Navigation Links
cMaster RTplusPCR System for increased sensitivity and product length ,,, in RT-PCR




Three step cycling program used for hTSF and Dynein



Target size, elongation time and annealing temperatures used



Primers used

Tubulin forward: CACCCGTCTTCAGGGCTTCTTGGTTT
Tubulin reverse: CATTTCACCATCTGGTTGGCTGGCTC
TNFR forward: CCACCATCTCGGTCATCAGGATTGCCT
TNFR reverse: TTCTCATGGAAGCTATGGGTATCACAT
hTSF forward: GGAGTTTATCATCACCGCGGAAATACTGAGAG
hTSF reverse: TATTTCACTGACAGGCAATACCGTCCAAGG
Dynein forward: CGGCGCTGGAGGAGAA
Dynein reverse: AGGTGGTGGCTCAAACACAAAG

Results

Experiment 1: Sensitivity of One Step RT-PCR


Fig. 1: One Step RT-PCR amplification of an
Alpha Tubulin cDNA fragment from various
amounts of total RNA.
Lane 1: 1 g
Lane 2: 100 ng
Lane 3: 10 ng
Lane 4: 1 ng
Lane 5: 100 pg
Lane 6: 10 pg
M: 100 bp ladder (NEB)

The cMaster RTplusPCR System shows a high dynamic range of product yield depending on the amount of template RNA. Alpha Tubulin mRNA can be detected in HELA RNA down to 10 pg of total RNA.

Experiment 2: Long range One Step RT-PCR with various amounts of total RNA



Fig. 2: Long range One Step RT-PCR of the human
Tuberous Sclerosis Factor mRNA.
M: DNA Ruler LadderMix 0.110 kb (MBI Fermentas).
Lane 1: 100 ng total RNA
Lane 2: 10 ng total RNA
Lane 3: 0 ng total RNA (negative control)

As shown in Fig. 2, a 5.3 kb hTSF PCR product is de
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Single-cell RT-PCR Analysis of Paramecium Primaurelia with the Eppendorf cMaster RTplusPCR System
2. New Mammalian Two-Hybrid System Detects Protein-Protein Interactions
3. Assess the In Vivo Activation of Signal Transduction Pathways with PathDetect Reporting Systems
4. Generate Adenovirus Vectors in E. coli by Homologous Recombination with the AdEasy Adenoviral Vector System
5. New Yeast Cloning System for Producing Proteins with Native Amino Acid Sequences
6. Enhanced PCR Cloning System
7. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
8. Performance Comparisons of Commercial RT-PCR Systems
9. Signal Transduction Reporting Systems Using Cis-Acting Enhancer Elements
10. Yeast Protein Production System Features High Yields and One-Step Purification
11. Detect Released Oligosaccharides Using the Eagle Eye II Still Video Imaging System
Post Your Comments:
(Date:9/22/2014)... by researchers at the USC Viterbi School of ... 3-D microfluidic system quickly and cheaply by simply ... Microfluidic systems are used in many fields including ... volumes of fluids for use in applications such ... diagnostic testing, and synthetic chemistry. Traditionally, microfluidic devices ...
(Date:9/22/2014)... University of Manchester have generated a new star-shaped molecule made ... its kind ever created. , Known as a ... one for over a quarter of a century and the ... . , Consisting of two molecular triangles, entwined about ... molecules are tiny each triangle is 114 atoms in ...
(Date:9/22/2014)... September 22, 2014 Lawrence Livermore ... John DeGioia on Friday renewed their institutional commitment ... additional five years to expand the collaborative work ... and global climate, energy and environmental sciences. , ... MOU originally signed in December 2009 and is ...
(Date:9/22/2014)... NY (PRWEB) September 22, 2014 Topical ... helping those in pain end their suffering, restoring hope ... healthcare model. This is only possible because of the ... and healing cream technology a reality. , The ... Rhinebeck, NY, by Lou Paradise (president, chief of research, ...
Breaking Biology Technology:Lego-like modular components make building 3-D 'labs-on-a-chip' a snap 2Lego-like modular components make building 3-D 'labs-on-a-chip' a snap 3Lego-like modular components make building 3-D 'labs-on-a-chip' a snap 4Lego-like modular components make building 3-D 'labs-on-a-chip' a snap 5Lawrence Livermore Renews Pact with Georgetown University to Expand Research and Education in Science and Policy 2Topical BioMedics (Topricin) Celebrates 20 Years of Providing Hope and Quality of Life...As Topricin Is Declared “The 21st Century Standard of Care for Pain Management” 2Topical BioMedics (Topricin) Celebrates 20 Years of Providing Hope and Quality of Life...As Topricin Is Declared “The 21st Century Standard of Care for Pain Management” 3Topical BioMedics (Topricin) Celebrates 20 Years of Providing Hope and Quality of Life...As Topricin Is Declared “The 21st Century Standard of Care for Pain Management” 4Topical BioMedics (Topricin) Celebrates 20 Years of Providing Hope and Quality of Life...As Topricin Is Declared “The 21st Century Standard of Care for Pain Management” 5Topical BioMedics (Topricin) Celebrates 20 Years of Providing Hope and Quality of Life...As Topricin Is Declared “The 21st Century Standard of Care for Pain Management” 6
... produced in barley grain, using renewable,geothermal energy, ... Genetics,( http://www.orfgenetics.com ), an Icelandic biotechnology company, ... 22,000 ft^2 (2043m^2),cultivation facilities in Grindavik, Iceland. ... barley, ORF Genetics produces and,markets biorisk-free ISOkine(TM) ...
... Stock Exchange Symbol: MS, EDMONTON, May 13 /PRNewswire-FirstCall/ - ... of multiple sclerosis (MS), today,announced that Dr. Mark Krantz, Vice ... Oligonucleotide and Peptide,Technology and Product Development Conference in Las Vegas., ... at 10:45 am (PDT), WHERE: Red ...
... Pharmaceuticals Founder and Senior Management Form Company ... Specializing in Dermatology and Podiatry Markets, FAIRFIELD, N.J., ... commenced operations. The newly-formed,Company, led by the founder and ... (NYSE: BDY ), will develop, license and,commercialize innovative ...
Cached Biology Technology:ORF Genetics Opens Revolutionary 'Green Factory' in Iceland 2BioMs Medical to present at TIDES(R) Conference 2Medimetriks Pharmaceuticals, Inc. Begins Operations 2
(Date:9/21/2014)... developed a protein therapy that disrupts the process that ... sites, travel through the blood stream and start aggressive ... known as metastasis, can cause cancer to spread with ... succumb to cancer fall prey to metastatic forms of ... bioengineering who describes a new therapeutic approach in ...
(Date:9/19/2014)... study the unique bioelectric signaling system of the electric ... The OU researcher is working to understand how ... signals used to map the world around them. ... 500-600 discharges a second throughout their lives. The ... but necessary for survival. , "There is evidence that ...
(Date:9/19/2014)... species which over thousands of years has adapted to the ... that makes the cold dangerous for you. , This is ... and the cold provoking substance, called nonylphenol, comes from the ... suspected of being a endocrine disruptor, but when entering the ... ability to protect the cells in its body from cold ...
Breaking Biology News(10 mins):Stanford researchers create 'evolved' protein that may stop cancer from spreading 2Stanford researchers create 'evolved' protein that may stop cancer from spreading 3Stanford researchers create 'evolved' protein that may stop cancer from spreading 4Environmental pollutants make worms susceptible to cold 2Environmental pollutants make worms susceptible to cold 3
... the first time, traced the nanoparticles taken up from ... states of their metallic elements. Zinc was shown to ... cerium did not dissolve into plant tissue. The results ... nanoparticles and whether engineered nanoparticles can enter into the ...
... JOLLA, CA----You might think you have nothing in common ... a plant from the mustard family, Salk scientists have ... directly regulate chemical reactions that quickly adjust the growth ... different body parts coordinate their growth, shedding light on ...
... the performance of technologies ranging from medical CT scanners ... extract specific information from huge collections of data and ... new approach is called model-based iterative reconstruction, or MBIR. ... and error, assessing probability and discarding extraneous information," said ...
Cached Biology News:X-rays reveal uptake of nanoparticles by soya bean crops 2X-rays reveal uptake of nanoparticles by soya bean crops 3Plants cut the mustard for basic discoveries in metabolism 2Plants cut the mustard for basic discoveries in metabolism 3New modeling approach transforms imaging technologies 2New modeling approach transforms imaging technologies 3New modeling approach transforms imaging technologies 4
... cDNA Library Panels were designed for full-length ... of PCRs to identify the desired cDNA ... in a 96-well "Master Plate," where each ... Having identified the positive well(s) by gel ...
... Analysis Note: Evaluated for its amino acid ... of amino acids Ala, Asp, Gly, Ile, Lys, ... Ser, Tyr. Preparation Unit Definition: One unit will ... 1.0 ml of water (1 cm light path). ...
... use as a carrier in ... Physical form: Solution in 10 ... 1 mM EDTA Preparation Note: ... Concentration: 10 mg/mL ...
... Cleland’s Reagent, Immobilized White solid. ... form of DTT on polyacrylamide resin with applications ... 233153 , 233156 , and ... no soluble components are added to the system. ...
Biology Products: