Navigation Links
cMaster RTplusPCR System for increased sensitivity and product length ,,, in RT-PCR




Three step cycling program used for hTSF and Dynein



Target size, elongation time and annealing temperatures used



Primers used

Tubulin forward: CACCCGTCTTCAGGGCTTCTTGGTTT
Tubulin reverse: CATTTCACCATCTGGTTGGCTGGCTC
TNFR forward: CCACCATCTCGGTCATCAGGATTGCCT
TNFR reverse: TTCTCATGGAAGCTATGGGTATCACAT
hTSF forward: GGAGTTTATCATCACCGCGGAAATACTGAGAG
hTSF reverse: TATTTCACTGACAGGCAATACCGTCCAAGG
Dynein forward: CGGCGCTGGAGGAGAA
Dynein reverse: AGGTGGTGGCTCAAACACAAAG

Results

Experiment 1: Sensitivity of One Step RT-PCR


Fig. 1: One Step RT-PCR amplification of an
Alpha Tubulin cDNA fragment from various
amounts of total RNA.
Lane 1: 1 g
Lane 2: 100 ng
Lane 3: 10 ng
Lane 4: 1 ng
Lane 5: 100 pg
Lane 6: 10 pg
M: 100 bp ladder (NEB)

The cMaster RTplusPCR System shows a high dynamic range of product yield depending on the amount of template RNA. Alpha Tubulin mRNA can be detected in HELA RNA down to 10 pg of total RNA.

Experiment 2: Long range One Step RT-PCR with various amounts of total RNA



Fig. 2: Long range One Step RT-PCR of the human
Tuberous Sclerosis Factor mRNA.
M: DNA Ruler LadderMix 0.110 kb (MBI Fermentas).
Lane 1: 100 ng total RNA
Lane 2: 10 ng total RNA
Lane 3: 0 ng total RNA (negative control)

As shown in Fig. 2, a 5.3 kb hTSF PCR product is de
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Single-cell RT-PCR Analysis of Paramecium Primaurelia with the Eppendorf cMaster RTplusPCR System
2. New Mammalian Two-Hybrid System Detects Protein-Protein Interactions
3. Assess the In Vivo Activation of Signal Transduction Pathways with PathDetect Reporting Systems
4. Generate Adenovirus Vectors in E. coli by Homologous Recombination with the AdEasy Adenoviral Vector System
5. New Yeast Cloning System for Producing Proteins with Native Amino Acid Sequences
6. Enhanced PCR Cloning System
7. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
8. Performance Comparisons of Commercial RT-PCR Systems
9. Signal Transduction Reporting Systems Using Cis-Acting Enhancer Elements
10. Yeast Protein Production System Features High Yields and One-Step Purification
11. Detect Released Oligosaccharides Using the Eagle Eye II Still Video Imaging System
Post Your Comments:
(Date:5/20/2015)... , May 20, 2015 Veracyte, ... preliminary data demonstrating the ability of the company,s ... (IPF) from other interstitial lung diseases (ILDs) using ... classifier,s potential to help thousands of patients avoid ... in IPF diagnosis – a frequent challenge for ...
(Date:5/20/2015)... , May 20, 2015  Select Medical Corporation ... Federal Trade Commission granted early termination of the ... Act of 1976, as amended, applicable to the ... Corporation, a joint venture that Select has created ... As previously announced, MJ Acquisition Corporation has ...
(Date:5/20/2015)... 20, 2015  Marc Tessier-Lavigne, president of The ... $100 million from The Marie-Josée and Henry R. ... building that will be the centerpiece of the ... Henry R. Kravis Research Building, two stories high, ... approximately three city blocks following the shoreline of ...
(Date:5/20/2015)... May 19, 2015 Research and Markets ... of the "Bone Morphogenetic Proteins Market (Types ... Reconstructive and Oral - Maxillofacial) - Global Industry ... - 2022" report to their offering. ... studied based on the types of recombinant BMPs, ...
Breaking Biology Technology:Veracyte Presents Preliminary Data Demonstrating Ability of Molecular Classifier to Improve Non-Surgical IPF Diagnosis Using Bronchoscopy Samples 2Veracyte Presents Preliminary Data Demonstrating Ability of Molecular Classifier to Improve Non-Surgical IPF Diagnosis Using Bronchoscopy Samples 3Veracyte Presents Preliminary Data Demonstrating Ability of Molecular Classifier to Improve Non-Surgical IPF Diagnosis Using Bronchoscopy Samples 4Veracyte Presents Preliminary Data Demonstrating Ability of Molecular Classifier to Improve Non-Surgical IPF Diagnosis Using Bronchoscopy Samples 5Select Medical Corporation's Proposed Acquisition of Concentra Inc. through Joint Venture with Welsh Carson Receives Antitrust Clearance 2The Marie-Josee and Henry R. Kravis Foundation Provides Landmark Gift of $100 Million to The Rockefeller University 2The Marie-Josee and Henry R. Kravis Foundation Provides Landmark Gift of $100 Million to The Rockefeller University 3The Marie-Josee and Henry R. Kravis Foundation Provides Landmark Gift of $100 Million to The Rockefeller University 4Global Bone Morphogenetic Proteins Market Industry Analysis 2014 - 2022 2
... Sciences Holdings, Inc. (OTC Bulletin Board: ... development and commercialization of novel drugs in the therapeutic ... that it has submitted a full proposal to the ... BAA-NIAID-DMID-NIHAI2010097 Development Of Therapeutics For Biodefense .  It ...
... imaging system, scientists have tracked a group of near-infrared ... the body and out again, providing a description of ... could be used in developing therapeutic agents to treat ... of the health effects of air pollution. ...
... 2010 Financial Results ... ... --> ... // Results are keyed by longUrl, so we need to grab the first one. for (var r in data.results) ...
Cached Biology Technology:Advanced Life Sciences Submits Full Proposal to NIAID for Development of Intravenous Formulation of Restanza as a Biodefense Countermeasure 2Advanced Life Sciences Submits Full Proposal to NIAID for Development of Intravenous Formulation of Restanza as a Biodefense Countermeasure 3Advanced Life Sciences Submits Full Proposal to NIAID for Development of Intravenous Formulation of Restanza as a Biodefense Countermeasure 4Scientist chronicle nanoparticles' journey from the lungs into the body 2Scientist chronicle nanoparticles' journey from the lungs into the body 3Oncothyreon Reports Third Quarter 2010 Financial Results 2Oncothyreon Reports Third Quarter 2010 Financial Results 3Oncothyreon Reports Third Quarter 2010 Financial Results 4Oncothyreon Reports Third Quarter 2010 Financial Results 5Oncothyreon Reports Third Quarter 2010 Financial Results 6Oncothyreon Reports Third Quarter 2010 Financial Results 7Oncothyreon Reports Third Quarter 2010 Financial Results 8Oncothyreon Reports Third Quarter 2010 Financial Results 9Oncothyreon Reports Third Quarter 2010 Financial Results 10Oncothyreon Reports Third Quarter 2010 Financial Results 11
(Date:5/7/2015)... , May 7, 2015 ... fingerprint sensors, FPC1022 and FPC1035, FPC,s smallest touch ... FPC1035 are mainly considered for integration on the ... gives smartphone OEMs increased possibilities to integrate touch ... decreased size also improves possibilities for module manufacturers ...
(Date:4/27/2015)... , Apr. 27, 2015 Profile Solutions, ... control and security systems is pleased to announce that ... as a consultant and member of its scientific advisory ... widely known as a thought leader in technology-enhanced learning ... Technology Group, and has published studies and books focused ...
(Date:4/14/2015)... YORK , April 14, 2015  HYPR ... IDentity Online (FIDO ® ) Alliance tm , ... specifications. FIDO members commit to share technology and ... methods that are interoperable, more secure and private, ... enable biometric identity verification that protects sensitive user ...
Breaking Biology News(10 mins):FPC Introduces its Smallest Touch Fingerprint Sensors to Date 2Profile Solutions Names Medicinal Cannabis, Agriculture and Technology Expert Dr. Gerry Bedore to its Scientific Advisory Board 2Profile Solutions Names Medicinal Cannabis, Agriculture and Technology Expert Dr. Gerry Bedore to its Scientific Advisory Board 3Profile Solutions Names Medicinal Cannabis, Agriculture and Technology Expert Dr. Gerry Bedore to its Scientific Advisory Board 4HYPR Corp. Joins the FIDO Alliance 2HYPR Corp. Joins the FIDO Alliance 3
... with injury better than others. A flesh wound or muscle ... will heal. The prognosis for a heart attack, on the ... been thought that cardiac cells (cardiomyocytes) lack the capacity for ... from a heart attack. However, recent evidence suggests that the ...
... Therapeutics, today announced the grant of a major patent, ... Trademark Office on microarray products allowing the specific detection ... for the discovery of alternative RNA splicing events. The ... of five oligonucleotides for the detection of each splice ...
... results in irreversible damage to the heart that ... results from the limited ability of the myocardium ... from Tufts University now document the existence of ... stem cells with therapeutic potency for myocardial tissue ...
Cached Biology News:Heart repair gets new muscle 2Products containing specific probes for detecting alternative splice forms protected 2
Selenoprotein P Purified Anti-Mouse clone 35, Isotype Mouse IgG 2b , 50 µg Consult technical datasheet for details....
Anti-MMP-13 Collagenase-3, amino terminal end of active enzyme; rabbit host...
Mouse monoclonal [2Q2147] to Aequorin ( Abpromise for all tested applications)....
... isomers are predominantly used for labeling proteins, ... labeling peptides and nucleotides because they give ... often required in the conjugation processes. 5-TAMRA ... labeling peptides and proteins. 6-TAMRA is predominately ...
Biology Products: