Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)

Post Your Comments:
(Date:11/5/2009)...PPANY, N.J., Nov. 5 DSM Pharmaceut...anufacturing alliance with Galenix, Saint Jean D,I...ercial scale manufacturing partner for Galenix com...Galenix will collaborate on business development o...chnologies, based on the strength of Galenix in dr...
(Date:11/5/2009)...rence Call on Thursday, November 5, 2009 at 4:30 p...Nov. 5 /PRNewswire-FirstCall/ - OncoGenex Pharmace...AQ: OGXI ) today reported unaudited financial res...eptember 30, 2009 and reviewed the Company,s highl...lowing consolidated results reflect the operations...
(Date:11/5/2009)...VALE, Calif., Nov. 5 Cep...cutives will be speaking at the following investor... via webcast. , , Credit Suisse He...Thursday, 12 November, 2009 at 10 a.m. Mountain Ti...ram, London, England, Tuesday, 1 D...
(Date:11/5/2009)...NT, Calif., Nov. 5 Wafer... leading developer of state-of-the-art genetic ana...ars, Ph.D. has joined the company,s Scientific Adv...ning and commercializing novel molecular diagnosti...d on the development of computational biology syst...
Breaking Biology Technology:DSM Pharmaceutical Products Forms Manufacturing Alliance With Galenix 2DSM Pharmaceutical Products Forms Manufacturing Alliance With Galenix 3OncoGenex Reports Third Quarter 2009 Financial Results 2OncoGenex Reports Third Quarter 2009 Financial Results 3OncoGenex Reports Third Quarter 2009 Financial Results 4OncoGenex Reports Third Quarter 2009 Financial Results 5OncoGenex Reports Third Quarter 2009 Financial Results 6OncoGenex Reports Third Quarter 2009 Financial Results 7OncoGenex Reports Third Quarter 2009 Financial Results 8Cepheid to Webcast Upcoming Financial Presentations 2WaferGen Names Christopher Sears, Ph.D., Architect of High-Value Molecular Diagnostics and Computational Biology Platforms, to Company's Scientific Advisory Board 2WaferGen Names Christopher Sears, Ph.D., Architect of High-Value Molecular Diagnostics and Computational Biology Platforms, to Company's Scientific Advisory Board 3WaferGen Names Christopher Sears, Ph.D., Architect of High-Value Molecular Diagnostics and Computational Biology Platforms, to Company's Scientific Advisory Board 4
...DNOR, Pa., Dec. 11 The following statement was i...ler Meltzer & Check, LLP: , , Notice is h...in the United States District Court for the Southe... the securities of Elan Corporation, plc (NYSE: ...07 and October 21, 2008, inclusive (the "Class Per...
... Biotech Trait Should Lead...ian Farmers , Brasilia, B... Pioneer Hi-Bred and Dow AgroSciences LLC , a w..., today announced that they have received regulato...ission on Biosafety, CTNBio, for cultivation of th...
...NSING, Mich., Dec. 11 Neogen Corporation,(Nasdaq:...ors has initiated a new,share repurchase program t...ommon stock. In a joint move, the Board rescinded ...ed in 1999. , The shares will be repurchased... depending on market conditions and other factors....
Other Biology Technology:Shareholder Class Action Filed Against Elan Corporation, plc by the Law Firm of Barroway Topaz Kessler Meltzer & Check, LLP 2Herculex Receives Regulatory Approval in Brazil 2Herculex Receives Regulatory Approval in Brazil 3Neogen Announces New Share Repurchase Program 2
(Date:11/4/2009)... 20 DigitalPersona, Inc., a leader...ons, today announced that WAND Corporation, a lead...uick-service restaurants, has integrated DigitalPe...c POS solutions. WAND,s quick-service customers ca...accountability and deter unauthorized manager over...
(Date:11/4/2009)...ire/ -- Global Rainmakers, Inc., an intellectual p...atory, today announced that the company has exited...mmercialize its suite of technologies designed to .... ,, During the past four years, the company ha... deploy a series of core--but expandable--technolo...
(Date:11/3/2009)...4, 2009) For more than 25 years, all attempts at ...igas ) have been unsuccessfuluntil now. For the fi... to produce beaded (nucleated) and non-beaded cult...ed by scientists from Florida Atlantic University,...th less than two years of research and experimenta...
Breaking Biology News(10 mins):WAND Point-of-Sale Solutions Integrate U.are.U(R) Fingerprint Biometrics From DigitalPersona for Quick-Service Restaurants 2WAND Point-of-Sale Solutions Integrate U.are.U(R) Fingerprint Biometrics From DigitalPersona for Quick-Service Restaurants 3Global Rainmakers Brings Cutting-Edge Biometric Security Products to Reality 2Global Rainmakers Brings Cutting-Edge Biometric Security Products to Reality 3Scientists are first to 'unlock' the mystery of creating cultured pearls from the queen conch 2Scientists are first to 'unlock' the mystery of creating cultured pearls from the queen conch 3Premier Research Names Bernard Sweeney as Executive Director Medical Devices 5602 1Premier Research Names Bernard Sweeney as Executive Director Medical Devices 5602 2ISTA Pharmaceuticals to Present at 2009 BIOCOM Investor Conference 5600 1The Brain Comes Alive With the Sounds of Music 59818 1The Brain Comes Alive With the Sounds of Music 59818 2
...rs ago, a massive swarm of locusts took off from t...e across the Atlantic Ocean to colonize the New Wo...Using genetic evidence from more than 20 species o...onto, Arizona, Maryland, Cornell University and th...ong-standing conundrum: why are the closest relati...
...eloped a novel, three-dimensional model that allow...icroenvironment of metastatic melanoma cells induc...ve cancer cells that migrate and spread throughout...endrix and colleagues at Children,s Memorial Resea...en matrix preconditioned by malignant melanoma cel...
...theoryBiologists examining evidence for the claim ...e surprising new conclusions. However, they cautio...eing resolved." Their analysis is published online...blished by John Wiley & Sons, Inc. and availab....com/journal/morphology ). , Dinosaurs have long c...
Other Biology News:Ancient trans-Atlantic swarm brought locusts to the New World 2Model identifies genes that induce normal skin cells to become abnormal 2Did feathered dinosaurs exist? 2Did feathered dinosaurs exist? 3
Rabbit Anti-Human PVRL2 Polyclonal Antibody, Unconjugated from Proteintech Group, Inc.
Rabbit Anti-CREB-2 (H-290) Polyclonal Antibody, Unconjugated from Santa Cruz Biotechnology, Inc.
Mouse Anti-Dynamin Monoclonal Antibody, Unconjugated, Clone D5 from MBL International
Mouse Anti-Mouse BKBeta2 potassium channel Monoclonal Antibody, Unconjugated, Clone N53/32 from UC Davis/NINDS/NIMH NeuroMab Facility
Biology Products: