Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning


Produce PCR amplicons that are easily cloned with high efficiency

pfuturbo DNA Polymerase:
A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

Jeff Braman Holly Hogrefe
Stratagene

A chloramphenicol resistance (CAM) gene generated from pfuturbo DNA polymerase *, was cloned into the PCR-Script vector with greater than 85% efficiency. PfuTurbo DNA polymerase not only creates high-fidelity products, it also generates blunt-end PCR products, which eliminates the need for polishing. PfuTurbo DNA polymerase enhances PCR product yield without altering the fidelity of DNA replication, making it the enzyme of choice for reliable PCR product amplification and subsequent cloning.

Stratagene recently introduced PfuTurbo DNA polymerase,1 a special formulation of cloned Pfu DNA polymerase and a novel thermostable factor** that enhances PCR product yield without altering the fidelity of DNA replication. PfuTurbo DNA polymerase can be used to amplify complex genomic DNA targets up to 10 kb in length and vector targets up to 15 kb in length. It also amplifies complex targets in higher yield than Taq DNA polymerase or other commercially available proofreading PCR enzymes. Because Pfu DNA polymerase is known to generate blunt-end amplicons that can be easily cloned using the PCR Script cloning kit2 we assumed PfuTurbo DNA polymerase would also possess this characteristic.

Cloning blunt-end amplicons generated with enzymes such as PfuTurbo DNA polymerase is significantly more convenient than cloning amplicons produced with Taq DNA polymerase. Taq DNA polymerase creates amplicons with 3 overhangs.3,4 These molecules are cloned with low efficiency using the TA Cloning vector,2 or with high efficiency using the blunt-end PCR-Script vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

The amplicon generated by PfuTurbo DNA polymerase was also purified using the StrataPrep PCR kit method prior to the ligation reaction. The CAM amplicons were ligated to the PCR-Script vector, and the products were transformed into Epicurian Coli XL1-Blue MRF Kan supercompetent cells according to instructions in the PCR-Script Amp SK(+) cloning kit manual. The transformation mixtures were plated on LB ampicillin (50 g/ml) plates containing 0.5mM IPTG and 40 g/ml X-gal. Following overnight incubation at 37C, recombinant (white) and nonrecombinant (blue) colonies were counted. White colonies containing the putative insert were replica plated onto LB plates containing chloramphenicol (35 g/ml) to determine the percentage of CAM-resistant positives.

Figure 1

The mean percentage of recombinant clones per plate (white colony number divided by blue colony number multiplied by 100) and the mean percentage of white colonies that were also CAM-resistant are presented in Figure 1: PfuTurbo DNA polymerase produced CAM amplicons cloned with high efficiency (85%). Amplicons generated from Taq DNA polymerase were also cloned with greater than 85% efficiency, if the amplicons were polished prior to ligation to the PCR Script vector. The cloning efficiency of Taq-generated product was less than 10% in these experiments if no polishing reaction was performed (data not shown).

Conclusions

PfuTurbo DNA polymerase is a high-performance, high-fidelity enzyme formulation ideal for generating blunt-end PCR amplicons that are easily cloned with high efficiency using the PCR-Script cloning kit. Amplicons generated with Taq DNA polymerase not only require polishing prior to ligation to the PCR Script vector but also possess six-fold greater errors. When compared to Pfu DNA polymerase, PfuTurbo DNA polymerase allows the use of shorter extension times, fewer PCR cycles, and lower concentrations of DNA template.1 PfuTurbo DNA polymerase couples enhanced PCR performance and product yield with high-fidelity while eliminating the need for polishing, making it the enzyme of choice for fast, reliable, and accurate PCR cloning.

REFERENCES
  1. Hogrefe, et al. (1997) Strategies 10: 93-96.

  2. Sanchez, T., Zheng, C.-F., and Bauer, J. (1996) Strategies 9: 44-46.

  3. Clark, J.M. (1988) Nuc. Acids Res. 16: 9677-9686.

  4. Hu, G. (1993) DNA and Cell Biol. 12: 763-770.

  5. Costa, G. and Weiner, M.P. (1994) Strategies 7: 47-48.

  6. Pearson, S. and Bauer, J.C. (1996) Strategies 9: 26-27.

  7. Cline, J., Braman, J.C., and Hogrefe, H.H. (1996) Nuc. Acids Res. 24: 3546-3551.

  8. Braman, J. and Basehore, S. (1997) Strategies 10 (2): 84-86.

* U.S. Patent No. 5,545,552 and patents pending.
** Patents pending.


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:5/21/2015)... uBiome, the leading startup focused ... PicnicHealth, a healthcare company that collects and consolidates ... Bowel Disease (IBD) will receive a complementary PicnicHealth ... kit. Both companies were funded by Y Combinator ... more information on this partnership and how to ...
(Date:5/21/2015)... 2015 Patent Offering, The patent’s technology ... or therapeutic imaging within a body lumen (open space). ... having a low cost, single-use disposable illumination and camera ... October 18, 2013 and the patent approval was received ... physician to customize the lighting and magnification of the ...
(Date:5/21/2015)... - RepliCel Life Sciences Inc. (TSX.V: RP) (OTCQB: ... on the development of autologous cell therapies, announced ... Society for Cellular Therapy (ISCT) on RepliCel,s autologous ... a Phase 1/2 clinical trial.  The presentation, taking ... PM to 7:00 PM local time, will review ...
(Date:5/20/2015)... 20, 2015 Research and Markets ( ... "Top Technologies in HW_Technical Insights" report to their ... evaluated technology trends in the Health and Wellness sector ... to have an impact in the year 2015. The ... top 10 health and wellness technologies that are anticipated ...
Breaking Biology Technology:uBiome Partners with PicnicHealth 2uBiome Partners with PicnicHealth 3IpAuctions™ Presents The Worlds Smallest Disposable Illuminated Endoscope For Auction 2IpAuctions™ Presents The Worlds Smallest Disposable Illuminated Endoscope For Auction 3RepliCel to Present Unique Autologous Cell Treatment for Achilles Tendinosis at International Society for Cellular Therapy Conference 2RepliCel to Present Unique Autologous Cell Treatment for Achilles Tendinosis at International Society for Cellular Therapy Conference 3Top Technologies in the Health and Wellness Industry 2015 2
... KUNMING, China, Nov. 12 /Xinhua-PRNewswire-FirstCall/ -- China ... ("China Shenghuo" or the,"Company"), which is engaged ... pharmaceutical, nutritional supplement and cosmetic products,in the ... the NYSE Alternext,US LLC (formerly the American ...
... Pa., Nov. 12 GEL Interactive,Technologies, a Cadient ... Director, will be a featured speaker at the ... on Defining Appropriate,and Effective Interactions with Thought Leaders ... Forum provides a platform for attendees to interact,and ...
... Nov. 12 Phosphagenics,Limited ("Phosphagenics") (ASX: POH; OTCQX: ... phase 1 human clinical trial using its ... delivery of a leading non steroidal,anti-inflammatory drug ... and penetration of the topically applied Voltaren(R) ...
Cached Biology Technology:NYSE Alternext US Accepts China Shenghuo's Compliance Plan for Continued Listing 2NYSE Alternext US Accepts China Shenghuo's Compliance Plan for Continued Listing 3NYSE Alternext US Accepts China Shenghuo's Compliance Plan for Continued Listing 4Cadient Group's GEL Interactive Technologies to Present and Exhibit at CBI's 5th Annual Forum 2Transdermal Diclofenac enters Phase 1 Clinical Trial in Humans 2
(Date:5/11/2015)... Ohio , May 11, 2015  Through a well-rounded ... Ohio had a strong showing at AUVSI,s Unmanned ... These representatives of Ohio,s UAS industry ... and abroad from all points along the UAS ecosystem. ... Development Coalition,s (DDC) Vice President for Aerospace Rich Knoll ...
(Date:5/8/2015)... 2015 Synaptics Inc. (NASDAQ: SYNA ), the ... of the executive management team will present at the following ... and Telecom Conference Date: May 18, 2015 Time: ... MA Cowen and Company Technology, Media ... Location: The New York Palace Hotel, New York, ...
(Date:5/5/2015)... 2015, NXT-ID, Inc. (NASDAQ: NXTD ) ("NXT-ID" ... growing mobile commerce market, reminds investors and media that  Mr. ... presenting  at CARTES SECURE CONNEXIONS AMERICA 2015, held in ... The three-day conference is organized into a series of ... themed Global Fraud: Where is the Trust in Cyberspace? ...
Breaking Biology News(10 mins):Ohio Flies High at Unmanned '15, Sets Stage for Ohio UAS Conference 2Synaptics to Present at Upcoming Investor Conferences 2NXT-ID, Inc.'s CTO, David Tunnell, Presents at CARTES SECURE CONNEXIONS AMERICA 2015 Today in Washington DC. 2NXT-ID, Inc.'s CTO, David Tunnell, Presents at CARTES SECURE CONNEXIONS AMERICA 2015 Today in Washington DC. 3
... piece of information to be of any use, one must first ... Nowadays, there is often just too much of it. We are ... night, assisting us to find, digest and comprehend it. In this ... for a barrier-free accessibility of content that can be harvested, extracted, ...
... tiny goggles, scientists say they have learned that the ... stimuli, but also can "learn" time intervals and create ... a team at the Johns Hopkins University School of ... light on learning and memory-making, the investigators say, and ...
... and Ghent, Belgium, January 23, 2013 Hundreds of ... scheduled to convene in Ghent, Belgium, from June 25-28 ... (ICG-Europe 2013). The conference, co-organized by BGI and VIB, ... in plant and animal genomics, metagenomics, as well as ...
Cached Biology News:Pensoft Publishers integrate their journal platform with OpenAIRE 2Pavlov's rats? Rodents trained to link rewards to visual cues 2Pavlov's rats? Rodents trained to link rewards to visual cues 3Pavlov's rats? Rodents trained to link rewards to visual cues 4The 2013 International Conference on Genomics in Europe will take place in Ghent, Belgium 2
The HQ505, 20 OptiGreen filter for the Molecular Imager FX is a band pass filter used for detection of Cy2 and FITC with 532 nm excitation....
... The APO-BRDU Kit is a 2-color staining ... cellular DNA to detect apoptotic cells by ... and reagents required for measuring apoptosis in ... for assessing reagent performance; washing, reaction and ...
... The ApopTag Red In Situ ... situ by the indirect TUNEL method, ... rhodamine fluorochrome. The kit provides indirect ... are analyzed using either fluorescence microscopy ...
The sample holders for gels are used to hold gels in place in the multi-sample tray I, which is used with Molecular Imager FX imaging systems....
Biology Products: