Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:12/15/2009)... 15 AstraZeneca (NYSE: ... (UVa) in Charlottesville, today announced that they ... to enhance development of new treatments primarily ... secondary focus on peripheral vascular disease (PAD). ... The collaborative preclinical research projects will focus ...
(Date:12/15/2009)... BRIARCLIFF MANOR, N.Y., Dec. 15 On ... the International Society for Medical Publication Professionals (ISMPP) ... Physicians in London, UK. More than 100 attendees ... new forum for publication professionals, editors, publishers, medical ... world of medical publications and the impact of ...
(Date:12/14/2009)... Dec. 14 Vermillion, Inc. (Pink ... announced William C. Wallen, Ph.D. Chief Scientific ... for IDEXX Laboratories, will be joining its ... bankruptcy plan. ,, "Bill brings more ... in diagnostics and biotechnology," said Gail Page, ...
(Date:12/14/2009)... Lionbridge (Nasdaq: LIOX ) ... new, three-year master services agreement with a ... services that serve patients in approximately 100 ... the sole provider for translation of the ... training, human resources, legal, and corporate communications ...
Breaking Biology Technology:AstraZeneca and the University of Virginia Sign Strategic Research Collaboration to Develop Novel Treatments for Cardiovascular Disease 2AstraZeneca and the University of Virginia Sign Strategic Research Collaboration to Develop Novel Treatments for Cardiovascular Disease 3Announcing ISMPP EU 2010 - the First European Meeting of the International Society for Medical Publication Professionals, Royal College of Physicians, London, UK, January 20, 2010 2Vermillion Announces Appointment of William C. Wallen, Ph.D. to Board of Directors 2Vermillion Announces Appointment of William C. Wallen, Ph.D. to Board of Directors 3Vermillion Announces Appointment of William C. Wallen, Ph.D. to Board of Directors 4Multi-Billion Dollar Biotech Firm Chooses Lionbridge as Exclusive Translation Provider with Three-Year Master Services Agreement 2Multi-Billion Dollar Biotech Firm Chooses Lionbridge as Exclusive Translation Provider with Three-Year Master Services Agreement 3
... Cardium Therapeutics,(Amex: CXM ) and its ... has entered into a exclusive commercialization agreement ... of medical products.,N.G.C. Medical primarily sells medical ... cardiology markets. They also provide,in-service management of ...
... Sunesis,Pharmaceuticals, Inc. (Nasdaq: SNSS ) today announced that ... will,provide a corporate update at the upcoming Jefferies 2nd ... 26, 2008 at the Mandarin,Oriental in New York, NY., ... presentation by visiting,the Sunesis website at http://ir.sunesis.com . ...
... grow at CAGRs of nearly, 60% and 20%, respectively, through 2012, according ... ... WALTHAM, Mass., June 19 According to Millennium,Research Group,s Japanese Markets ... increase at a compound annual,growth rate (CAGR) of nearly 60% through 2012 ...
Other Biology Technology:Cardium's InnerCool Therapies Unit Announces Italian Commercialization Agreement for Portfolio of Temperature Modulation Systems 2Cardium's InnerCool Therapies Unit Announces Italian Commercialization Agreement for Portfolio of Temperature Modulation Systems 3Cardium's InnerCool Therapies Unit Announces Italian Commercialization Agreement for Portfolio of Temperature Modulation Systems 4Cardium's InnerCool Therapies Unit Announces Italian Commercialization Agreement for Portfolio of Temperature Modulation Systems 5Cardium's InnerCool Therapies Unit Announces Italian Commercialization Agreement for Portfolio of Temperature Modulation Systems 6Aortic Stent Grafts Will Boost Canadian and Japanese Peripheral Vascular Markets 2
(Date:12/14/2009)... a defining feature of humans. That,s until examples of tool ... an array of other mammals. Now, a report in the ... Press publication, adds an octopus to the growing list of ... behavioral trick that the researchers call stilt walking. In it, ... "bowls," makes its eight arms rigid, and raises the whole ...
(Date:12/13/2009)... may help to engineer plants that take advantage of ... finding could help to engineer crops that take advantage ... carbon dioxide they need for photosynthesis through microscopic breathing ... molecule of the gas gained, they lose hundreds of ... tighten to save water when CO 2 is ...
(Date:12/13/2009)... CADecember 10, 2009Researchers at The Scripps Research Institute ... single protein from an ancient family of enzymes ... body. In addition to providing guidance for understanding ... a theoretical underpinning for the protein,s possible use ... , The research was published in the December ...
Breaking Biology News(10 mins):Tool use in an invertebrate: The coconut-carrying octopus 2Newly identified enzymes help plants sense elevated CO2 and could lead to water-wise crops 2Newly identified enzymes help plants sense elevated CO2 and could lead to water-wise crops 3Scripps Research scientists crack mystery of protein's dual function 2Scripps Research scientists crack mystery of protein's dual function 3SAFC Supply Solutions 28R 29 Announces Raw Materials Line Developed Specifically to Meet Molecular Diagnostics Manufacturing Requirements 13111 1SAFC Supply Solutions 28R 29 Announces Raw Materials Line Developed Specifically to Meet Molecular Diagnostics Manufacturing Requirements 13111 2SAFC Supply Solutions 28R 29 Announces Raw Materials Line Developed Specifically to Meet Molecular Diagnostics Manufacturing Requirements 13111 3Mylan Receives FDA Approval for Additional Strengths of the Antipsychotic Haloperidol 52172 1Can the relationship between doctors and drug companies ever be a healthy one 3F 52168 1Can the relationship between doctors and drug companies ever be a healthy one 3F 52168 2
... common antipsychotic drug used in emergency rooms to treat ... the brain known to regulate movement, a new study ... indicate that only the combination of the medication, haloperidol, ... alone. Senior author Bryan Yamamoto, PhD, and his team ...
... watershed decision to propose listing the polar bear as ... Society (WCS) is launching a bold initiative to save ... bears themselves, but the receding sea ice habitat that ... In a project named "Warm Waters for Cool Bears," ...
... meaning to watching out for other mothers' kids. , ... by the University of Alberta in Edmonton, Canada and the ... responded to the recorded distress calls of fawns, similar to ... mothers responding to both whitetail and mule deer calls, even ...
Other Biology News:Common treatment for methamphetamine overdose may damage brain cells 2Want to save polar bears? Follow the ice 2Want to save polar bears? Follow the ice 3Mule deer moms rescue other fawns 2
Human ULBP-3 MAb (Clone 166514)...
Homo sapiens CDC23 (cell division cycle 23, yeast, homolog),...
Homo sapiens postsynaptic protein CRIPT Antigen: Recombinant Protein...
Immunogen: Synthetic Peptide: V(22) N G H E F E I E G E G E G R(36) Storage: -20 C, Avoid Freeze/Thaw Cycles...
Biology Products: