( ents). Materials and methods...)HotMasterAn innovative Hot Start/Cold Stop technology for better ,,, PCR* results

ents).

Materials and methods

All PCR reactions were performed in triplicate on the Eppendorf Mastercycler gradient using human genomic DNA or Phage Lambda DNA (New England BioLabs, USA) as indicated. The reaction components are:

1x PCR buffer
2.5 mM Mg⁺⁺
0.2 M of each primer
0.2 mM dNTP's
1.25 units respective Taq polymerase
MBGW to 50 l total reaction volume
(Templates are indicated in each experiment)

Note that we have determined empirically that the optimal temperature for the elongation step using HotMaster is 65C.

Experiment 1: Specificity

A 131 bp target in the human TNF gene was amplified using Eppendorf HotMaster Taq DNA polymerase, a conventional chemically modified Hot Start DNA polymerase, an antibody- mediated Hot Start DNA polymerase and standard Taq DNA polymerase. The following reaction conditions were used:

Primers and Template:

Primers 131 bp TNF system

Forward Primer: GGTTTCGAAGTGGTGGTCTTG
Reverse Primer: CCTGCCCCAATCCCTTTATT
Template: 50 ng human gDNA

HotMaster Taq and Standard Taq cycling conditions: Initial Denaturation: None 35 cycles: 94C for 1 second
55C for 1 second
72C for 5 seconds Hold: 10C Chemically blocked Taq cycling conditions: Initial Denaturation: 95C for 10 minutes 35 cycles: 94C for 1 second
55C for 1 second '"/>

Source:


Page: All 1 2 3 4 5 6 7
Related biology technology :

1. Amplification of genome-representative DNA from limited sources with GenomePlex WGA technology for use in genetic alterations studies