Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol

Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:11/5/2009)... Brooke Sanders brings a new...ne, CA (PRWEB) November 5, 2009 -- Professional Re... reprographics company is pleased to present Brook... as their graphics/PR specialist. The addition of ...sistent growth within Professional Reprographics.,...
(Date:11/4/2009)..., HUNTSVILLE, Ala., Nov. 4 DIATHE...X.com ), today presented at the Michigan Security...rence in Dearborn, Mich. Dennis Grimaud, Chairman ...d the impact of the company,s advanced molecular d...sponse, infectious disease diagnosis and military ...
(Date:11/4/2009)..., EMERYVILLE, Calif., Nov. 4 /PRNewswire-FirstCal...today announced that it will present at the Credit...sday, November 11, at 9:30 a.m. Mountain Time (8:3...ss a live webcast of the presentation on our websi...nt-Calendar ,, It is recommended that listene...
(Date:11/4/2009)..., QUEBEC CITY, Nov. 4 /PRNewswire-FirstCall/ - Me...focused on developing highly effective and afforda...chnologies and Virus-Like Particles (VLPs), today ...U.S. Department of Health and Human Services (HHS)...ve Workshop (GHSI) on November 5, 2009 at 2:40 pm ...
Breaking Biology Technology:DIATHERIX Laboratories Presents at Homeland Security Conference 2Medicago to present at the U.S. Department of Health and Human Services' Global Health Security Initiative Workshop 2
...ces, Inc. (Nasdaq: CALP ) today announced that i...d on June 2, 2009, at 10:00 a.m. local time at its...achusetts. The record date for Caliper stockholde...009. , , About Caliper Life Sciences , Cali...-edge technologies enabling researchers in the lif...
..., Pepscan reports,that it has achieved a major sci...based synthetic peptide immunogen technology. By c...ing-site on CXCR7 it has induced functional,antibo...CXCR7. CXCR7 is novel,therapeutic target thought t... proud and confident with achieving this major bre...
...Demonstrated at HIMSS 2009 , , BERKELEY HEIGHTS, ...q: ADAT ), a worldwide provider of secure Health...ices, today announced that it has integrated Authe...tient Discharge Solution (PDS) to improve hospital...to automate and accelerate the patient discharge a...
Other Biology Technology:Pepscan Achieves a Breakthrough With CLIPS Immunogen Technology: Synthetic Peptide Antigen is Able to Induce Fully Functional Antibodies Against a Formerly Intractable GPCR Target CXCR7 2Authentidate Teams with Nortel to Enhance Hospital Patient Discharge and Placement Processes 2Authentidate Teams with Nortel to Enhance Hospital Patient Discharge and Placement Processes 3Authentidate Teams with Nortel to Enhance Hospital Patient Discharge and Placement Processes 4
(Date:11/5/2009)...y Teachers (NABT) will recognize Leonard C. Yannie... Valley Community College (NVCC) in Waterbury, Con...during the NABT annual professional development co... Colorado. , The Evolution Education Award is co...Sciences,(AIBS) and Biological Sciences Curriculu...
(Date:11/4/2009)...ence) , United States Using Less Water Today ...t did 35 years ago, despite a 30 percent populatio...butable to alternative cooling methods at power pl...ing to the latest USGS water use report, nearly ha...cooling thermoelectric power plants. Irrigation ac...
(Date:11/4/2009)...phered the DNA codes, or genomes, of the famed fug...he Genome 10K Project, an international effort to ... 10,000 species of animals for conducting comparat...chieved. , Participating in The Genome 10K proje...2009 issue of the Journal of Heredity , are 70 le...
Breaking Biology News(10 mins):Biologists, educators recognize excellence in evolution education 2USGS science picks 2USGS science picks 3USGS science picks 4USGS science picks 5USGS science picks 6USGS science picks 7Singapore scientists join international study of 10,000 vertebrates' genomes 2Conceptual Options a Center for Surrogacy 26amp 3B Egg Donation Announces Third Party Assurance Program 47863 1Conceptual Options a Center for Surrogacy 26amp 3B Egg Donation Announces Third Party Assurance Program 47863 2Conceptual Options a Center for Surrogacy 26amp 3B Egg Donation Announces Third Party Assurance Program 47863 3Illness medical bills linked to nearly two thirds of bankruptcies 47858 1Illness medical bills linked to nearly two thirds of bankruptcies 47858 2Illness medical bills linked to nearly two thirds of bankruptcies 47858 3Kornberg Associates Architects Selected to Design Research Areas of Malaysia Genome Institute 12458 1Kornberg Associates Architects Selected to Design Research Areas of Malaysia Genome Institute 12458 2
...nine following a heart attack does not improve cer... associated with an increased risk of death, accor...L-arginine is a widely available dietary supplemen...s with hypertension, angina, heart failure and sex...on in the article. Prior studies suggest that L-ar...
...ergy,s Brookhaven National Laboratory have develop...g the many species of microorganisms living in an ...ed in the March 2006 issue of Applied Environmenta...ssing the microbes present in environmental sample...ontamination to identifying pathogens and distingu...
...nine following a heart attack does not improve cer... associated with an increased risk of death, accor...L-arginine is a widely available dietary supplemen...s with hypertension, angina, heart failure and sex...on in the article. Prior studies suggest that L-ar...
Other Biology News:Little known DNA repair enzyme may be a tumor suppressor gene 2New method for identifying microbes 2Use of amino acid supplement following a heart attack provides no benefit, may be harmful 2
...Protein DetectorTM Microarray Dot Blot Kits overco...uracy and quantitation over a wide range in low-de...tection. They are ideal for performing reverse-ph...amples for the presence of low abundant antigens. ...
...Convenient, easy-to-use kits for arraying proteins...tion using common lab equipment. DiscoverLight Pro...ur protein, cell lysate or antibody in a low-densi...ed nitrocellulose membranes with a 384-grid templa...
Conjugate Stabilizing Diluent Alkaline Phosphatase from Meridian Life Science, Inc.
...StabilZyme AP Conjugate Stabilizer is an aqueous s...d other non-toxic stabilizing chemicals in a MES b...6.5. This product contains a combination of 0.02%...s a preservative. StabilZyme AP Conjugate Stabili...
Biology Products: