Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning


Produce PCR amplicons that are easily cloned with high efficiency

pfuturbo DNA Polymerase:
A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

Jeff Braman Holly Hogrefe
Stratagene

A chloramphenicol resistance (CAM) gene generated from pfuturbo DNA polymerase *, was cloned into the PCR-Script vector with greater than 85% efficiency. PfuTurbo DNA polymerase not only creates high-fidelity products, it also generates blunt-end PCR products, which eliminates the need for polishing. PfuTurbo DNA polymerase enhances PCR product yield without altering the fidelity of DNA replication, making it the enzyme of choice for reliable PCR product amplification and subsequent cloning.

Stratagene recently introduced PfuTurbo DNA polymerase,1 a special formulation of cloned Pfu DNA polymerase and a novel thermostable factor** that enhances PCR product yield without altering the fidelity of DNA replication. PfuTurbo DNA polymerase can be used to amplify complex genomic DNA targets up to 10 kb in length and vector targets up to 15 kb in length. It also amplifies complex targets in higher yield than Taq DNA polymerase or other commercially available proofreading PCR enzymes. Because Pfu DNA polymerase is known to generate blunt-end amplicons that can be easily cloned using the PCR Script cloning kit2 we assumed PfuTurbo DNA polymerase would also possess this characteristic.

Cloning blunt-end amplicons generated with enzymes such as PfuTurbo DNA polymerase is significantly more convenient than cloning amplicons produced with Taq DNA polymerase. Taq DNA polymerase creates amplicons with 3 overhangs.3,4 These molecules are cloned with low efficiency using the TA Cloning vector,2 or with high efficiency using the blunt-end PCR-Script vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

The amplicon generated by PfuTurbo DNA polymerase was also purified using the StrataPrep PCR kit method prior to the ligation reaction. The CAM amplicons were ligated to the PCR-Script vector, and the products were transformed into Epicurian Coli XL1-Blue MRF Kan supercompetent cells according to instructions in the PCR-Script Amp SK(+) cloning kit manual. The transformation mixtures were plated on LB ampicillin (50 g/ml) plates containing 0.5mM IPTG and 40 g/ml X-gal. Following overnight incubation at 37C, recombinant (white) and nonrecombinant (blue) colonies were counted. White colonies containing the putative insert were replica plated onto LB plates containing chloramphenicol (35 g/ml) to determine the percentage of CAM-resistant positives.

Figure 1

The mean percentage of recombinant clones per plate (white colony number divided by blue colony number multiplied by 100) and the mean percentage of white colonies that were also CAM-resistant are presented in Figure 1: PfuTurbo DNA polymerase produced CAM amplicons cloned with high efficiency (85%). Amplicons generated from Taq DNA polymerase were also cloned with greater than 85% efficiency, if the amplicons were polished prior to ligation to the PCR Script vector. The cloning efficiency of Taq-generated product was less than 10% in these experiments if no polishing reaction was performed (data not shown).

Conclusions

PfuTurbo DNA polymerase is a high-performance, high-fidelity enzyme formulation ideal for generating blunt-end PCR amplicons that are easily cloned with high efficiency using the PCR-Script cloning kit. Amplicons generated with Taq DNA polymerase not only require polishing prior to ligation to the PCR Script vector but also possess six-fold greater errors. When compared to Pfu DNA polymerase, PfuTurbo DNA polymerase allows the use of shorter extension times, fewer PCR cycles, and lower concentrations of DNA template.1 PfuTurbo DNA polymerase couples enhanced PCR performance and product yield with high-fidelity while eliminating the need for polishing, making it the enzyme of choice for fast, reliable, and accurate PCR cloning.

REFERENCES
  1. Hogrefe, et al. (1997) Strategies 10: 93-96.

  2. Sanchez, T., Zheng, C.-F., and Bauer, J. (1996) Strategies 9: 44-46.

  3. Clark, J.M. (1988) Nuc. Acids Res. 16: 9677-9686.

  4. Hu, G. (1993) DNA and Cell Biol. 12: 763-770.

  5. Costa, G. and Weiner, M.P. (1994) Strategies 7: 47-48.

  6. Pearson, S. and Bauer, J.C. (1996) Strategies 9: 26-27.

  7. Cline, J., Braman, J.C., and Hogrefe, H.H. (1996) Nuc. Acids Res. 24: 3546-3551.

  8. Braman, J. and Basehore, S. (1997) Strategies 10 (2): 84-86.

* U.S. Patent No. 5,545,552 and patents pending.
** Patents pending.


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:7/10/2014)... Robert Harman, DVM, Founder and CEO of Vet-Stem, Inc., ... the relaunch of his highly informative blog, now named Stem ... What are Stem Cells ?” Dr. Harman’s purpose for ... the basics of stem cell therapy so that pet owners ... treatment when considering regenerative medicine. , A veterinarian by trade, ...
(Date:7/10/2014)... , July 10, 2014  Franciscan St. ... of capnography for respiratory monitoring outside the ... healthcare leaders in embracing state-of-the-art patient safety ... patients are breathing and can alert medical ... measuring the amount of carbon dioxide the ...
(Date:7/10/2014)... , July 10, 2014 Research and ... of the "International Photonic Integrated Circuit (Monolithic ... to 2019" report to their offering. ... The concept of photonic integration traces its roots ... The promise of photonic integration went unexplored and ...
(Date:7/10/2014)... Using microscopic polymer light resonators that expand in ... Quantum Photonics Laboratory have developed new optical sensors ... Optical sensors are ideal for detecting trace gas ... lightweight nature, and immunity to electromagnetic interference. , ... before, the MIT team conceived an extremely sensitive, ...
Breaking Biology Technology:Robert Harman, DVM Talks About What Stem Cells are in His Latest Blog Series for Vet-Stem, Inc. 2Robert Harman, DVM Talks About What Stem Cells are in His Latest Blog Series for Vet-Stem, Inc. 3Franciscan St. Anthony Health-Crown Point Underscores Patient Safety Commitment Through Expanded Use of Capnography 2International Photonic Integrated Circuit (Monolithic Integration, Hybrid Integration, Module Integration) Market - Forecasts to 2019 2Swell new sensors 2
... March 29, 2011 Perceptive Informatics , a ... International Corporation (Nasdaq: PRXL ), today unveiled ... (EDC) solution, which provides richer functionality to further streamline ... solution enables clinical trial sponsors to more efficiently ...
... MP3s, smartphones and cameras could become a reality thanks ... a tiny device that improves on existing forms of ... to convert data into signals that are stored as ... arm to translate the data into electrical signals. This ...
... MARIETTA, Ga., March 28, 2011 MiMedx Group, Inc. ... developer, manufacturer and marketer of patent protected biomaterial-based products ... its results for the year ended December 31, 2010. ... Company changed its fiscal year to coincide with the ...
Cached Biology Technology:Perceptive Informatics Introduces DataLabs® 5.0 EDC Solution, Unlocking New Clinical Trial Process Efficiencies 2Perceptive Informatics Introduces DataLabs® 5.0 EDC Solution, Unlocking New Clinical Trial Process Efficiencies 3Perceptive Informatics Introduces DataLabs® 5.0 EDC Solution, Unlocking New Clinical Trial Process Efficiencies 4Perceptive Informatics Introduces DataLabs® 5.0 EDC Solution, Unlocking New Clinical Trial Process Efficiencies 5MiMedx Group Announces 2010 Results 2MiMedx Group Announces 2010 Results 3MiMedx Group Announces 2010 Results 4MiMedx Group Announces 2010 Results 5MiMedx Group Announces 2010 Results 6MiMedx Group Announces 2010 Results 7
(Date:7/11/2014)... Shenzhen, China Researchers from Salk Institute for Biological ... time evaluated the safety and reliability of the ... a new method, TALEN-HDAdV, which could significantly increased ... (hiPSC). This study published online in Cell ... for stem cell-based gene therapy. , The combination ...
(Date:7/11/2014)... team of researchers, including scientists from the Max Planck ... reported a major step in understanding photosynthesis, the process ... the oxygen in its atmosphere and which is therefore ... , The researchers report the first direct visualization ... the step in which a specific protein complex, photosystem ...
(Date:7/11/2014)... SEATTLE, WASH. July 11, 2014 Researchers ... navigate three-dimensional images. The new technology, called Virtual ... of small structures like neurons and synapses using ... Finger,s unique technology makes 3D imaging studies orders ... resources at an unprecedented level across many areas ...
Breaking Biology News(10 mins):A new genome editing method brings the possibility of gene therapies closer to reality 2A first direct glimpse of photosynthesis in action 2Virtual finger enables scientists to navigate and analyze complex 3D images 2
... pathway that Cannabis sativa uses to create bioactive compounds ... marijuana varieties to produce pharmaceuticals or cannabinoid-free industrial hemp. ... edition of the Proceedings of the National Academy ... professor of biology Jon Page explains that the pathway ...
... R.I. A Rhode Island Hospital researcher has found ... behaviors such as alcohol use, unsafe sex and violence. ... messaging, email, or Internet) over traditional intervention methods such ... Megan L. Ranney, M.D., is available now online in ...
... waste time and money while reducing print quality. University of ... the human eye. "The nozzle cover we invented ... associate professor in the College of Engineering. "The eye and ... not be allowed to dry while, simultaneously, they must open. ...
Cached Biology News:U of S researchers discover cannabis 'pharma factory' 2RIH study: Emergency patients prefer technology-based interventions for behavioral issues 2Human eye inspires clog-free ink jet printer invented by MU researcher 2
Rabbit polyclonal to Synapsin II ( Abpromise for all tested applications). entrezGeneID: 6854 SwissProtID: Q92777...
BD BioCoat Laminin 35 mm Culture Dishes, tissue-culture treated polystyrene with a uniform application of mouse laminin....
... sequencing inserts cloned into M13/pUC-based plasmids, plasmids ... polymerase promoters, or lambda gt10 and gt11 ... of 0.1 µg/µl in water. The primers ... using SequiTherm™ EXCEL™ II DNA Polymerase with ...
... a powerful application for DNA and ... interface, Expression makes complex computational analyses ... uses the very latest computing technology ... way sequences are analysed. Features include: ...
Biology Products: