Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:12/16/2009)... by scientists at the University of East Anglia (UEA) ... domestic or agricultural waste to generate clean electricity. , ... of the National Academy of Sciences (PNAS), the ... by which some bacteria survive by ,breathing rocks,. , ... development of new microbe-based technologies such as fuel cells, ...
(Date:12/16/2009)... 16 WaferGen Biosystems, Inc. (OTC Bulletin ... analysis systems, today announced that it will be ... service for gene-expression profiling using its SmartChip(TM) Real-Time ... the most comprehensive human microRNA panel of 885 ... SmartChip service offers customers the use of its ...
(Date:12/16/2009)... 16 Decision Resources, one of the ... and healthcare issues, finds that, according to responses ... Abbott,s briakinumab (both interleukin inhibitors) will capture 22 ... the drug market for moderate to severe psoriasis. ... uptake, capturing nearly three times as much patient ...
(Date:12/16/2009)... Eppendorf has initiated an,import ban ... systems for,infringement of European patent EP 1 ... and/or the quantification of a target compound". ... of the respective products into any country ... to confiscate any,violating products. , ...
Breaking Biology Technology:'Rock-breathing' bacteria could generate electricity and clean up oil spills 2WaferGen to Launch Human MicroRNA Panel for Gene-Expression Profiling of 885 MicroRNA for Its Service Using the SmartChip(TM) Real-Time PCR System 2WaferGen to Launch Human MicroRNA Panel for Gene-Expression Profiling of 885 MicroRNA for Its Service Using the SmartChip(TM) Real-Time PCR System 3WaferGen to Launch Human MicroRNA Panel for Gene-Expression Profiling of 885 MicroRNA for Its Service Using the SmartChip(TM) Real-Time PCR System 4In 2012, Stelara and Briakinumab Will Capture 22 Percent of the Biologics Share in the Moderate to Severe Psoriasis Drug Market 2In 2012, Stelara and Briakinumab Will Capture 22 Percent of the Biologics Share in the Moderate to Severe Psoriasis Drug Market 3Eppendorf Successfully Initiates Import ban Against Nanosphere, Inc. for the Countries of the European Union 2
... ARBOR, Mich., April 16 Lycera Corp. today announced ... company, which is developing novel small-molecule pharmaceuticals to treat ... disease, has received $10 million as a first tranche ... the proceeds in two tranches as specific milestones are ...
... Implanted through the Smallest Micro-Incision using nanoPOINT(TM)Pricing of ... PracticesMONROVIA, Calif., April 16 STAAR Surgical Company ... manufacturer and marketer of minimally invasive ophthalmic products, ... Aspheric Single Piece New Technology Intraocular Lens (NTIOL). ...
... company Solidus Bioscience Inc have successfully implemented Amphora,s ... Solidus are using PatentSafe as a fully electronic ... this fit more efficiently into today,s laboratories but ... their data simply and effectively, saving significant time ...
Other Biology Technology:Lycera Closes $36 Million Series A Financing 2Lycera Closes $36 Million Series A Financing 3Lycera Closes $36 Million Series A Financing 4STAAR Surgical Releases Afinity(TM) Collamer(R) Aspheric Single Piece NTIOL 2STAAR Surgical Releases Afinity(TM) Collamer(R) Aspheric Single Piece NTIOL 3STAAR Surgical Releases Afinity(TM) Collamer(R) Aspheric Single Piece NTIOL 4STAAR Surgical Releases Afinity(TM) Collamer(R) Aspheric Single Piece NTIOL 5Solidus Bioscience Protect their Research and Improve Efficiency With Amphora's PatentSafe Solution 2Solidus Bioscience Protect their Research and Improve Efficiency With Amphora's PatentSafe Solution 3
(Date:12/16/2009)... Society has announced the winners of its student travel ... at the Moscone Convention Center in San Francisco, California, ... are selected based on scientific merit, with priority given ... conference. Each awardee receives a travel grant and ... 20. , The 2010 recipients of the Student Travel ...
(Date:12/16/2009)... a high priority for grape growers in the southern Napa Valley, ... irrigated to make it through the growing season. But Stanford researchers ... the vines zips right by the plants, hardly even pausing. ... is applied is lost below the vine rooting zone and does ... Hinckley, who worked on the project for her PhD thesis in ...
(Date:12/16/2009)... form an intricate network of interactions. Today,s techniques, ... molecular reactions outside the cells. Since molecular concentrations ... laboratory, scientists suspect that the kinetics of molecular ... probes. We expected the cellular reaction speed to ... "However, our novel optical approach showed that ...
Breaking Biology News(10 mins):Biophysical Society announces winners of 2010 Student Travel Awards 2Biophysical Society announces winners of 2010 Student Travel Awards 3Biophysical Society announces winners of 2010 Student Travel Awards 4Lost water of the Napa Valley vineyards 2Lost water of the Napa Valley vineyards 3Lost water of the Napa Valley vineyards 4Looking for the heartbeat of cellular networks 2Survey Results Show Long Term Care Providers Wary about Healthcare Reform 48652 1Survey Results Show Long Term Care Providers Wary about Healthcare Reform 48652 2Survey Results Show Long Term Care Providers Wary about Healthcare Reform 48652 3Study shows promise for new cancer stopping therapy 48649 1Study shows promise for new cancer stopping therapy 48649 2Study finds segregation decreases access to surgical care for minorities 48646 1Study finds segregation decreases access to surgical care for minorities 48646 2
... bones, the skeletons of organisms contain small amounts of ... these elements provide important clues to past environments, a ... impurity contents to the ancient environments in which an ... of Science magazine, Allison Stephenson, a Ph.D. ...
... bacteria in the root of a tropical grass whose ... industries. These bacteria seem to promote the production of ... of the oil, giving it different flavours and properties: ... of the tropical Vetiver grass through interdisciplinary research, the ...
... Helmholtz-Zentrum fr Infektionsforschung (HZI) in Braunschweig, Germany have ... pathways in bacteria and their use. Using computer ... headed up by Vtor Martins dos Santos, calculated ... the production of biosynthetics in the Pseudomonas ...
Other Biology News:Bare bones of crystal growth: Biomolecules enhance metal contents in calcite 2Bacteria manage perfume oil production from grass 2Biosynthetics production with detours 2
...
...
... The Corning CellBIND surface is produced by ... more hydrophilic surface giving more consistent, even ... CellBIND enhances cell attachment and growth uunder ... medium. • CellBIND may provide a more ...
... of microplate readers combines reagent dispensing with ... affordable, easy-to-use platform for the complete range ... design and adaptability of the Infinite 200 ... a monochromator (M200) or filter (F200) system ...
Biology Products: