mechanisms that would otherwise kill the bacteria, ...
... prospect of using nanoparticles in biomedical applications and consumer ... the miniscule materials. Scientists at the University of Michigan ... of nanoparticles damage cell membranes---enough to cause cell death ... , "If you're inventing these sorts of materials, you ...
Cached Biology News:HIV vaccine trial breaks ground for future research 2Substance protects resilient staph bacteria 2Probing the promise and perils of nanoparticles 2
... 'SoftLinx software, a multitasking application capable of ... programming and operation of lab automation workcells ... for custom modification by programmers. • ... simple drag-anddrop flowchart. If you can build ...
... Caliper software products bring you ease of use and rapid solutions to meet your laboratory's ... ... ... CLARA® is the standard software ...
... digital microscope and camera system that does ... adjustment or software installation. Built on Nikon's ... simplicity and advanced technology for users of ... of a macro image and a micro ...
... The Fujifilm Life Science LAS-3000 imaging ... with a simplified user interface, providing ... wide range of modularities. The LAS-3000 ... a wide range of applications including: ...
Biology Products: