Navigation Links
pfuturbo DNA Polymerase:,,,A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning


Produce PCR amplicons that are easily cloned with high efficiency

pfuturbo DNA Polymerase:
A High-Performance, High-Fidelity Enzyme Ideal for PCR Cloning

Jeff Braman Holly Hogrefe
Stratagene

A chloramphenicol resistance (CAM) gene generated from pfuturbo DNA polymerase *, was cloned into the PCR-Script vector with greater than 85% efficiency. PfuTurbo DNA polymerase not only creates high-fidelity products, it also generates blunt-end PCR products, which eliminates the need for polishing. PfuTurbo DNA polymerase enhances PCR product yield without altering the fidelity of DNA replication, making it the enzyme of choice for reliable PCR product amplification and subsequent cloning.

Stratagene recently introduced PfuTurbo DNA polymerase,1 a special formulation of cloned Pfu DNA polymerase and a novel thermostable factor** that enhances PCR product yield without altering the fidelity of DNA replication. PfuTurbo DNA polymerase can be used to amplify complex genomic DNA targets up to 10 kb in length and vector targets up to 15 kb in length. It also amplifies complex targets in higher yield than Taq DNA polymerase or other commercially available proofreading PCR enzymes. Because Pfu DNA polymerase is known to generate blunt-end amplicons that can be easily cloned using the PCR Script cloning kit2 we assumed PfuTurbo DNA polymerase would also possess this characteristic.

Cloning blunt-end amplicons generated with enzymes such as PfuTurbo DNA polymerase is significantly more convenient than cloning amplicons produced with Taq DNA polymerase. Taq DNA polymerase creates amplicons with 3 overhangs.3,4 These molecules are cloned with low efficiency using the TA Cloning vector,2 or with high efficiency using the blunt-end PCR-Script vector, following treatment with Pfu DNA polymerase in the presence of deoxynucleoside triphosphates to polish the ends.2,5,6 Furthermore, PfuTurbo DNA polymerase has an error rate six-fold lower than that of Taq DNA polymerase,7 a crucial factor for accurate cloning.

Amplicon Generation

The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. The CAM gene from plasmid pBC SK (+) was amplified with Stratagenes PfuTurbo and Taq2000 DNA polymerases. Reactions contained 100 ng pBC SK (+) DNA, 200 mM dNTPs, 1 mg of each CAM primer (primer 1-5 GCTGTGACGGAAGATCACTTCGC 3; primer 2-5 GCTCCACGGGGAGAGCCTGAGCA 3), the appropriate 1X buffer for each enzyme and either PfuTurbo DNA polymerase, Pfu DNA polymerase or Taq DNA polymerase and were performed in a RoboCycler Gradient 96 thermocycler.

Taq DNA polymerase is known to introduce an additional 3-A or 3-C nucleotide3,4 onto amplicons produced with primers used in this experiment. Therefore, the amplicon generated from Taq DNA polymerase was polished prior to blunt-end ligation to the PCR-Script vector. The PCR product was first purified using the StrataPrep PCR purification kit8 to remove Taq DNA polymerase, primers, PCR contaminants, and buffer components. For the polishing reaction, a 10-l portion of the purified amplicon was incubated at 72C for 30 minutes in 1X reaction buffer, 100 M dNTPs, and 0.5 unit of Pfu DNA polymerase. To stop the reaction, the tube was placed on ice. Another portion of the purified Taq-generated amplicon was not subjected to a polishing reaction and served as a control.

The amplicon generated by PfuTurbo DNA polymerase was also purified using the StrataPrep PCR kit method prior to the ligation reaction. The CAM amplicons were ligated to the PCR-Script vector, and the products were transformed into Epicurian Coli XL1-Blue MRF Kan supercompetent cells according to instructions in the PCR-Script Amp SK(+) cloning kit manual. The transformation mixtures were plated on LB ampicillin (50 g/ml) plates containing 0.5mM IPTG and 40 g/ml X-gal. Following overnight incubation at 37C, recombinant (white) and nonrecombinant (blue) colonies were counted. White colonies containing the putative insert were replica plated onto LB plates containing chloramphenicol (35 g/ml) to determine the percentage of CAM-resistant positives.

Figure 1

The mean percentage of recombinant clones per plate (white colony number divided by blue colony number multiplied by 100) and the mean percentage of white colonies that were also CAM-resistant are presented in Figure 1: PfuTurbo DNA polymerase produced CAM amplicons cloned with high efficiency (85%). Amplicons generated from Taq DNA polymerase were also cloned with greater than 85% efficiency, if the amplicons were polished prior to ligation to the PCR Script vector. The cloning efficiency of Taq-generated product was less than 10% in these experiments if no polishing reaction was performed (data not shown).

Conclusions

PfuTurbo DNA polymerase is a high-performance, high-fidelity enzyme formulation ideal for generating blunt-end PCR amplicons that are easily cloned with high efficiency using the PCR-Script cloning kit. Amplicons generated with Taq DNA polymerase not only require polishing prior to ligation to the PCR Script vector but also possess six-fold greater errors. When compared to Pfu DNA polymerase, PfuTurbo DNA polymerase allows the use of shorter extension times, fewer PCR cycles, and lower concentrations of DNA template.1 PfuTurbo DNA polymerase couples enhanced PCR performance and product yield with high-fidelity while eliminating the need for polishing, making it the enzyme of choice for fast, reliable, and accurate PCR cloning.

REFERENCES
  1. Hogrefe, et al. (1997) Strategies 10: 93-96.

  2. Sanchez, T., Zheng, C.-F., and Bauer, J. (1996) Strategies 9: 44-46.

  3. Clark, J.M. (1988) Nuc. Acids Res. 16: 9677-9686.

  4. Hu, G. (1993) DNA and Cell Biol. 12: 763-770.

  5. Costa, G. and Weiner, M.P. (1994) Strategies 7: 47-48.

  6. Pearson, S. and Bauer, J.C. (1996) Strategies 9: 26-27.

  7. Cline, J., Braman, J.C., and Hogrefe, H.H. (1996) Nuc. Acids Res. 24: 3546-3551.

  8. Braman, J. and Basehore, S. (1997) Strategies 10 (2): 84-86.

* U.S. Patent No. 5,545,552 and patents pending.
** Patents pending.


'"/>

Source:


Page: All 1 2 3 4

Related biology technology :

1. PCR Performance Comparisons Between pfuturbo and Taq DNA Polymerases
2. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
3. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
4. High-Fidelity PCR with a Novel Polymerase Mixture
5. The Best Enzyme for the Toughest PCR Challenges Improved with New Hot-Start Feature
6. Comparing Fidelity and Performance of Proofreading PCR Enzymes
7. Greater Amplification Specificity with New Hot Start PCR Enzyme
8. Enzyme Immunoassay for Studying Intracellular Levels of cAMP
9. Improve Amplification Specificity with Hot Start PCR Enzyme
10. Choice of RT-PCR Enzymes
11. Properties of PCR Enzymes
Post Your Comments:
(Date:12/22/2014)... , Dec. 22, 2014   ... a developer of pathogen-specific therapies for serious ... protecting the microbiome, today announced positive topline ... 1a clinical trial of SYN-004, the Company,s ... of Clostridium difficile (C. difficile) ...
(Date:12/22/2014)... Dec. 22, 2014 GenomeDx Biosciences today announced ... Cancer Classifier, a genomic test for prostate cancer, was ... men managed by radical prostatectomy without adjuvant therapy. Although ... relatively uncommon, using tumor genomics to identify these men ... is an important advance. The study has been ...
(Date:12/22/2014)... 22, 2014 ITRA Global, one of ... of commercial real estate, has further expanded its global ... Perth and Brisbane, Western Australia, reports Mylinda Vick, CCIM, ... ITRA Global / ACORPP (Australian Corporate Property and ... company providing property services to a wide range of ...
(Date:12/19/2014)... Charm Sciences is pleased to announce that ... Aflatoxin M1 in raw commingled milk is the first ... The peer reviewed report of the validation by Technology ... and Fisheries Research (ILVO-T&V) has been published by the ... most toxic aflatoxin and a known carcinogen, can be ...
Breaking Biology Technology:Synthetic Biologics Announces Positive Topline Results from Phase 1a Trial of SYN-004 for the Prevention of C. difficile Infection 2Synthetic Biologics Announces Positive Topline Results from Phase 1a Trial of SYN-004 for the Prevention of C. difficile Infection 3Synthetic Biologics Announces Positive Topline Results from Phase 1a Trial of SYN-004 for the Prevention of C. difficile Infection 4Synthetic Biologics Announces Positive Topline Results from Phase 1a Trial of SYN-004 for the Prevention of C. difficile Infection 5Study Published in European Urology Shows that the Decipher Prostate Cancer Classifier is Predictive of Rapid Metastasis in High-Risk Men who have had Prostate Surgery 2Study Published in European Urology Shows that the Decipher Prostate Cancer Classifier is Predictive of Rapid Metastasis in High-Risk Men who have had Prostate Surgery 3ITRA Global Continues International Expansion in Perth and Brisbane, Australia 2Charm Sciences Achieves Independent Validation of First 15 Minute Quantitative Screening Method for Aflatoxin M1 2
... VILLAGE, Nev., Nov. 23 PDL BioPharma, Inc. (PDL) (Nasdaq: ... 27, 2009 as the ex-dividend date for its $200 million ... on November 2, 2009. The dividend will be paid on ... record date, December 1, 2009. NASDAQ has set the ...
... 23 /PRNewswire/ - Inimex Pharmaceuticals, Inc. announced today that it ... CEO. , Abrams brings more than 25 years of drug ... of the nuclear medicine imaging agent, Cardiolite, and worked from ... Manager, Biomedical Research Worldwide. In 1996, Abrams led the establishment ...
... countries have an opportunity to take the lead in ... Valencia (UV), working together with the IDICHUS Foundation, have ... Their conclusion is that Spain,s food and plant sectors ... Biotechnology as applied to food and plants has been ...
Cached Biology Technology:PDL BioPharma Announces Ex-Dividend Date of November 27 for Special Dividend 2Inimex Announces Appointment of New CEO 2Spanish biotechnology should focus on food and plant sectors to be more competitive 2
(Date:12/10/2014)... 9, 2014     ...   Jifflenow, a ... solutions for business-to-business (B2B) events, today announced a ... mobile near-field communication (NFC), Bluetooth low energy (BLE), ... http://photos.prnewswire.com/prnh/20140612/691055) , Jifflenow will integrate its ...
(Date:12/3/2014)... 2, 2014 As part of our commitment ... is pleased to announce the release of a new ... collect the workforce data that they need. ... left by existing readers. Many such devices have serious ... modern technology. Older models force users to navigate numerous ...
(Date:11/21/2014)... Nov. 20, 2014   Atmel® Corporation (NASDAQ: ... (MCU) and touch technology solutions, today launched the industry,s ... with the widest V cc range from 1.7V ... and faster I 2 C bus communication speeds, and ... memory making them ideal for consumer, industrial, computer, and ...
Breaking Biology News(10 mins):Jifflenow And ITN International Bring Cutting-Edge Badge Scanning Technology To B2B Events 2Jifflenow And ITN International Bring Cutting-Edge Badge Scanning Technology To B2B Events 3Inception Technologies to Release New Biometric Reader 2Atmel Launches Industry's First Wide-V(cc) Low-Power Temperature Sensor Family 2Atmel Launches Industry's First Wide-V(cc) Low-Power Temperature Sensor Family 3Atmel Launches Industry's First Wide-V(cc) Low-Power Temperature Sensor Family 4
... recently presented preliminary research findings that identify a specific ... diseases. Two research studies funded by grants ... the National Institutes of Health (NIH) examined the role ... Type 2 diabetes and other obesity-related cardiovascular diseases. The ...
... Scientists are reporting first use of a new method ... recycle, and reuse nanoparticles, some of which ounce for ... which offers a solution to a nagging problem, could ... cells, flexible electronic displays, and other products, the scientists ...
... Researchers have identified a gene that appears to increase ... common type of Alzheimer,s disease. The research will be presented ... Academy of Neurology,s 62nd Annual Meeting in Toronto, April 10 ... chromosome six. "Only recently have common variants in ...
Cached Biology News:EVMS researchers identify potential target for treatment of obesity-related diseases 2New gene associated with increased risk of Alzheimer's disease 2
Unique enzyme blend containing Taq and Pwo DNA Polymerase and another thermostable enzyme. The Expand 20 kbPLUS PCR System also includes an optimized reaction buffer, MgCl2 solution, and a human cont...
... polyacrylamide gel electrophoresis (2D-PAGE) with biological mass ... technology platform for proteomic analysis. 2D-PAGE gels ... limited only in the dynamic range and ... Quantitative image based analysis of separated proteins ...
... offers precision beveling of micropipette ... The unique abrasive plate drive ... greater control of the beveling ... very rapidly and produces consistent ...
... lightweight, high current power supply capable of producing ... is an excellent choice for PAGE, SDS-PAGE and ... ideal for all types of electroblotting applications.A dual ... end a run and wil automatically accrue elapsed ...
Biology Products: