Navigation Links
cMaster RTplusPCR System for increased sensitivity and product length ,,, in RT-PCR




Three step cycling program used for hTSF and Dynein



Target size, elongation time and annealing temperatures used



Primers used

Tubulin forward: CACCCGTCTTCAGGGCTTCTTGGTTT
Tubulin reverse: CATTTCACCATCTGGTTGGCTGGCTC
TNFR forward: CCACCATCTCGGTCATCAGGATTGCCT
TNFR reverse: TTCTCATGGAAGCTATGGGTATCACAT
hTSF forward: GGAGTTTATCATCACCGCGGAAATACTGAGAG
hTSF reverse: TATTTCACTGACAGGCAATACCGTCCAAGG
Dynein forward: CGGCGCTGGAGGAGAA
Dynein reverse: AGGTGGTGGCTCAAACACAAAG

Results

Experiment 1: Sensitivity of One Step RT-PCR


Fig. 1: One Step RT-PCR amplification of an
Alpha Tubulin cDNA fragment from various
amounts of total RNA.
Lane 1: 1 g
Lane 2: 100 ng
Lane 3: 10 ng
Lane 4: 1 ng
Lane 5: 100 pg
Lane 6: 10 pg
M: 100 bp ladder (NEB)

The cMaster RTplusPCR System shows a high dynamic range of product yield depending on the amount of template RNA. Alpha Tubulin mRNA can be detected in HELA RNA down to 10 pg of total RNA.

Experiment 2: Long range One Step RT-PCR with various amounts of total RNA



Fig. 2: Long range One Step RT-PCR of the human
Tuberous Sclerosis Factor mRNA.
M: DNA Ruler LadderMix 0.110 kb (MBI Fermentas).
Lane 1: 100 ng total RNA
Lane 2: 10 ng total RNA
Lane 3: 0 ng total RNA (negative control)

As shown in Fig. 2, a 5.3 kb hTSF PCR product is de
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Single-cell RT-PCR Analysis of Paramecium Primaurelia with the Eppendorf cMaster RTplusPCR System
2. New Mammalian Two-Hybrid System Detects Protein-Protein Interactions
3. Assess the In Vivo Activation of Signal Transduction Pathways with PathDetect Reporting Systems
4. Generate Adenovirus Vectors in E. coli by Homologous Recombination with the AdEasy Adenoviral Vector System
5. New Yeast Cloning System for Producing Proteins with Native Amino Acid Sequences
6. Enhanced PCR Cloning System
7. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
8. Performance Comparisons of Commercial RT-PCR Systems
9. Signal Transduction Reporting Systems Using Cis-Acting Enhancer Elements
10. Yeast Protein Production System Features High Yields and One-Step Purification
11. Detect Released Oligosaccharides Using the Eagle Eye II Still Video Imaging System
Post Your Comments:
(Date:8/28/2015)... - RepliCel Life Sciences Inc. (OTCQB: REPCF) (TSXV: ... the development of autologous cell therapies, today reported ... 2015, corporate highlights, and near-term milestones.  The company,s ... www.sedar.com ,  www.edgar.com and at ... to launch its RCS-01 treatment for aging and ...
(Date:8/27/2015)... (PRWEB) , ... August 27, 2015 , ... Capital ... solve complex business problems, is pleased to announce their ranking as one of the ... ranking of the fastest-growing private companies across the nation. , “It is truly an ...
(Date:8/27/2015)... Calif. , Aug. 27, 2015  Asterias Biotherapeutics, ... the emerging field of regenerative medicine, today announced that ... conferences in the month of September.  ... present at Rodman & Renshaw,s 17th Annual Global Investment ... PT at the St. Regis Hotel in ...
(Date:8/27/2015)... ... , ... Inc. Magazine released its annual list of the 5,000 fastest-growing privately ... for the three years through 2014. Being named to the Inc. 5000 list designates ... country. , “We are thrilled to make the Inc. 5000 list for 2015,” ...
Breaking Biology Technology:RepliCel Reports Second Quarter 2015 Financial Results 2RepliCel Reports Second Quarter 2015 Financial Results 3RepliCel Reports Second Quarter 2015 Financial Results 4RepliCel Reports Second Quarter 2015 Financial Results 5Capital Edge Consulting Makes Inc. 5000 List of America’s Fastest-Growing Private Companies 2Capital Edge Consulting Makes Inc. 5000 List of America’s Fastest-Growing Private Companies 3Asterias Biotherapeutics to Present at Upcoming Investor Conferences 2iLab Solutions Named to 2015 Inc. 5000 List 2iLab Solutions Named to 2015 Inc. 5000 List 3
... Michael Leist Varian , ... Introduction , ... greatly between the various chemical species in which an element occurs, ... one such example where the various species differ; the inorganic trivalent ...
... Tran T. Nham Varian Australia Pty Ltd Mulgrave, Victoria, Australia , ... Because of the low detection limit capability of ... widely used to determine trace and ultratrace levels in water samples 1 ... the ultrasonic nebulizer to handle samples with significant amounts of dissolved solids, ...
... Pond, Jason S. Wood, and August Specht Varian, Inc. , ... Alprazolam (Xanax) and Temazepam (Restoril) were ... after protein precipitation using Liquid Chromatography Electrospray Ionization Mass Spectrometry (LC/ESI/MS/MS). ... and accurately quantitate these drugs in the BSA matrix is investigated ...
Cached Biology Technology:Speciation of Arsenic by LC-ICP-MS 2Speciation of Arsenic by LC-ICP-MS 3Speciation of Arsenic by LC-ICP-MS 4Speciation of Arsenic by LC-ICP-MS 5Analysis of urine and seawater samples by ultrasonic nebulization with a high resolution ICP spectrometer 2Analysis of urine and seawater samples by ultrasonic nebulization with a high resolution ICP spectrometer 3Analysis of urine and seawater samples by ultrasonic nebulization with a high resolution ICP spectrometer 4Detection of Alprazolam and Temazepam in a Bovine Plasma Matrix Using the Varian 500-MS Ion Trap Mass Spectrometer 2Detection of Alprazolam and Temazepam in a Bovine Plasma Matrix Using the Varian 500-MS Ion Trap Mass Spectrometer 3
(Date:8/20/2015)... -- NXT-ID, Inc. (NASDAQ: NXTD ) ("NXT-ID" or ... growing mobile commerce market and creator of the Wocket® ... Alliance and the EMV Migration Forum.  ... Alliance Latin America (SCALA) Chapter provides NXT-ID, Inc. direct ... promoting adoption of smart card technology. To ...
(Date:8/18/2015)... , Aug. 18, 2015  Navitas today ... contributor to the Submission Content Management webinar ... a non-profit forum. Dedicated to the Implementation of ... neutral platform for industry, vendors, health authorities, ... and work towards a standard method of ...
(Date:8/17/2015)... , Aug. 17, 2015  NXT-ID, Inc. (NASDAQ: ... company focused on the growing mobile commerce market and ... sales campaign for Q4 2015. The new marketing campaign ... consisting of Amplitude Marketing Group ( http://amplitudemarketing.com/ ) and ... is a leader in retail driven marketing and brand ...
Breaking Biology News(10 mins):NXT-ID, Inc. Joins Smart Card Alliance and EMV Migration Forum 2NXT-ID, Inc. Joins Smart Card Alliance and EMV Migration Forum 3NXT-ID, Inc. Joins Smart Card Alliance and EMV Migration Forum 4Navitas, a Key Contributor in IRISS Forum Webinar 2Navitas, a Key Contributor in IRISS Forum Webinar 3NXT-ID, Inc. Launches Sales Campaign for Wocket Smart Wallet with Award Winning Marketing Team 2NXT-ID, Inc. Launches Sales Campaign for Wocket Smart Wallet with Award Winning Marketing Team 3
... Shocking new research shows size isn,t always an ... that bigger is better. Michael Kasumovic, a ... Redback male spiders to determine whether the larger ones ... offspring. Surprisingly, Kasumovic found the large spiders didn,t ...
... decades, the number of adults consuming sugar-sweetened beverages ... has increased dramatically, according to a study led ... of Public Health. Researchers examined changes over the ... on nationally representative survey data, and found that ...
... --The U.S. Environmental Protection Agency and U.S. Department of ... (NCII) to learn more about the effectiveness of actions ... basin and into the northern Gulf of Mexico, says ... The report also advises how to move forward on ...
Cached Biology News:Sweetened beverage consumption increases in the US 2EPA and USDA should create new initiative to better monitor nutrients 2EPA and USDA should create new initiative to better monitor nutrients 3EPA and USDA should create new initiative to better monitor nutrients 4
6-keto Prostaglandin F1α EIA Antiserum 6-keto-PGF1alpha EIAs prostaglandins antisera enzyme immunoassays reagents 6-keto-PGF1.alpha....
... reagent has been developed for use ... reduction of nonspecific background staining due ... describe blocking peroxidase with hydrogen peroxide. ... in combination with additional novel components ...
Phospho-Btk (Tyr223) Antibody...
Rad51B...
Biology Products: