Navigation Links
cMaster RTplusPCR System for increased sensitivity and product length ,,, in RT-PCR




Three step cycling program used for hTSF and Dynein



Target size, elongation time and annealing temperatures used



Primers used

Tubulin forward: CACCCGTCTTCAGGGCTTCTTGGTTT
Tubulin reverse: CATTTCACCATCTGGTTGGCTGGCTC
TNFR forward: CCACCATCTCGGTCATCAGGATTGCCT
TNFR reverse: TTCTCATGGAAGCTATGGGTATCACAT
hTSF forward: GGAGTTTATCATCACCGCGGAAATACTGAGAG
hTSF reverse: TATTTCACTGACAGGCAATACCGTCCAAGG
Dynein forward: CGGCGCTGGAGGAGAA
Dynein reverse: AGGTGGTGGCTCAAACACAAAG

Results

Experiment 1: Sensitivity of One Step RT-PCR


Fig. 1: One Step RT-PCR amplification of an
Alpha Tubulin cDNA fragment from various
amounts of total RNA.
Lane 1: 1 g
Lane 2: 100 ng
Lane 3: 10 ng
Lane 4: 1 ng
Lane 5: 100 pg
Lane 6: 10 pg
M: 100 bp ladder (NEB)

The cMaster RTplusPCR System shows a high dynamic range of product yield depending on the amount of template RNA. Alpha Tubulin mRNA can be detected in HELA RNA down to 10 pg of total RNA.

Experiment 2: Long range One Step RT-PCR with various amounts of total RNA



Fig. 2: Long range One Step RT-PCR of the human
Tuberous Sclerosis Factor mRNA.
M: DNA Ruler LadderMix 0.110 kb (MBI Fermentas).
Lane 1: 100 ng total RNA
Lane 2: 10 ng total RNA
Lane 3: 0 ng total RNA (negative control)

