Navigation Links
cMaster RTplusPCR System for increased sensitivity and product length ,,, in RT-PCR

Abstract

RT-PCR has become an essential method that allows researchers to determine the presence, structure and level of expression of an mRNA transcript in the organism, tissue or cell of interest. The basic protocol involves the synthesis of a cDNA copy of all the mRNA present in the sample, followed by amplification of the gene(s) of interest. Due to buffer incompatibilities, the two steps (RT and PCR) are often performed separately. While there are kits that combine the two steps into one, the limitations on sensitivity, due to the aforementioned buffer incompatibilities, are great. Eppendorf has designed a new kit with novel chemistries that allow for a more robust single-step RT-PCR reaction and even greater sensitivity in Two Step experiments. This paper examines the performance of this new kit.

Introduction

Reverse Transcription followed by PCR* (RT-PCR) is one of the most popular techniques for RNA analysis. One Step RT-PCR is the method of choice if many RNA samples need to be analyzed in parallel; the Two Step protocol is used for difficult targets or multiple target amplification from a single cDNA pool. The new Eppendorf cMaster RTplusPCR System enables the full range of RT-PCR applications. It contains a novel, recombinant reverse transcriptase, and a high fidelity PCR enzyme mix. In addition, the RTplusPCR buffer is formulated to adjust the Mg2+ concentration automatically, so that there is never a need for optimization of this critical component. This is achieved by weakly chelating Mg 2+ ions: when Mg2+ is present in excess, it is bound by the chelating agent, but as it is needed by the reaction (for Taq, or DNA), it is released. This novel technology increases the sensitivity and specificity of cMaster RTplusPCR. A single kit combines One- and Two Step RT-PCR protocols with high dynamic detection ranges and broad ranges of PCR product size (up to 5.3 kb for One Step reactions; up to 12.3 kb for Two Step protocols). The following experiments were designed to demonstrate the use of the kit in various applications.

The first experiment focuses on the extraordinary sensitivity of the new system with respect to One Step RT-PCR. Working with small amounts of target material is the most critical factor in One Step applications. Performing long range RT-PCR in a One Step protocol is no longer a problem as demonstrated in experiment two. The novel buffer system in the kit allows optimal processivity of both the reverse transcriptase and proofreading polymerase mix. The optional Two Step RT-PCR protocol provided in the system is adaptable to a wide range of templates. Experiment three depicts amplification of various templates. Whether moderately sized or very long, low- or high abundance, the new system offers a comprehensive
solution for all RT targets.

Materials and Methods

Eppendorf cMaster RTplusPCR System
Eppendorf Perfect RNA Eukaryotic Kit
All PCR* reactions were performed on the Eppendorf Mastercycler gradient.

Experiment 1: One Step, Sensitivity Test

Target for RT-PCR amplification: human Alpha Tubulin mRNA, a 500 fragment. Template RNA: total RNA purified from human HELA cells. Template concentrations in the reactions ranged from 1 g down to 10 pg. Protocol: Eppendorf cMaster RTplusPCR System, standard One Step RT-PCR protocol. 50 l reactions in 1:10 diluted RTplusPCR Buffer at 2.5 mM final Magnesium concentration.

Set-up for One Step RT-PCR reactions



Cycling program parameters



Experiment 2: One Step, Long Range

Target for RT-PCR amplification: human Tuberous Sclerosis Factor (hTSF) mRNA, a 5.3 kb fragment. Template RNA: total RNA purified from human HELA cells, template concentrations in the reactions are 100 and 10 ng.
Protocol: Eppendorf cMaster RTplusPCR Kit, special One Step
RT-PCR protocol for long templates.

Set-up for One Step RT-PCR reactions



Cycling program parameters



Experiment 3: Two Step RT-PCR

Targets for Two Step RT-PCR amplification:

Alpha Tubulin mRNA (mouse and human), 500 bp fragment
Tumor Necrosis Factor Receptor (TNFR1) mRNA (mouse and human), 1.3 kb fragment
Human Tuberous Sclerosis Factor (hTSF) mRNA, 5.3 kb fragment
Mouse Dynein mRNA, 12.3 kb fragment
Protocol: Eppendorf cMaster RTplusPCR Kit, Two Step RT-PCR
protocol for standard sized and long templates (manual). All reverse
transcription reactions were primed with 0.5 g Oligo(dT)20 primer.


Set-up for the first step RT reaction



Set-up for the second step PCR reaction



Set-up for RT reaction



Two step cycling program used for Tubulin and TNFR1



Three step cycling program used for hTSF and Dynein



Target size, elongation time and annealing temperatures used



Primers used

Tubulin forward: CACCCGTCTTCAGGGCTTCTTGGTTT
Tubulin reverse: CATTTCACCATCTGGTTGGCTGGCTC
TNFR forward: CCACCATCTCGGTCATCAGGATTGCCT
TNFR reverse: TTCTCATGGAAGCTATGGGTATCACAT
hTSF forward: GGAGTTTATCATCACCGCGGAAATACTGAGAG
hTSF reverse: TATTTCACTGACAGGCAATACCGTCCAAGG
Dynein forward: CGGCGCTGGAGGAGAA
Dynein reverse: AGGTGGTGGCTCAAACACAAAG

Results

Experiment 1: Sensitivity of One Step RT-PCR


Fig. 1: One Step RT-PCR amplification of an
Alpha Tubulin cDNA fragment from various
amounts of total RNA.
Lane 1: 1 g
Lane 2: 100 ng
Lane 3: 10 ng
Lane 4: 1 ng
Lane 5: 100 pg
Lane 6: 10 pg
M: 100 bp ladder (NEB)

The cMaster RTplusPCR System shows a high dynamic range of product yield depending on the amount of template RNA. Alpha Tubulin mRNA can be detected in HELA RNA down to 10 pg of total RNA.

Experiment 2: Long range One Step RT-PCR with various amounts of total RNA



Fig. 2: Long range One Step RT-PCR of the human
Tuberous Sclerosis Factor mRNA.
M: DNA Ruler LadderMix 0.110 kb (MBI Fermentas).
Lane 1: 100 ng total RNA
Lane 2: 10 ng total RNA
Lane 3: 0 ng total RNA (negative control)

As shown in Fig. 2, a 5.3 kb hTSF PCR product is detectable in 100 and 10 ng of total RNA using the One Step RT-PCR protocol. This is a very difficult PCR at best, and most manufacturers of RT-PCR kits do not even publish results of one-step protocols on templates this long. In contrast the Eppendorf kit can consistently and reliably amplify this product from 10 ng of RNA from HELA cells.

Experiment 3: Two Step RT-PCR of short, long, rare and abundant transcripts from various sources of total RNA.



Fig. 3: Two Step RT-PCR of multiple targets and RNA sources. M: DNA Ladder Mix 0.110 kb (MBI Fermentas).

RT-PCR was performed on five genes that exhibit various levels of expression. In order to maximize sensitivity the RT reaction was performed separately from the PCR reaction. In the case of Alpha Tubulin and TNFR1, we were able to use a two-step protocol and combined the annealing and elongation step into a single 68 C step. As shown in fig. 3, all reactions worked well regardless of fragment length or copy number. Even Dynein, an extremely rare transcript that is
very long (12.3 kb), was efficiently amplified with the cMaster RTplusPCR. These results were extremely reproducible and show that the Eppendorf kit can be expected to give reliable results for difficult RT-PCR reactions.

Details for Fig. 3



Discussion

The cMaster RT is designed to provide maximum flexibility for all demanding RT and RT-PCR applications. A recombinant homo-dimeric viral reverse transcriptase together with a unique formulation of the RTplusPCR buffer allows efficient cDNA synthesis over a broad temperature range (37 C60 C) and product size (0.2 kb12.5 kb). The cMaster RTplusPCR enzyme mix uses a blend of thermostable DNA polymerases with proofreading assisted fidelity and high extension rate. Performing the One Step procedure, sensitive detection out of smallest amounts of total RNA and amplification of up to 5.3 kb cDNAs is possible (see Fig. 1 and Fig. 2). The Two Step protocol enables multiple cDNA targets to be amplified from an RT reaction, extending the PCR product size up to 12.3 kb (see Fig. 3). To further extend flexibility, the RT-only option of the system can be used to combine cMaster RT with any PCR system or to generate cDNA probes for other downstream applications, e.g. hybridization experiments.





'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Single-cell RT-PCR Analysis of Paramecium Primaurelia with the Eppendorf cMaster RTplusPCR System
2. New Mammalian Two-Hybrid System Detects Protein-Protein Interactions
3. Assess the In Vivo Activation of Signal Transduction Pathways with PathDetect Reporting Systems
4. Generate Adenovirus Vectors in E. coli by Homologous Recombination with the AdEasy Adenoviral Vector System
5. New Yeast Cloning System for Producing Proteins with Native Amino Acid Sequences
6. Enhanced PCR Cloning System
7. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
8. Performance Comparisons of Commercial RT-PCR Systems
9. Signal Transduction Reporting Systems Using Cis-Acting Enhancer Elements
10. Yeast Protein Production System Features High Yields and One-Step Purification
11. Detect Released Oligosaccharides Using the Eagle Eye II Still Video Imaging System
Post Your Comments:
(Date:7/10/2014)... Ouagadougou, Burkina Faso (PRWEB) July 10, 2014 ... Burkina Faso, today have access to an additional ... to increase access to contraception at all levels ... combining a lower-dose formulation of a widely used ... injection system. , Burkina Faso is the first ...
(Date:7/10/2014)... Understanding the need for better quality and ... gap that currently exists in this area, ChanTest has ... of validated ion channel and GPCR cell lines. ... ion channels control many critical physiological functions throughout the ... potential to treat a variety of human diseases. ...
(Date:7/10/2014)... (PRWEB) July 10, 2014 Robert Harman, DVM, ... Medicine company, is proud to announce the relaunch of his ... with a new series called “ What are Stem Cells ... an honest and straightforward foundation in the basics of stem ... decision on the right type of treatment when considering regenerative ...
(Date:7/10/2014)... CA (PRWEB) July 10, 2014 Senior ... institutions and professional associations, addressed the challenges of “Reducing ... Medical Device Industries” through strategic sourcing. Describing the partnership ... with the Supply Chain Management Institute ( SCMI) ... event on June 24 at the Kroc Institute of ...
Breaking Biology Technology:Injectable Contraceptive Launched in Burkina Faso to Expand Choice and Address Unmet Need 2Injectable Contraceptive Launched in Burkina Faso to Expand Choice and Address Unmet Need 3Injectable Contraceptive Launched in Burkina Faso to Expand Choice and Address Unmet Need 4Injectable Contraceptive Launched in Burkina Faso to Expand Choice and Address Unmet Need 5Injectable Contraceptive Launched in Burkina Faso to Expand Choice and Address Unmet Need 6Leader in Ion Channel Research Announces Newly Validated and Re-Engineered Cells 2Leader in Ion Channel Research Announces Newly Validated and Re-Engineered Cells 3Robert Harman, DVM Talks About What Stem Cells are in His Latest Blog Series for Vet-Stem, Inc. 2Robert Harman, DVM Talks About What Stem Cells are in His Latest Blog Series for Vet-Stem, Inc. 3Biotech & Biopharm Supply Chain Management Executives Launch BSMA in San Diego 2Biotech & Biopharm Supply Chain Management Executives Launch BSMA in San Diego 3Biotech & Biopharm Supply Chain Management Executives Launch BSMA in San Diego 4
... Nev., Sept. 30, 2011 Lifeline Biotechnologies, Inc. (Pink Sheets: ... efforts to reestablish DTC services. Jim Holmes, Lifeline,s ... services to the Company we have not been successful.  We ... The value of Lifeline is not reflected in ...
... , SALT LAKE CITY, Sept. 29, 2011 University of ... catalysts, which are substances that speed chemical reactions and are ... the new method, the chemists also made a discovery that ... discovery: the sizes and electronic properties of catalysts interact to ...
... BioSpace , the leading life sciences employment and ... marking the 14th edition. (Logo: http://photos.prnewswire.com/prnh/20040907/CLTU006LOGO) ... Each company,s brand is added to an electronic and ... as well as at industry events and career fairs. ...
Cached Biology Technology:Lifeline Biotechnologies and Depository Trust Company 2Building better catalysts 2Building better catalysts 3BioSpace Spotlights Southern California's Life Science Community 2
(Date:7/11/2014)... new report from the Wildlife Conservation Society shows ... help economically valuable species such as lobster, conch, ... help re-colonize nearby reef areas. , The reporttitled ... systematic review of research literature from no-take areas ... Dr. Craig Dahlgren, a recognized expert in marine ...
(Date:7/11/2014)... were many fires burning in eastern New South Wales, ... 11. , At 03:35 UTC on July 11 (12:35 ... Aqua passed over eastern New South Wales (NSW), the ... visible image of the region and spotted smoke (light ... MODIS,s thermal bands, are outlined in red. , The ...
(Date:7/11/2014)... and Mineral Research awarded Michael F. Holick, PhD, MD, ... 2014 Louis V. Avioli Award. Holick, a professor of ... for revolutionizing the understanding of vitamin D and its ... a member of the American Society for Bone and ... mineral basic research. It is named for ASBMR,s first ...
Breaking Biology News(10 mins):Belize's lobster, conch, and fish populations rebuild in no-take zones 2BUSM's Michael F. Holick receives American Society for Bone and Mineral Research award 2
... from the Buck Institute for Age Research offers a ... neurodegenerative disorder which afflicts 24 million people worldwide. ... a protein implicated in AD, scientists in California and ... a new therapeutic target for the disease. The finding ...
... fish do it. But Prof. Yossi Loya from Tel Aviv ... to discover that Japanese sea corals engage in "sex switching" ... survival of fragile sea corals ― essential to all life ... In times of stress like extreme hot spells, the ...
... group of scientists is renewing calls for policymakers to ... eutrophication or nutrient pollution problems in fresh ... Science , the researchers argue that dual-nutrient reduction ... complex interactions between nitrogen and phosphorus in fresh and ...
Cached Biology News:A revolutionary new model for Alzheimer's disease 2Changing sexes on the sea floor 2
... Andrew J. Davison and ... • Contents include: information ... viruses, paramyxoviruses, influenza and ... covers analysis of viral ...
... U. Desselberger (1995) • This book ... together classical and molecular techniques currently ... infections and analysis of virus-specific antibodies ... are presented covering immunoassays, blotting and ...
...
... provide rapid and efficient removal of short ... salts from PCR products (Figure 1). The ... Binding Buffer options for fragments >100 bp ... in either single column or 96-well plate ...
Biology Products: