Navigation Links
cMaster RTplusPCR System for increased sensitivity and product length ,,, in RT-PCR




Three step cycling program used for hTSF and Dynein



Target size, elongation time and annealing temperatures used



Primers used

Tubulin forward: CACCCGTCTTCAGGGCTTCTTGGTTT
Tubulin reverse: CATTTCACCATCTGGTTGGCTGGCTC
TNFR forward: CCACCATCTCGGTCATCAGGATTGCCT
TNFR reverse: TTCTCATGGAAGCTATGGGTATCACAT
hTSF forward: GGAGTTTATCATCACCGCGGAAATACTGAGAG
hTSF reverse: TATTTCACTGACAGGCAATACCGTCCAAGG
Dynein forward: CGGCGCTGGAGGAGAA
Dynein reverse: AGGTGGTGGCTCAAACACAAAG

Results

Experiment 1: Sensitivity of One Step RT-PCR


Fig. 1: One Step RT-PCR amplification of an
Alpha Tubulin cDNA fragment from various
amounts of total RNA.
Lane 1: 1 g
Lane 2: 100 ng
Lane 3: 10 ng
Lane 4: 1 ng
Lane 5: 100 pg
Lane 6: 10 pg
M: 100 bp ladder (NEB)

The cMaster RTplusPCR System shows a high dynamic range of product yield depending on the amount of template RNA. Alpha Tubulin mRNA can be detected in HELA RNA down to 10 pg of total RNA.

Experiment 2: Long range One Step RT-PCR with various amounts of total RNA



Fig. 2: Long range One Step RT-PCR of the human
Tuberous Sclerosis Factor mRNA.
M: DNA Ruler LadderMix 0.110 kb (MBI Fermentas).
Lane 1: 100 ng total RNA
Lane 2: 10 ng total RNA
Lane 3: 0 ng total RNA (negative control)

As shown in Fig. 2, a 5.3 kb hTSF PCR product is de
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Single-cell RT-PCR Analysis of Paramecium Primaurelia with the Eppendorf cMaster RTplusPCR System
2. New Mammalian Two-Hybrid System Detects Protein-Protein Interactions
3. Assess the In Vivo Activation of Signal Transduction Pathways with PathDetect Reporting Systems
4. Generate Adenovirus Vectors in E. coli by Homologous Recombination with the AdEasy Adenoviral Vector System
5. New Yeast Cloning System for Producing Proteins with Native Amino Acid Sequences
6. Enhanced PCR Cloning System
7. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
8. Performance Comparisons of Commercial RT-PCR Systems
9. Signal Transduction Reporting Systems Using Cis-Acting Enhancer Elements
10. Yeast Protein Production System Features High Yields and One-Step Purification
11. Detect Released Oligosaccharides Using the Eagle Eye II Still Video Imaging System
Post Your Comments:
(Date:10/19/2014)... October 19, 2014 The Asia-Pacific Speech ... market in Asia-Pacific with analysis and forecast of revenue. ... in 2014 to $208 million by 2019, at a ... to 2019. , Browse through the TOC of the ... of the in-depth analysis provided. It also provides a ...
(Date:10/18/2014)... The “Human Insulin Market- by ... Premixed), Modern Human Insulin (Rapid Acting, Long Acting, ... Tresiba, Others) - Forecast to 2018” provides a ... opportunities, current market trends, and strategies impacting the ... and forecasts of the revenue and share analysis. ...
(Date:10/18/2014)... October 18, 2014 The Asia-Pacific Liquid ... segments the concerned market in Asia-Pacific with analysis and ... million in 2013, and is expected to reach $380.0 ... 2013 to 2018. , Browse through the TOC of ... idea of the in-depth analysis provided. This also provides ...
(Date:10/18/2014)... 2014 The “Global Diagnostic Electrocardiograph ... by End-user (Hospitals, Home/Ambulatory, Research Center, Physician Office, ... -Global Forecast to 2020” provides a detailed overview ... market trends, and strategies impacting the global diagnostic ... of the revenue and share analysis. , The ...
Breaking Biology Technology:The Asia-Pacific Speech Analytics market is estimated to reach $208 million by 2019 - New Report by MicroMarket Monitor 2The Asia-Pacific Speech Analytics market is estimated to reach $208 million by 2019 - New Report by MicroMarket Monitor 3The Asia-Pacific Speech Analytics market is estimated to reach $208 million by 2019 - New Report by MicroMarket Monitor 4Medical Human Insulin Market Is Expected to Reach $42 billion by 2019 - New Research Report by MarketsandMarkets 2Medical Human Insulin Market Is Expected to Reach $42 billion by 2019 - New Research Report by MarketsandMarkets 3Medical Human Insulin Market Is Expected to Reach $42 billion by 2019 - New Research Report by MarketsandMarkets 4Medical Human Insulin Market Is Expected to Reach $42 billion by 2019 - New Research Report by MarketsandMarkets 5The Asia-Pacific Liquid Crystal on Silicon (LCoS) display market is expected to reach $380.0 million by 2018 - New Report by MicroMarket Monitor 2The Asia-Pacific Liquid Crystal on Silicon (LCoS) display market is expected to reach $380.0 million by 2018 - New Report by MicroMarket Monitor 3The Electrocardiograph (ECG) Market Is Expected to Reach $5,435 Million By 2020 - New Research Report by MarketsandMarkets 2The Electrocardiograph (ECG) Market Is Expected to Reach $5,435 Million By 2020 - New Research Report by MarketsandMarkets 3The Electrocardiograph (ECG) Market Is Expected to Reach $5,435 Million By 2020 - New Research Report by MarketsandMarkets 4The Electrocardiograph (ECG) Market Is Expected to Reach $5,435 Million By 2020 - New Research Report by MarketsandMarkets 5
... Austria and BETHESDA, Md., Sept. 25 ,The International ... Research (NFCR) announced today that the two organizations ... NFCR. This special fund will,support the IAEA,s Programme ... developing countries. (Logo: http://www.newscom.com/cgi-bin/prnh/20070925/CLTU127LOGO ) ...
... Albert Einstein College of Medicine researchers published in ... major scientific journal ... on demand" in mice by administering an experimental drug from,Ikaria (an ... study designed to reduce damage from heart attacks. The,study was published ...
... September 25 XTL,Biopharmaceuticals Ltd. (NASDAQ: XTLB ; ... Meeting ("AGM") and Extraordinary General Meeting,("EGM") was postponed for ... to the absence of a quorum. The postponed AGM ... Kiryat Weizmann Science Park,Rehovot, Israel 76100 at 4:00 pm ...
Cached Biology Technology:International Atomic Energy Agency and National Foundation for Cancer Research Launch Major Initiative to Improve Cancer Prevention and Treatments in Developing Countries 2New Study Shows Promise for Hydrogen Sulfide in Reducing Heart-Attack Damage, Ikaria Announces 2New Study Shows Promise for Hydrogen Sulfide in Reducing Heart-Attack Damage, Ikaria Announces 3XTL Biopharmaceuticals Ltd. AGM / EGM Postponed Until October 2, 2007 2
(Date:10/16/2014)... land managers have a new synthesis of recent research ... (MMC) forests in the two states. , The ... Oregon and Washington: A Synthesis of the Relevant Biophysical ... technical report published by the U.S. Forest Service,s Pacific ... request from managers for a synthesis of the large ...
(Date:10/16/2014)... respiratory tract infections and worldwide claims the lives ... and Ghent University have succeeded in developing a ... infection. , Xavier Saelens (VIB/UGent): "We discovered ... for the development of a novel approach to ... in numerous small children and elderly people." , ...
(Date:10/15/2014)... N.Y. , Oct. 15, 2014 ... solutions for home and community-based care, today announced ... of implementing Sandata,s Santrax® Electronic Visit Verification™ Solution ... Services is a home health company founded in ... Texas . The study ...
Breaking Biology News(10 mins):New report synthesizes best available science on management of moist mixed-conifer forests 2New perspectives for development of an RSV vaccine 2Sandata Announces Case Study with Quality Care Services, Inc. 2
... Deep red tomatoes get their rich color from lycopene, ... a special variety of orange-colored tomatoes provide a different ... readily use. , Researchers found that eating spaghetti covered ... tomatoes, caused a noticeable boost in this form of ...
... children's game participants stand as close as possible without ... be very, very close without actually touching one another ... biologists. , Now MIT researchers led by Sangeeta Bhatia, ... the Harvard-MIT Division of Health Sciences and Technology (HST) ...
... have identified how different species use common genes to ... are used to accommodate their own features. The findings, ... and Steve Small’s laboratories in NYU’s Center for Developmental ... pathways across species. The study is published in the ...
Cached Biology News:Unique tomatoes tops in disease-fighting antioxidants 2Unique tomatoes tops in disease-fighting antioxidants 3MIT device draws cells close -- but not too close -- together 2MIT device draws cells close -- but not too close -- together 3NYU scientists identify how development of different species uses same genes with distinct features 2
... Mch3 Lyophilized solid. Highly active ... kinetics, cleavage of target substrates, and inhibitor screening. ... One unit is defined as the amount of enzyme ... 235400 per hour at 37 C at saturated substrate ...
Request Info...
Bovine Coronary Artery Endothelial Cells (BCAEC) (>500,000 cells)...
Bovine Pulmonary Artery Endothelial Cells (BPAEC) (>500,000 cells)...
Biology Products: