Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning


Produce PCR amplicons that are easily cloned with high efficiency

pfuturbo DNA Polymerase:
A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

Jeff Braman Holly Hogrefe
Stratagene

A chloramphenicol resistance (CAM) gene generated from pfuturbo DNA polymerase *, was cloned into the PCR-Script vector with greater than 85% efficiency. PfuTurbo DNA polymerase not only creates high-fidelity products, it also generates blunt-end PCR products, which eliminates the need for polishing. PfuTurbo DNA polymerase enhances PCR product yield without altering the fidelity of DNA replication, making it the enzyme of choice for reliable PCR product amplification and subsequent cloning.

Stratagene recently introduced PfuTurbo DNA polymerase,1 a special formulation of cloned Pfu DNA polymerase and a novel thermostable factor** that enhances PCR product yield without altering the fidelity of DNA replication. PfuTurbo DNA polymerase can be used to amplify complex genomic DNA targets up to 10 kb in length and vector targets up to 15 kb in length. It also amplifies complex targets in higher yield than Taq DNA polymerase or other commercially available proofreading PCR enzymes. Because Pfu DNA polymerase is known to generate blunt-end amplicons that can be easily cloned using the PCR Script cloning kit2 we assumed PfuTurbo DNA polymerase would also possess this characteristic.

Cloning blunt-end amplicons generated with enzymes such as PfuTurbo DNA polymerase is significantly more convenient than cloning amplicons produced with Taq DNA polymerase. Taq DNA polymerase creates amplicons with 3 overhangs.3,4 These molecules are cloned with low efficiency using the TA Cloning vector,2 or with high efficiency using the blunt-end PCR-Script vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

The amplicon generated by PfuTurbo DNA polymerase was also purified using the StrataPrep PCR kit method prior to the ligation reaction. The CAM amplicons were ligated to the PCR-Script vector, and the products were transformed into Epicurian Coli XL1-Blue MRF Kan supercompetent cells according to instructions in the PCR-Script Amp SK(+) cloning kit manual. The transformation mixtures were plated on LB ampicillin (50 g/ml) plates containing 0.5mM IPTG and 40 g/ml X-gal. Following overnight incubation at 37C, recombinant (white) and nonrecombinant (blue) colonies were counted. White colonies containing the putative insert were replica plated onto LB plates containing chloramphenicol (35 g/ml) to determine the percentage of CAM-resistant positives.

Figure 1

The mean percentage of recombinant clones per plate (white colony number divided by blue colony number multiplied by 100) and the mean percentage of white colonies that were also CAM-resistant are presented in Figure 1: PfuTurbo DNA polymerase produced CAM amplicons cloned with high efficiency (85%). Amplicons generated from Taq DNA polymerase were also cloned with greater than 85% efficiency, if the amplicons were polished prior to ligation to the PCR Script vector. The cloning efficiency of Taq-generated product was less than 10% in these experiments if no polishing reaction was performed (data not shown).

Conclusions

PfuTurbo DNA polymerase is a high-performance, high-fidelity enzyme formulation ideal for generating blunt-end PCR amplicons that are easily cloned with high efficiency using the PCR-Script cloning kit. Amplicons generated with Taq DNA polymerase not only require polishing prior to ligation to the PCR Script vector but also possess six-fold greater errors. When compared to Pfu DNA polymerase, PfuTurbo DNA polymerase allows the use of shorter extension times, fewer PCR cycles, and lower concentrations of DNA template.1 PfuTurbo DNA polymerase couples enhanced PCR performance and product yield with high-fidelity while eliminating the need for polishing, making it the enzyme of choice for fast, reliable, and accurate PCR cloning.

REFERENCES
  1. Hogrefe, et al. (1997) Strategies 10: 93-96.

  2. Sanchez, T., Zheng, C.-F., and Bauer, J. (1996) Strategies 9: 44-46.

  3. Clark, J.M. (1988) Nuc. Acids Res. 16: 9677-9686.

  4. Hu, G. (1993) DNA and Cell Biol. 12: 763-770.

  5. Costa, G. and Weiner, M.P. (1994) Strategies 7: 47-48.

  6. Pearson, S. and Bauer, J.C. (1996) Strategies 9: 26-27.

  7. Cline, J., Braman, J.C., and Hogrefe, H.H. (1996) Nuc. Acids Res. 24: 3546-3551.

  8. Braman, J. and Basehore, S. (1997) Strategies 10 (2): 84-86.

* U.S. Patent No. 5,545,552 and patents pending.
** Patents pending.


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:8/29/2014)... The global companion diagnostics market ... It is expected to grow at a CAGR ... valued at $1.8 billion in 2013, according to ... , For more information regarding analysis details and ... research report, titled “Companion Diagnostics Market (Breast Cancer, ...
(Date:8/29/2014)... California (PRWEB) August 29, 2014 ... of Energy's 2014 Hydrogen Production R&D Award ... -- by splitting water using sunlight. , Shared ... (NREL) and the University of Nevada, Las Vegas ... work developing models of photoelectrochemical solar-hydrogen production and ...
(Date:8/28/2014)... Nevada City, CA (PRWEB) August 28, 2014 ... and sanitation products for the food processing industry, is ... conducting a side-by side comparison of the E2 soap ... Q E2 Sanitizing Foam Soap . Hand hygiene ... pathogens in the food processing environment. Six key criteria ...
(Date:8/28/2014)... NEW YORK , Aug. ... announces that a new market ... its catalogue: Whole ... (Systems, Kits (Library Preparation, Target ... Technology (Sequencing by Synthesis), by ...
Breaking Biology Technology:Companion Diagnostics Market to Hit $5.6 Billion in 2019: Transparency Market Research 2Companion Diagnostics Market to Hit $5.6 Billion in 2019: Transparency Market Research 3Livermore Team Awarded for Hydrogen Production Research 2Best Sanitizers, Inc. Asks Food Industry Professionals: With Fall Harvest On the Way, Is Your E2 Hand Soap Up to the Task? 2Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 2Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 3Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 4Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 5Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 6Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 7Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 8Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 9Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 10Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 11Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 12Whole Exome Sequencing Market by Product (Systems, Kits (Library Preparation, Target Enrichment), by Services (Sequencing), by Technology (Sequencing by Synthesis), by Application (Cancer, Monogenic disorders) - Global Forecast to 2018 13
... of Wisconsins economic growth will be getting the big ... best technology to the marketplace, controlling taxes and regulation, ... 21st century infrastructure in place to support all businesses. ... too, that may prove as vital to Wisconsins future ...
... For a number of reasons, we have all heard a lot ... drugs, the rise in number of people without medical insurance in ... the entry of generics into the market to help cap some ... reasons. , ,In fact, it is estimated that 41.2 million ...
... Systems is launching a national tour designed to ... wellness. The "GE Women's Health & Wellness Tour" will kick ... , ,"Empowering women with information about medical screening and prevention ... to managing their health," said Joseph M. Hogan, President and ...
Cached Biology Technology:Athletics, pop culture and the arts 2Athletics, pop culture and the arts 3The Generic Drug Industry in Illinois 2The Generic Drug Industry in Illinois 3The Generic Drug Industry in Illinois 4GE Launches Women's Health Initiative 2
(Date:8/28/2014)... new method for measuring and imaging how quickly blood ... better understand how drug abuse affects the brain, which ... and lead to better treatment options for recovering drug ... researchers from Stony Brook University in New York, USA ... today in The Optical Society,s (OSA) open-access journal ...
(Date:8/28/2014)... of new roads will be built worldwide by 2050. ... wildernesses, where they bring an influx of destructive loggers, ... study has created a ,global roadmap, for prioritising road ... competing demands of development and environmental protection. , The ... that natural importance of ecosystems and a ,road-benefits, layer ...
(Date:8/28/2014)... mould in homes could pose a significant health risk to ... the Journal of Allergy and Clinical Immunology . , ... different countries, the research has found that the presence of ... asthma sufferers, as well as increasing the likelihood of developing ... team at the University of Exeter Medical School and is ...
Breaking Biology News(10 mins):This is your brain's blood vessels on drugs 2This is your brain's blood vessels on drugs 3Study shows where on the planet new roads should and should not go 2Study shows where on the planet new roads should and should not go 3Indoor mold poses health risk to asthma sufferers 2
... DENVER Researchers have linked a variant in the ... chronic obstructive pulmonary disease (COPD) in Caucasian men. The ... Normative Aging Study, a multidisciplinary study of aging that ... presented at the ATS 2011 International Conference. "Our ...
... the process of converting the genetic information encoded in ... protein or any of several types of RNA. Scientists ... different physiological processes throughout the body are robustly pre-determined ... new study by researchers from the University of California, ...
... Most people who have had the experience of having ... the animals can "recognize" us. They seem to recognize our ... they respond to us differently from other people. , Actually, ... shown that domesticated animals, such as honey bees, chickens, pigeons, ...
Cached Biology News:Gene variant linked with development of COPD in men 2Plasticity of hormonal response permits rapid gene expression reprogramming 2I know you, bad guy! 2I know you, bad guy! 3
... CLS number is a new ... match Cornings product number. If ... order under the old Sigma-Aldrich ... service for assistance. ID clarifier: ...
ID clarifier: With ethidium bromide (50 μg/ml)...
... Mouse C2C12 cells were cultured in DMEM ... In order to keep the antigens in ... The cells are arrayed on a 12-well ... surface specifically treated to enhance cellular attachment and ...
... for optimal colony growth; ... growth of anchorage-dependent cells. ... colony-forming assays of human ... Not suitable for long-term ...
Biology Products: