Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning


Produce PCR amplicons that are easily cloned with high efficiency

pfuturbo DNA Polymerase:
A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

Jeff Braman Holly Hogrefe
Stratagene

A chloramphenicol resistance (CAM) gene generated from pfuturbo DNA polymerase *, was cloned into the PCR-Script vector with greater than 85% efficiency. PfuTurbo DNA polymerase not only creates high-fidelity products, it also generates blunt-end PCR products, which eliminates the need for polishing. PfuTurbo DNA polymerase enhances PCR product yield without altering the fidelity of DNA replication, making it the enzyme of choice for reliable PCR product amplification and subsequent cloning.

Stratagene recently introduced PfuTurbo DNA polymerase,1 a special formulation of cloned Pfu DNA polymerase and a novel thermostable factor** that enhances PCR product yield without altering the fidelity of DNA replication. PfuTurbo DNA polymerase can be used to amplify complex genomic DNA targets up to 10 kb in length and vector targets up to 15 kb in length. It also amplifies complex targets in higher yield than Taq DNA polymerase or other commercially available proofreading PCR enzymes. Because Pfu DNA polymerase is known to generate blunt-end amplicons that can be easily cloned using the PCR Script cloning kit2 we assumed PfuTurbo DNA polymerase would also possess this characteristic.

Cloning blunt-end amplicons generated with enzymes such as PfuTurbo DNA polymerase is significantly more convenient than cloning amplicons produced with Taq DNA polymerase. Taq DNA polymerase creates amplicons with 3 overhangs.3,4 These molecules are cloned with low efficiency using the TA Cloning vector,2 or with high efficiency using the blunt-end PCR-Script vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

The amplicon generated by PfuTurbo DNA polymerase was also purified using the StrataPrep PCR kit method prior to the ligation reaction. The CAM amplicons were ligated to the PCR-Script vector, and the products were transformed into Epicurian Coli XL1-Blue MRF Kan supercompetent cells according to instructions in the PCR-Script Amp SK(+) cloning kit manual. The transformation mixtures were plated on LB ampicillin (50 g/ml) plates containing 0.5mM IPTG and 40 g/ml X-gal. Following overnight incubation at 37C, recombinant (white) and nonrecombinant (blue) colonies were counted. White colonies containing the putative insert were replica plated onto LB plates containing chloramphenicol (35 g/ml) to determine the percentage of CAM-resistant positives.

Figure 1

The mean percentage of recombinant clones per plate (white colony number divided by blue colony number multiplied by 100) and the mean percentage of white colonies that were also CAM-resistant are presented in Figure 1: PfuTurbo DNA polymerase produced CAM amplicons cloned with high efficiency (85%). Amplicons generated from Taq DNA polymerase were also cloned with greater than 85% efficiency, if the amplicons were polished prior to ligation to the PCR Script vector. The cloning efficiency of Taq-generated product was less than 10% in these experiments if no polishing reaction was performed (data not shown).

Conclusions

PfuTurbo DNA polymerase is a high-performance, high-fidelity enzyme formulation ideal for generating blunt-end PCR amplicons that are easily cloned with high efficiency using the PCR-Script cloning kit. Amplicons generated with Taq DNA polymerase not only require polishing prior to ligation to the PCR Script vector but also possess six-fold greater errors. When compared to Pfu DNA polymerase, PfuTurbo DNA polymerase allows the use of shorter extension times, fewer PCR cycles, and lower concentrations of DNA template.1 PfuTurbo DNA polymerase couples enhanced PCR performance and product yield with high-fidelity while eliminating the need for polishing, making it the enzyme of choice for fast, reliable, and accurate PCR cloning.

REFERENCES
  1. Hogrefe, et al. (1997) Strategies 10: 93-96.

  2. Sanchez, T., Zheng, C.-F., and Bauer, J. (1996) Strategies 9: 44-46.

  3. Clark, J.M. (1988) Nuc. Acids Res. 16: 9677-9686.

  4. Hu, G. (1993) DNA and Cell Biol. 12: 763-770.

  5. Costa, G. and Weiner, M.P. (1994) Strategies 7: 47-48.

  6. Pearson, S. and Bauer, J.C. (1996) Strategies 9: 26-27.

  7. Cline, J., Braman, J.C., and Hogrefe, H.H. (1996) Nuc. Acids Res. 24: 3546-3551.

  8. Braman, J. and Basehore, S. (1997) Strategies 10 (2): 84-86.

* U.S. Patent No. 5,545,552 and patents pending.
** Patents pending.


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:8/28/2008)...wswire-FirstCall/ -- ThromboGenics NV,(Euronext Br...nnovative,treatments for eye disease, vascular dis...e and its financial results for the six month peri...f 2008, ThromboGenics has achieved a number of,key...uccessfully pursue the,next stage of its corporate...
(Date:8/28/2008)...ewswire-FirstCall/ -- deCODE genetics,(Nasdaq: DC...ast of deCODE,CSO Jeffrey Gulcher,s presentation a...8., The presentation will be delivered at 1:30 PM... Wednesday, September 3 at the Four Seasons Hotel,...he Investors page on,deCODE,s website, http://www...
(Date:8/28/2008)...stCall/ -- SulphCo, Inc. (the "Company",or "SulphC...ented ultrasound,process to desulfurize crude oil,...n to the Company,s Board of Directors., "We are p... Directors,",said Dr. Larry D. Ryan, Chief Executi...rom his extensive experience, both in the executiv...
(Date:8/28/2008)...ewswire-FirstCall/ -- Abaxis, Inc.,(Nasdaq: ABAX ...of-care,blood analysis systems, announced today th...nta Ines, CFO, will present at the Sidoti & Compan...itutional Investor Forum on,Monday, September 8, 2...an,Francisco, CA., About Abaxis, Abaxis develops...
Breaking Biology Technology:ThromboGenics Announces Half Year Results 2008 2ThromboGenics Announces Half Year Results 2008 3ThromboGenics Announces Half Year Results 2008 4ThromboGenics Announces Half Year Results 2008 5deCODE genetics to Webcast Presentation at Thomas Weisel Partners Healthcare Conference 2008 2SulphCo Adds New Board Member 2
...t help thinking of the second verse from "Blowin,...y to confront what is really happening all around ...edia starts hyping yet another new business impera...s all the rage. Anyone hesitating to reengineer th... the dustbin of history. Or so it was believed. Bu...
...istory of interstate sports rivalries (especially ...etimes, like this past New Years Day, the rivalry ...an Wolverines and marijuana have in common? They b...ay be fomenting another interstate rivalry. This o...er this month, Michigans state government announce...
... a calm before the storm. The plans are set, the p... in quiet preparations by a group of outstanding c...t. , ,As executive producer of the event, I,m boun...uncements confidential until their unveiling at th...my near-exclusive focus for the past five months, ...
...vider of global supply chain technology solutions,... License revenue was $14.8 million, up 44% over 20...and amortization (EBITDA) were $16.3 million, up 2...mments John Jazwiec, RedPrairie Company Leader, ...ts was our strong growth in license revenue fueled...
Other Biology Technology:Offshore Outsourcing: On Target or Off Base? 2Offshore Outsourcing: On Target or Off Base? 3For Now, Michigan Can Celebrate $150 Million Entrepreneurial VC Fund 2For Now, Michigan Can Celebrate $150 Million Entrepreneurial VC Fund 3For Now, Michigan Can Celebrate $150 Million Entrepreneurial VC Fund 4The Calm Before the Storm: Hot New Firms and Technologies 2The Calm Before the Storm: Hot New Firms and Technologies 3
(Date:8/28/2008)... HOUSTON, Aug. 28, 2008 Presenting new research ... and measures, a conference established by a Unive...become the premier forum for the research communit...ors and two students from UH will be at the fifth ...ineers International Conference on Advanced Video ...
(Date:8/28/2008)..., Following last summer,s record minimum ice c...s Envisat satellite suggest that the extent of pol...to that of last year. , Envisat observations fro...ce coverage could be reached in a matter of weeks.... Arctic Ocean created from images acquired between...
(Date:8/28/2008)... Juergen Tautz will receive a special discretiona...ology Organization (EMBO) Award for Communication ...nition of Tautz,s long-term public communication a...edia. Tautz is the author of the Springer book Th...at all aspects of bees and bee colonies. , The B...
(Date:8/27/2008)... AMES, Iowa -- Iowa State University researcher R...oteins have controlled motions. , Most biochemi...m, uncontrolled movements. , Research conducted ... Bioinformatics and Biological Statistics together...er science and graduate student Lei Yang, over a 1...
Breaking Biology News(10 mins):National security remedies among topics at surveillance confab 2National security remedies among topics at surveillance confab 3Arctic ice on the verge of another all-time low 2Arctic ice on the verge of another all-time low 3Springer bee expert Juergen Tautz wins prize for public communication 2Iowa State University researcher shows proteins have controlled motions 2Ibuprofen can slow lung disease in children with cystic fibrosis Canadian study shows 507 1BioMarin to Present at the Bear Stearns 20th Annual Healthcare Conference 502 1Revolutionary Genomics Research Group Opens Boston Office 3B Provides DNA Evidence in Workers Comp Cases 351 1Revolutionary Genomics Research Group Opens Boston Office 3B Provides DNA Evidence in Workers Comp Cases 351 2American Oriental Bioengineering Announces Participation in September Investor Conferences 346 1American Oriental Bioengineering Announces Participation in September Investor Conferences 346 2
...st affect every organism on Earth, even Monarch bu...than non-migratory ones to parasite infections; sc...: infected monarchs quite don,t make it while migr...infection once arrived at destination. , A littl...hese long journeys can limit the spread of parasit...
...on University in St. Louis has proposed that evolu...th,s development rather than physical processes, s...ashington University assistant professor of geomic...ry Sciences in Arts & Sciences, studying Cyano...on dioxide to produce oxygen and biomass ?has conc...
...Research Center are analyzing the surprising resul...rring in the Amazonian rainforest. , From January ...e-hectare (2.2 acre) plot in the middle of the Tap... of rainfall was diverted with six thousand 2, by ...ve the soil. The panels were removed during the fi...
... News) and Karolinska Institutet announced today t...signed to improve healthcare by accelerating the t...r better diagnosis, prognosis, and treatment. , D...etic analyses and measurement of gene expression i...eumatoid arthritis, asthma and dyslexia. These dis...
Other Biology News:Family trees of ancient bacteria reveal evolutionary moves 2Family trees of ancient bacteria reveal evolutionary moves 3World's largest rainforest drying experiment completes first phase 2World's largest rainforest drying experiment completes first phase 3Affymetrix and the Karolinska Institutet Announce Translational Medicine Strategic Alliance 2Affymetrix and the Karolinska Institutet Announce Translational Medicine Strategic Alliance 3