As shown in Fig. 2, a 5.3 kb hTSF PCR product is de
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Single-cell RT-PCR Analysis of Paramecium Primaurelia with the Eppendorf cMaster RTplusPCR System
2. New Mammalian Two-Hybrid System Detects Protein-Protein Interactions
3. Assess the In Vivo Activation of Signal Transduction Pathways with PathDetect Reporting Systems
4. Generate Adenovirus Vectors in E. coli by Homologous Recombination with the AdEasy Adenoviral Vector System
5. New Yeast Cloning System for Producing Proteins with Native Amino Acid Sequences
6. Enhanced PCR Cloning System
7. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
8. Performance Comparisons of Commercial RT-PCR Systems
9. Signal Transduction Reporting Systems Using Cis-Acting Enhancer Elements
10. Yeast Protein Production System Features High Yields and One-Step Purification
11. Detect Released Oligosaccharides Using the Eagle Eye II Still Video Imaging System
Post Your Comments:
(Date:7/13/2014)... 2014 Deep Research Report on Global and ... study on the current state of the Nano Silver ... a basic overview of the industry, including definitions, applications ... domestic market analysis are provided with a focus on ... A comparison between the international and Chinese situation is ...
(Date:7/11/2014)... PALM BEACH, Fla. , July 11, 2014 /PRNewswire-iReach/ ... variety of high-quality peptides that are used solely in ... To honor two successful years in business, Maxim Peptide, ... LLC, has just launched a new and updated website ... the research blog section has been updated with fascinating ...
(Date:7/11/2014)... July 11, 2014 Research and Markets ... Technology Market - Global Industry Analysis, Size, Share, Growth, ... offering. http://photos.prnewswire.com/prnh/20130307/600769 ... acids (either DNA or RNA) into cells. This technology ... cancer cells and protein metabolism by affecting the nuclear ...
(Date:7/11/2014)... July 11, 2014 EPFL and ... the appointment of John P. Donoghue . The ... Geneva . The new Wyss ... in Geneva , has named as ... John P. Donoghue , founder of Brown University,s ...
Breaking Biology Technology:2014 Nano Silver Industry in Global and China Regions Development Proposals Analysis Available at DeepResearchReports.com 22014 Nano Silver Industry in Global and China Regions Development Proposals Analysis Available at DeepResearchReports.com 3Maxim Peptide Celebrates Second Anniversary Online with an Updated Website and Special Deals Section 2International Transfection Technology Market - Industry Analysis, Size, Share, Growth, Trends and Forecast to 2019 2John P. Donoghue is Taking the Lead at the Wyss Center and is Appointed Professor at EPFL and University of Geneva 2John P. Donoghue is Taking the Lead at the Wyss Center and is Appointed Professor at EPFL and University of Geneva 3
... a simple and convenient technique that combines nanoscale ... elusive goal. With current analytical instruments, spatial resolution ... preparation too complex or sample size too large ... the University of Illinois have demonstrated a method ...
... LAKES, N.J., March 27 BD (Becton,Dickinson and ... medical technology,company, and Direct Relief International, a humanitarian ... volunteer,initiative to strengthen healthcare in Ghana. A team ... Ghana for three weeks and work side-by-side,with Direct ...
... (Nasdaq: GNTA ) announced that the NASDAQ ... an extension of,time to achieve full compliance with ... decision, the listing of the,Company,s common stock will ... NASDAQ Capital Market, effective with the open of ...
Cached Biology Technology:Femtogram-level chemical measurements now possible, U. of I. team reports 2BD and Direct Relief International Launch Second Volunteer Service Trip to Improve Healthcare in Ghana 2BD and Direct Relief International Launch Second Volunteer Service Trip to Improve Healthcare in Ghana 3Genta Granted Extension to Achieve Compliance with NASDAQ Listing Requirements 2Genta Granted Extension to Achieve Compliance with NASDAQ Listing Requirements 3
(Date:7/10/2014)... July 3, 2014 According to ... Type (Swipe And Area), Material (Optical Prism, Pizeoelectric, Capacitive, ... Security and Banking & Finance), and Geography - Global ... MarketsandMarkets, the global Fingerprint Sensors Market is projected to ... CAGR of 16.8% from 2014 to 2020. ...
(Date:7/10/2014)... Fingerprint Cards, (FPC,s) new mobile touch sensor FPC1021 ... Top 5 smartphone OEM has selected FPC1021 for a flagship ... 2014.   FPC is proud to announce this ... a planned date for the start of mass production in ... of 3 million units. The Chinese OEM wants to remain ...
(Date:7/10/2014)... 2014 Fingerprint Cards, (FPC,s) ... win (DW). An Asian OEM has selected FPC1021 for a ... in August 2014.   FPC is proud to ... a planned date for start of mass production in August ... SEK 5M, for delivery in the first half of July. ...
Breaking Biology News(10 mins):Fingerprint Sensors Market worth $14.35 Billion by 2020 2Fingerprint Sensors Market worth $14.35 Billion by 2020 3FPC Wins DW for 1021 Touch Sensor for Flagship Smartphone from Chinese Top 5 Smartphone OEM 2FPC Wins DW and Initial Ramp Order for FPC1021 Touch Sensor for Flagship Smartphone from Asian OEM 2
... School of Medicine has revealed key features in ... and other extreme environments. The researchers, funded by ... environment of Antarctica. They found subtle but significant ... and Haloarchaea, organisms that can tolerate severe conditions ...
... that pumpkins and cucumbers can be traced back to India. ... of Cucurbitaceae evolution and diversity, a new checklist of the ... that family. The study was published in the open access ... components of a healthy daily diet, not just in India ...
... of continuing evolution in the college textbook market, an ... leader (NYSE:JWa, JWb), and Rice University-based OpenStax College, a ... partnership calls for Wiley to deliver content from OpenStax ... online learning, practice and assessment resources that are ...
Cached Biology News:University of Maryland School of Medicine discovers adaptations to explain strategies for survival on Mars 2A new checklist confirms Indian origins of pumpkins and cucumbers 2Unlikely partners create innovative product for college biology 2
Recombinant Rhesus Macaque IFN-alpha...
... 500 g protein in 200 l SDS-PAGE ... cell lysate; Abelson transformed macrophage cells, ... positive control, should be stored ... be minimized, sample vial should ...
The epitope is specific for TASK and is not present in any other known proteins tested so far.,SPECIES REACTIVITIES: The epitope is also highly conserved between mouse and rat (17/18 residues iden...
Anti-Mouse MIP-1g, Biotin (Polyclonal) (rabbit IgG)...
Biology Products: