Navigation Links
cMaster RTplusPCR System for increased sensitivity and product length ,,, in RT-PCR




Three step cycling program used for hTSF and Dynein



Target size, elongation time and annealing temperatures used



Primers used

Tubulin forward: CACCCGTCTTCAGGGCTTCTTGGTTT
Tubulin reverse: CATTTCACCATCTGGTTGGCTGGCTC
TNFR forward: CCACCATCTCGGTCATCAGGATTGCCT
TNFR reverse: TTCTCATGGAAGCTATGGGTATCACAT
hTSF forward: GGAGTTTATCATCACCGCGGAAATACTGAGAG
hTSF reverse: TATTTCACTGACAGGCAATACCGTCCAAGG
Dynein forward: CGGCGCTGGAGGAGAA
Dynein reverse: AGGTGGTGGCTCAAACACAAAG

Results

Experiment 1: Sensitivity of One Step RT-PCR


Fig. 1: One Step RT-PCR amplification of an
Alpha Tubulin cDNA fragment from various
amounts of total RNA.
Lane 1: 1 g
Lane 2: 100 ng
Lane 3: 10 ng
Lane 4: 1 ng
Lane 5: 100 pg
Lane 6: 10 pg
M: 100 bp ladder (NEB)

The cMaster RTplusPCR System shows a high dynamic range of product yield depending on the amount of template RNA. Alpha Tubulin mRNA can be detected in HELA RNA down to 10 pg of total RNA.

Experiment 2: Long range One Step RT-PCR with various amounts of total RNA



Fig. 2: Long range One Step RT-PCR of the human
Tuberous Sclerosis Factor mRNA.
M: DNA Ruler LadderMix 0.110 kb (MBI Fermentas).
Lane 1: 100 ng total RNA
Lane 2: 10 ng total RNA
Lane 3: 0 ng total RNA (negative control)

As shown in Fig. 2, a 5.3 kb hTSF PCR product is de
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Single-cell RT-PCR Analysis of Paramecium Primaurelia with the Eppendorf cMaster RTplusPCR System
2. New Mammalian Two-Hybrid System Detects Protein-Protein Interactions
3. Assess the In Vivo Activation of Signal Transduction Pathways with PathDetect Reporting Systems
4. Generate Adenovirus Vectors in E. coli by Homologous Recombination with the AdEasy Adenoviral Vector System
5. New Yeast Cloning System for Producing Proteins with Native Amino Acid Sequences
6. Enhanced PCR Cloning System
7. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
8. Performance Comparisons of Commercial RT-PCR Systems
9. Signal Transduction Reporting Systems Using Cis-Acting Enhancer Elements
10. Yeast Protein Production System Features High Yields and One-Step Purification
11. Detect Released Oligosaccharides Using the Eagle Eye II Still Video Imaging System

Post Your Comments:
(Date:11/24/2009)... Health care employment grew b...e only one to show consistent growth during the U....tals remain in trouble, and health systems are com...nnel, instead of just administrators. , ... care employment continued growing in October desp...
(Date:11/24/2009)... SHANGHAI,Nov.24/PRNewswire-Asia/--NODPharmaceutic...TO)hasallowedthepatentapplicationfor,itsnano-parti...gyisahighlyefficientapproachtoincorporatepeptideso...aldeliveryofdrugs,otherwiseadministeredasinjection...iedtomanymacromoleculardrugssuchasinsulin,interfer...
(Date:11/24/2009)... SHANGHAI,Nov.24/PRNewswire-Asia/--ShanghaiBiolaxy...on(SFDA)hasapprovedthe,investigationalnewdrugappli...ovativeinsulinformulationtotreatdiabetes.ThisIND,a...alstudy. , Diabetesisadisordercharacteristico...nsofdiabetesoftenresultinseveremicro-and,macro-vas...
(Date:11/24/2009)... The FBI recently approved the P...ies participating in or generating DNA records for... Madison, WI USA (PRWEB) -- The FBI recent...em for use by laboratories participating in, or g...System (NDIS). NDIS currently contains more than s...
Breaking Biology Technology:The MedZilla Report for October 2009 - Health Care Employment Grows Again in October Even As Clinics, Specialty Centers Close 2The MedZilla Report for October 2009 - Health Care Employment Grows Again in October Even As Clinics, Specialty Centers Close 3The MedZilla Report for October 2009 - Health Care Employment Grows Again in October Even As Clinics, Specialty Centers Close 4Biolaxy Secures IND Approval for Oral Insulin 2NDIS Approval of Promega PowerPlex Kit Clears Path for More DNA Profiles to be Added to U.S. Database 2
...14 /PRNewswire-FirstCall/,-- Abbott (NYSE: ABT ) ... they,have entered into an agreement for Abbott to...lcium), a medication used along with diet to,reduc...ment, Abbott will obtain the non-exclusive,right t...ted States,excluding Puerto Rico. Specific financi...
...s Biotech Group (USA),Inc. (the "Company" or "Tien...ced financial results for the second quarter and s...arter ended June 30, 2008, revenue was $19.7 milli...for the same period in 2007., Net income for the ...to,net income of $5.0 million for the second quart...
....,(OTC Bulletin Board: DSCI), a provider of advanc... the second quarter and first six months ended,Jun... increased volume and,distribution capacity provid... as the increased sales of its new flagship produc...he company reported sales of $13,083,966, up,from ...
Other Biology Technology:Abbott and AstraZeneca Expand Relationship to Include Co-Promotion of CRESTOR(R) 2Abbott and AstraZeneca Expand Relationship to Include Co-Promotion of CRESTOR(R) 3Abbott and AstraZeneca Expand Relationship to Include Co-Promotion of CRESTOR(R) 4Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 2Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 3Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 4Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 5Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 6Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 7Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 8Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 9Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 10Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 11Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 12Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 13Tiens Biotech Group (USA) Reports Second Quarter and Six-Month Results 14Derma Sciences Reports Second Quarter 2008 Results 2Derma Sciences Reports Second Quarter 2008 Results 3Derma Sciences Reports Second Quarter 2008 Results 4Derma Sciences Reports Second Quarter 2008 Results 5
(Date:11/24/2009)... , This release is available in Spanish . ,...re higher levels of inflammatory substances in the...eight; as shown by a research project of the Unive...Soto, a scientist at the School of Pharmacy. , T...mic study in relation to the control of body weigh...
(Date:11/23/2009)... , , Cambridge, Mass. November 23, 2009 Appli...plantain lily ( Hosta lancifolia ), a characterist... closely packed ripples along the edges. The simpl...tion resulting from bending during differential gr...que, stretching foam ribbons. , Haiyi Liang, a p...
(Date:11/23/2009)... , IRVINE, Calif. -- More than 160 participants g...Academies Keck FUTURES INITIATIVE conference. This...er scientists, engineers, and medical researchers ... issues surrounding the emerging field of syntheti...ecular biology at Princeton University and this ye...
Breaking Biology News(10 mins):It can be predicted the reaction obese patients will have to a diet 2The cause behind the characteristic shape of a long leaf revealed 2Synthetic biology offers new opportunities for interdisciplinary collaboration 2American College of Surgeons Supports Bill to Create New Frontline Providers Loan Repayment Program 49293 1American College of Surgeons Supports Bill to Create New Frontline Providers Loan Repayment Program 49293 2Florida Dermatologists Announce Distinguished Service Award Winner 49289 1AMERIGROUP Corporation to Present at the 19th Annual Wachovia Mid Year Equity Conference on June 24 49288 1
...earchers showed for the first time that a natural ...help destroy pancreatic cancer cells by reaching t...and crippling its function. The study is published...Experimental Medicine and Biology. , The study al...re doubly assaulted -- pre-treated with the antiox...
...imal species in the world are insects. The largest...). Beetles can be very beautiful and colorful, but... pests that can destroy food plants like potatoes ...eas of forest. Altogether, insect pests cause U.S.... and beetles are responsible for a substantial par...
...ss., March 25, 2008 -- Scientists at Harvard Unive... invertebrate animals called bdelloid rotifers are...surviving and continuing to reproduce after doses ...d by any other animal species studied to date. , ...adiation have been implicated in inflammation, can...
Other Biology News:Mounting evidence shows red wine antioxidant kills cancer 2Mounting evidence shows red wine antioxidant kills cancer 3Common aquatic animals show extreme resistance to radiation 2
...vy duty stainless-steel shaker flask clips, purpos...h speeds. All clips are equipped with a top retai... bottom retainer spring, and silicon tubing spring...are. Clips include the required mounting screws.,...
Mouse Anti-DIPHTHERIA TOXIN (A SUBUNIT) Monoclonal Antibody, Unconjugated, Clone 8G2 from AbD Serotec
... EnzChek Lysozyme Assay Kit (E-22013) provides,res...of lysozyme,activity in solution. This fluorescenc... 20 U/mL (Figure 1). The assay,measures lysozyme a...hich are labeled to such a degree that the fluores...
...(5')ppp(5')G (Cap Analog) is used for the synthesi...tion reactions. Substitution of cap analog for a l...on reaction results in the incorporation of the ca...ts. Capped mRNAs are generally translated more eff...
Biology Products: