Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning


Produce PCR amplicons that are easily cloned with high efficiency

pfuturbo DNA Polymerase:
A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

Jeff Braman Holly Hogrefe
Stratagene

A chloramphenicol resistance (CAM) gene generated from pfuturbo DNA polymerase *, was cloned into the PCR-Script vector with greater than 85% efficiency. PfuTurbo DNA polymerase not only creates high-fidelity products, it also generates blunt-end PCR products, which eliminates the need for polishing. PfuTurbo DNA polymerase enhances PCR product yield without altering the fidelity of DNA replication, making it the enzyme of choice for reliable PCR product amplification and subsequent cloning.

Stratagene recently introduced PfuTurbo DNA polymerase,1 a special formulation of cloned Pfu DNA polymerase and a novel thermostable factor** that enhances PCR product yield without altering the fidelity of DNA replication. PfuTurbo DNA polymerase can be used to amplify complex genomic DNA targets up to 10 kb in length and vector targets up to 15 kb in length. It also amplifies complex targets in higher yield than Taq DNA polymerase or other commercially available proofreading PCR enzymes. Because Pfu DNA polymerase is known to generate blunt-end amplicons that can be easily cloned using the PCR Script cloning kit2 we assumed PfuTurbo DNA polymerase would also possess this characteristic.

Cloning blunt-end amplicons generated with enzymes such as PfuTurbo DNA polymerase is significantly more convenient than cloning amplicons produced with Taq DNA polymerase. Taq DNA polymerase creates amplicons with 3 overhangs.3,4 These molecules are cloned with low efficiency using the TA Cloning vector,2 or with high efficiency using the blunt-end PCR-Script vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

The amplicon generated by PfuTurbo DNA polymerase was also purified using the StrataPrep PCR kit method prior to the ligation reaction. The CAM amplicons were ligated to the PCR-Script vector, and the products were transformed into Epicurian Coli XL1-Blue MRF Kan supercompetent cells according to instructions in the PCR-Script Amp SK(+) cloning kit manual. The transformation mixtures were plated on LB ampicillin (50 g/ml) plates containing 0.5mM IPTG and 40 g/ml X-gal. Following overnight incubation at 37C, recombinant (white) and nonrecombinant (blue) colonies were counted. White colonies containing the putative insert were replica plated onto LB plates containing chloramphenicol (35 g/ml) to determine the percentage of CAM-resistant positives.

Figure 1

The mean percentage of recombinant clones per plate (white colony number divided by blue colony number multiplied by 100) and the mean percentage of white colonies that were also CAM-resistant are presented in Figure 1: PfuTurbo DNA polymerase produced CAM amplicons cloned with high efficiency (85%). Amplicons generated from Taq DNA polymerase were also cloned with greater than 85% efficiency, if the amplicons were polished prior to ligation to the PCR Script vector. The cloning efficiency of Taq-generated product was less than 10% in these experiments if no polishing reaction was performed (data not shown).

Conclusions

PfuTurbo DNA polymerase is a high-performance, high-fidelity enzyme formulation ideal for generating blunt-end PCR amplicons that are easily cloned with high efficiency using the PCR-Script cloning kit. Amplicons generated with Taq DNA polymerase not only require polishing prior to ligation to the PCR Script vector but also possess six-fold greater errors. When compared to Pfu DNA polymerase, PfuTurbo DNA polymerase allows the use of shorter extension times, fewer PCR cycles, and lower concentrations of DNA template.1 PfuTurbo DNA polymerase couples enhanced PCR performance and product yield with high-fidelity while eliminating the need for polishing, making it the enzyme of choice for fast, reliable, and accurate PCR cloning.

REFERENCES
  1. Hogrefe, et al. (1997) Strategies 10: 93-96.

  2. Sanchez, T., Zheng, C.-F., and Bauer, J. (1996) Strategies 9: 44-46.

  3. Clark, J.M. (1988) Nuc. Acids Res. 16: 9677-9686.

  4. Hu, G. (1993) DNA and Cell Biol. 12: 763-770.

  5. Costa, G. and Weiner, M.P. (1994) Strategies 7: 47-48.

  6. Pearson, S. and Bauer, J.C. (1996) Strategies 9: 26-27.

  7. Cline, J., Braman, J.C., and Hogrefe, H.H. (1996) Nuc. Acids Res. 24: 3546-3551.

  8. Braman, J. and Basehore, S. (1997) Strategies 10 (2): 84-86.

* U.S. Patent No. 5,545,552 and patents pending.
** Patents pending.


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:9/15/2014)... State University have developed a technique for controlling the ... voltages, opening the door to a new generation of ... hinges on the fact that the oxide "skin" of ... acts as a surfactant, lowering the surface tension ... researchers used a liquid metal alloy of gallium and ...
(Date:9/15/2014)... MORRISVILLE, NC (PRWEB) September 15, 2014 ... newly developed deep imaging OCT system for the optical ... , The EnvisuTM S4410 SDOCT for Contact ... measurements for standard and high complexity contact lens, IOL ... allows imaging of a complete contact lens immersed in ...
(Date:9/15/2014)... The chemistry, taste, and health effects of tea can vary ... the nonprofit American Botanical Council (ABC). Recent research by ... on the phytochemical compounds in tea ( Camellia sinensis ) ... in the Yunnan province of southwestern ... future of medicinal botanicals. Dr. Ahmed,s report on ...
(Date:9/15/2014)... septiembre de 2014 La segunda anual International ... 12 al 18 de octubre. Como iniciativa conjunta de la ... compañías miembro s, la IPAW se ha diseñado para: ... a la colección de fuentes de plasma , Reconocimiento ... y mejorar las vidas , Aumento del conocimiento sobre ...
Breaking Biology Technology:Researchers control surface tension to manipulate liquid metals 2Bioptigen Introduces Deep Imaging OCT System for Contact Lens Metrology 2Tea Taste and Quality Affected by Climate Change 2Tea Taste and Quality Affected by Climate Change 3Tea Taste and Quality Affected by Climate Change 4La International Plasma Awareness Week será una celebración para los donantes 2La International Plasma Awareness Week será una celebración para los donantes 3
... Ondine Biopharma,Corporation (the "Company" or "Ondine", TSX: ... photodisinfection based products, today,announced its financial results ... 2008., "During the past quarter we ... photodisinfection technology and we are leveraging our,successes ...
... 14 Palatin Technologies,Inc. (Amex: PTN ) ... clinical,trial of PL-3994, a novel, long-acting natriuretic peptide ... heart failure (HF). The,Phase 2a trial was a ... volunteers with controlled hypertension who,received the medication or ...
... professor of aerospace and ocean engineering at Virginia Tech, ... E. Powe Junior Faculty Award. The award will support ... are new material and structural systems that have the ... "I believe these innovative materials will lead to new ...
Cached Biology Technology:Ondine Biopharma Announces Second Quarter 2008 Financial Results 2Ondine Biopharma Announces Second Quarter 2008 Financial Results 3Ondine Biopharma Announces Second Quarter 2008 Financial Results 4Ondine Biopharma Announces Second Quarter 2008 Financial Results 5Ondine Biopharma Announces Second Quarter 2008 Financial Results 6Ondine Biopharma Announces Second Quarter 2008 Financial Results 7Ondine Biopharma Announces Second Quarter 2008 Financial Results 8Ondine Biopharma Announces Second Quarter 2008 Financial Results 9Ondine Biopharma Announces Second Quarter 2008 Financial Results 10Ondine Biopharma Announces Second Quarter 2008 Financial Results 11Ondine Biopharma Announces Second Quarter 2008 Financial Results 12Ondine Biopharma Announces Second Quarter 2008 Financial Results 13Ondine Biopharma Announces Second Quarter 2008 Financial Results 14Ondine Biopharma Announces Second Quarter 2008 Financial Results 15Ondine Biopharma Announces Second Quarter 2008 Financial Results 16Ondine Biopharma Announces Second Quarter 2008 Financial Results 17Palatin Technologies, Inc. Reports Positive Results of Phase 2a Clinical Study with PL-3994 for the Treatment of Heart Failure 2Palatin Technologies, Inc. Reports Positive Results of Phase 2a Clinical Study with PL-3994 for the Treatment of Heart Failure 3
(Date:9/15/2014)... PULLMAN, Wash.Washington State University researchers have found "the most ... that can be used to transfer valuable genes ... the way for breeders to develop wheat varieties with ... a legion of genetic tools that can reduce crop ... hurdles and controversy of Genetically Modified Organisms, or GMOs., ...
(Date:9/15/2014)... understand how the fish communities might shift under ... of environmental data to inform future decisions relating ... said Paula Whitfield, a research ecologist at NOAA,s ... lead author of the study. , The North ... where historically, both temperate and tropical species live, ...
(Date:9/15/2014)... the Department of Science and Technology in Society in ... Virginia Tech, has won a 2014 National Science Foundation ... and problems of creating a global nuclear emergency response ... Nuclear Power Plant in March 2011 was a turning ... Schmid said. Three of the plant,s six nuclear reactors ...
Breaking Biology News(10 mins):WSU researchers find 'most famous wheat gene' 2Study finds warming Atlantic temperatures could increase range of invasive species 2'Nuclear disasters don't respect national boundaries' 2
... German . Scientists at the Max Planck ... insights for stem cell research which are also applicable to ... treatments. As Rolf Kemler,s research group discovered, a molecular link ... telomeres and a signalling pathway known as the Wnt/β-signalling pathway. ...
... smaller than the nano as it is the equivalent of ... green algae of this imperceptible size existing in the Bilbao ... estuary. This has enabled him to identify six genera and ... been catalogued in these waters. He has also put forward ...
... toward treating disease with minute capsules containing not drugs ... making the drug. In an article in ACS, journal ... nano-sized capsules that contain the genetically coded instructions, plus ... that can be switched on with an external signal. ...
Cached Biology News:A nanoscopic look at the estuary's green algae 2A nanoscopic look at the estuary's green algae 3
... your microarray data using Asuragens bioinformatics ... need from consultation to extensive data ... date methods. Utilize our expertise in ... Service or from your own microarray ...
... value of your microarray data using ... support you need from consultation to ... up to date methods. Utilize our ... Expression Profiling Service or from your ...
... Maximize the value of your microarray ... the support you need from consultation to ... to date methods. Utilize our expertise in ... or from your own microarray experiments., ,Normalization ...
... This CLS number is a ... easily match Cornings product number. ... please order under the old ... customer service for assistance. ...
Biology Products: