Navigation Links
cMaster RTplusPCR System for increased sensitivity and product length ,,, in RT-PCR




Three step cycling program used for hTSF and Dynein



Target size, elongation time and annealing temperatures used



Primers used

Tubulin forward: CACCCGTCTTCAGGGCTTCTTGGTTT
Tubulin reverse: CATTTCACCATCTGGTTGGCTGGCTC
TNFR forward: CCACCATCTCGGTCATCAGGATTGCCT
TNFR reverse: TTCTCATGGAAGCTATGGGTATCACAT
hTSF forward: GGAGTTTATCATCACCGCGGAAATACTGAGAG
hTSF reverse: TATTTCACTGACAGGCAATACCGTCCAAGG
Dynein forward: CGGCGCTGGAGGAGAA
Dynein reverse: AGGTGGTGGCTCAAACACAAAG

Results

Experiment 1: Sensitivity of One Step RT-PCR


Fig. 1: One Step RT-PCR amplification of an
Alpha Tubulin cDNA fragment from various
amounts of total RNA.
Lane 1: 1 g
Lane 2: 100 ng
Lane 3: 10 ng
Lane 4: 1 ng
Lane 5: 100 pg
Lane 6: 10 pg
M: 100 bp ladder (NEB)

The cMaster RTplusPCR System shows a high dynamic range of product yield depending on the amount of template RNA. Alpha Tubulin mRNA can be detected in HELA RNA down to 10 pg of total RNA.

Experiment 2: Long range One Step RT-PCR with various amounts of total RNA



Fig. 2: Long range One Step RT-PCR of the human
Tuberous Sclerosis Factor mRNA.
M: DNA Ruler LadderMix 0.110 kb (MBI Fermentas).
Lane 1: 100 ng total RNA
Lane 2: 10 ng total RNA
Lane 3: 0 ng total RNA (negative control)

As shown in Fig. 2, a 5.3 kb hTSF PCR product is de
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Single-cell RT-PCR Analysis of Paramecium Primaurelia with the Eppendorf cMaster RTplusPCR System
2. New Mammalian Two-Hybrid System Detects Protein-Protein Interactions
3. Assess the In Vivo Activation of Signal Transduction Pathways with PathDetect Reporting Systems
4. Generate Adenovirus Vectors in E. coli by Homologous Recombination with the AdEasy Adenoviral Vector System
5. New Yeast Cloning System for Producing Proteins with Native Amino Acid Sequences
6. Enhanced PCR Cloning System
7. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
8. Performance Comparisons of Commercial RT-PCR Systems
9. Signal Transduction Reporting Systems Using Cis-Acting Enhancer Elements
10. Yeast Protein Production System Features High Yields and One-Step Purification
11. Detect Released Oligosaccharides Using the Eagle Eye II Still Video Imaging System
Post Your Comments:
(Date:7/29/2014)... 2014 Philadelphia’s newest entrepreneurial incubation space is ... start. The Innovation Center @3401 , a collaborative effort ... Science Center to help attract and nurture start-up businesses ... 28. , The Innovation Center @3401 (ic@3401), ... Streets, is the new home of DreamIt Ventures ...
(Date:7/29/2014)...  United Therapeutics Corporation (NASDAQ: ... for the second quarter ended June 30, 2014. ... our medicines are reaching increasing numbers of ... said Martine Rothblatt, Ph.D., United Therapeutics, Chairman ... this quarter of our extended-release tablet called ...
(Date:7/29/2014)... Dr. Jason Wendel – recipient of a ... of the Top 10 Plastic Surgeon Specialists for Nashville, TN ... His complete line includes a Hydration Booster, Retexturing Night Crème, ... and skin a younger, more radiant appearance while protecting them ... different, that is why at Dr. J. J. Wendel Plastic ...
(Date:7/28/2014)... , July 28, 2014 Sapphire ... technologies, today announced the appointment of biotechnology veteran ... the board of directors. Levine replaces Cynthia ,CJ, Warner, ... She will remain chairman of the company,s board of ... Sapphire Energy,s mission to deliver commercial scale algae-based fuels ...
Breaking Biology Technology:Innovation Center @3401 Opens for Business; DreamIt Ventures and Point.io First Residents 2Innovation Center @3401 Opens for Business; DreamIt Ventures and Point.io First Residents 3United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 2United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 3United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 4United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 5United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 6United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 7United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 8United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 9United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 10United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 11United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 12United Therapeutics Corporation Reports Second Quarter 2014 Financial Results 13Dr. J. J. Wendel Launches New Line of Skin Care Products 2Sapphire Energy Announces New CEO James Levine 2Sapphire Energy Announces New CEO James Levine 3
... , , Gene Provides Yield Stability During Periods of ... June 9, 2009 Monsanto Company (NYSE: MON ) ... help corn plants combat drought conditions and confer yield stability during ... stated that they will use the gene in their first-generation drought-tolerant ...
... Calif., June 9 STAAR Surgical Company (Nasdaq: ... of minimally invasive ophthalmic products, today announced that it ... Hydrophobic Acrylic Injector for use in minimally invasive cataract ... to market this foldable intraocular (IOL) KS-X lens delivery ...
... Collaborate on Testing OVAR Effectiveness , , PITTSBURGH, ... www.neuro-kinetics.com ), manufacturers of noninvasive medical evaluation equipment ... other disorders, said today that the University of ... Center has purchased and installed its I-Portal(R) NOTC (Neuro-Otologic ...
Cached Biology Technology:Monsanto, BASF Scientists Disclose Discovery of Gene Conferring Drought Tolerance in Corn Plants 2Monsanto, BASF Scientists Disclose Discovery of Gene Conferring Drought Tolerance in Corn Plants 3Monsanto, BASF Scientists Disclose Discovery of Gene Conferring Drought Tolerance in Corn Plants 4Monsanto, BASF Scientists Disclose Discovery of Gene Conferring Drought Tolerance in Corn Plants 5STAAR Surgical Receives CE Mark Approval for KS-X Preloaded Hydrophobic Acrylic Lens Injector System 2STAAR Surgical Receives CE Mark Approval for KS-X Preloaded Hydrophobic Acrylic Lens Injector System 3STAAR Surgical Receives CE Mark Approval for KS-X Preloaded Hydrophobic Acrylic Lens Injector System 4University of Michigan Installs Neuro Kinetics' I-Portal(R) NOTC System 2University of Michigan Installs Neuro Kinetics' I-Portal(R) NOTC System 3
(Date:7/29/2014)... two of the major disciplines behind Jurassic Park is ... stunning photographs and unique illustrations. , Fossil Insects, by ... incredible preservation and diversity of fossilised insects from around ... fossils can tell us about the ancient and modern ... the mosquito in Jurassic Park, many of the hundreds ...
(Date:7/28/2014)... two additional coral communities showing signs of damage from the ... 2010 spill in the Gulf of Mexico. The discovery was ... biology at Penn State University. A paper describing this work ... Gulf of Mexico will be published during the last week ... journal Proceedings of the National Academy of Sciences . ...
(Date:7/28/2014)... CAMBRIDGE, MA -- Fifteen years ago, MIT professor John Essigmann ... idea for an HIV drug. They thought if they could ... to weaken and eventually die out a strategy that ... researchers developed such a drug, which caused HIV to mutate ... eliminate the virus from patients in a small clinical trial ...
Breaking Biology News(10 mins):Unique images bring fossil insects back to life 2Impact of Deepwater Horizon oil spill on coral is deeper and broader than predicted 2Forced mutations doom HIV 2Forced mutations doom HIV 3Forced mutations doom HIV 4
... most industrious workers now a study reveals why colonies of ... workers in social insect colonies such as ants, bees and ... instincts make them better at caring for the queen,s offspring. ... these highly organised insect societies. In these species, it is only ...
... Ruhr-Universitt Bochum (RUB) have developed a bio-based solar cell. ... which in plants are responsible of photosynthesis, into complex ... Headed by Prof Dr Wolfgang Schuhmann from the Department ... and Prof Dr Matthias Rgner from the Department of ...
... YORK, NY (November 21, 2013) In what is ... disease research, The New York Stem Cell Foundation (NYSCF) ... Health (NIH) Undiagnosed Disease Program (UDP). NYSCF scientists ... the UDP and collaborate with UDP researchers to better ...
Cached Biology News:Hardworking sisters enable insect colonies to thrive 2Bio-based solar cell 2NYSCF and NIH create cell models of rare and undiagnosed diseases 2NYSCF and NIH create cell models of rare and undiagnosed diseases 3
DNA fragmentation factor & Inhibitor of CAD...
Component in MasterPure™ Purification Kits...
Anti-gp340 Monoclonal Antibody Description: 100 g Research Focus: cancer & cell proliferation Storage: -20C Shipping Temperature: 4C...
Mouse anti-HIV-Imn PND Class: Antibody Product Group: Bacterial and Viral Antigen...
Biology Products: