( Produce PCR amplicons that ...)pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

Produce PCR amplicons that are easily cloned with high efficiency

pfuturbo DNA Polymerase:
A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

Jeff Braman Holly Hogrefe
Stratagene

A chloramphenicol resistance (CAM) gene generated from pfuturbo DNA polymerase *^, was cloned into the PCR-Script vector with greater than 85% efficiency. PfuTurbo DNA polymerase not only creates high-fidelity products, it also generates blunt-end PCR products, which eliminates the need for polishing. PfuTurbo DNA polymerase enhances PCR product yield without altering the fidelity of DNA replication, making it the enzyme of choice for reliable PCR product amplification and subsequent cloning.

Stratagene recently introduced PfuTurbo DNA polymerase,¹ a special formulation of cloned Pfu DNA polymerase and a novel thermostable factor** that enhances PCR product yield without altering the fidelity of DNA replication. PfuTurbo DNA polymerase can be used to amplify complex genomic DNA targets up to 10 kb in length and vector targets up to 15 kb in length. It also amplifies complex targets in higher yield than Taq DNA polymerase or other commercially available proofreading PCR enzymes. Because Pfu DNA polymerase is known to generate blunt-end amplicons that can be easily cloned using the PCR Script cloning kit² we assumed PfuTurbo DNA polymerase would also possess this characteristic.

Cloning blunt-end amplicons generated with enzymes such as PfuTurbo DNA polymerase is significantly more convenient than cloning amplicons produced with Taq DNA polymerase. Taq DNA polymerase creates amplicons with 3 overhangs.^3,4 These molecules are cloned with low efficiency using the TA Cloning vector,² or with high efficiency using the blunt-end PCR-Script vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.^2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,⁷ a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide^3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit⁸ to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

The amplicon generated by PfuTurbo DNA polymerase was also purified using the StrataPrep PCR kit method prior to the ligation reaction. The CAM amplicons were ligated to the PCR-Script vector, and the products were transformed into Epicurian Coli XL1-Blue MRF Kan supercompetent cells according to instructions in the PCR-Script Amp SK(+) cloning kit manual. The transformation mixtures were plated on LB ampicillin (50 g/ml) plates containing 0.5mM IPTG and 40 g/ml X-gal. Following overnight incubation at 37C, recombinant (white) and nonrecombinant (blue) colonies were counted. White colonies containing the putative insert were replica plated onto LB plates containing chloramphenicol (35 g/ml) to determine the percentage of CAM-resistant positives.

Figure 1

The mean percentage of recombinant clones per plate (white colony number divided by blue colony number multiplied by 100) and the mean percentage of white colonies that were also CAM-resistant are presented in Figure 1: PfuTurbo DNA polymerase produced CAM amplicons cloned with high efficiency (85%). Amplicons generated from Taq DNA polymerase were also cloned with greater than 85% efficiency, if the amplicons were polished prior to ligation to the PCR Script vector. The cloning efficiency of Taq-generated product was less than 10% in these experiments if no polishing reaction was performed (data not shown).

Conclusions

PfuTurbo DNA polymerase is a high-performance, high-fidelity enzyme formulation ideal for generating blunt-end PCR amplicons that are easily cloned with high efficiency using the PCR-Script cloning kit. Amplicons generated with Taq DNA polymerase not only require polishing prior to ligation to the PCR Script vector but also possess six-fold greater errors. When compared to Pfu DNA polymerase, PfuTurbo DNA polymerase allows the use of shorter extension times, fewer PCR cycles, and lower concentrations of DNA template.¹ PfuTurbo DNA polymerase couples enhanced PCR performance and product yield with high-fidelity while eliminating the need for polishing, making it the enzyme of choice for fast, reliable, and accurate PCR cloning.

REFERENCES

1. Hogrefe, et al. (1997) Strategies 10: 93-96.

2. Sanchez, T., Zheng, C.-F., and Bauer, J. (1996) Strategies 9: 44-46.

3. Clark, J.M. (1988) Nuc. Acids Res. 16: 9677-9686.

4. Hu, G. (1993) DNA and Cell Biol. 12: 763-770.

5. Costa, G. and Weiner, M.P. (1994) Strategies 7: 47-48.

6. Pearson, S. and Bauer, J.C. (1996) Strategies 9: 26-27.

7. Cline, J., Braman, J.C., and Hogrefe, H.H. (1996) Nuc. Acids Res. 24: 3546-3551.

8. Braman, J. and Basehore, S. (1997) Strategies 10 (2): 84-86.

* U.S. Patent No. 5,545,552 and patents pending.
** Patents pending.