Navigation Links
cMaster RTplusPCR System for increased sensitivity and product length ,,, in RT-PCR

Abstract

RT-PCR has become an essential method that allows researchers to determine the presence, structure and level of expression of an mRNA transcript in the organism, tissue or cell of interest. The basic protocol involves the synthesis of a cDNA copy of all the mRNA present in the sample, followed by amplification of the gene(s) of interest. Due to buffer incompatibilities, the two steps (RT and PCR) are often performed separately. While there are kits that combine the two steps into one, the limitations on sensitivity, due to the aforementioned buffer incompatibilities, are great. Eppendorf has designed a new kit with novel chemistries that allow for a more robust single-step RT-PCR reaction and even greater sensitivity in Two Step experiments. This paper examines the performance of this new kit.

Introduction

Reverse Transcription followed by PCR* (RT-PCR) is one of the most popular techniques for RNA analysis. One Step RT-PCR is the method of choice if many RNA samples need to be analyzed in parallel; the Two Step protocol is used for difficult targets or multiple target amplification from a single cDNA pool. The new Eppendorf cMaster RTplusPCR System enables the full range of RT-PCR applications. It contains a novel, recombinant reverse transcriptase, and a high fidelity PCR enzyme mix. In addition, the RTplusPCR buffer is formulated to adjust the Mg2+ concentration automatically, so that there is never a need for optimization of this critical component. This is achieved by weakly chelating Mg 2+ ions: when Mg2+ is present in excess, it is bound by the chelating agent, but as it is needed by the reaction (for Taq, or DNA), it is released. This novel technology increases the sensitivity and specificity of cMaster RTplusPCR. A single kit combines One- and Two Step RT-PCR protocols with high dynamic detection ranges and broad ranges of PCR product size (up to 5.3 kb for One Step reactions; up to 12.3 kb for Two Step protocols). The following experiments were designed to demonstrate the use of the kit in various applications.

The first experiment focuses on the extraordinary sensitivity of the new system with respect to One Step RT-PCR. Working with small amounts of target material is the most critical factor in One Step applications. Performing long range RT-PCR in a One Step protocol is no longer a problem as demonstrated in experiment two. The novel buffer system in the kit allows optimal processivity of both the reverse transcriptase and proofreading polymerase mix. The optional Two Step RT-PCR protocol provided in the system is adaptable to a wide range of templates. Experiment three depicts amplification of various templates. Whether moderately sized or very long, low- or high abundance, the new system offers a comprehensive
solution for all RT targets.

Materials and Methods

Eppendorf cMaster RTplusPCR System
Eppendorf Perfect RNA Eukaryotic Kit
All PCR* reactions were performed on the Eppendorf Mastercycler gradient.

Experiment 1: One Step, Sensitivity Test

Target for RT-PCR amplification: human Alpha Tubulin mRNA, a 500 fragment. Template RNA: total RNA purified from human HELA cells. Template concentrations in the reactions ranged from 1 g down to 10 pg. Protocol: Eppendorf cMaster RTplusPCR System, standard One Step RT-PCR protocol. 50 l reactions in 1:10 diluted RTplusPCR Buffer at 2.5 mM final Magnesium concentration.

Set-up for One Step RT-PCR reactions



Cycling program parameters



Experiment 2: One Step, Long Range

Target for RT-PCR amplification: human Tuberous Sclerosis Factor (hTSF) mRNA, a 5.3 kb fragment. Template RNA: total RNA purified from human HELA cells, template concentrations in the reactions are 100 and 10 ng.
Protocol: Eppendorf cMaster RTplusPCR Kit, special One Step
RT-PCR protocol for long templates.

Set-up for One Step RT-PCR reactions



Cycling program parameters



Experiment 3: Two Step RT-PCR

Targets for Two Step RT-PCR amplification:

Alpha Tubulin mRNA (mouse and human), 500 bp fragment
Tumor Necrosis Factor Receptor (TNFR1) mRNA (mouse and human), 1.3 kb fragment
Human Tuberous Sclerosis Factor (hTSF) mRNA, 5.3 kb fragment
Mouse Dynein mRNA, 12.3 kb fragment
Protocol: Eppendorf cMaster RTplusPCR Kit, Two Step RT-PCR
protocol for standard sized and long templates (manual). All reverse
transcription reactions were primed with 0.5 g Oligo(dT)20 primer.


Set-up for the first step RT reaction



Set-up for the second step PCR reaction



Set-up for RT reaction



Two step cycling program used for Tubulin and TNFR1



Three step cycling program used for hTSF and Dynein



Target size, elongation time and annealing temperatures used



Primers used

Tubulin forward: CACCCGTCTTCAGGGCTTCTTGGTTT
Tubulin reverse: CATTTCACCATCTGGTTGGCTGGCTC
TNFR forward: CCACCATCTCGGTCATCAGGATTGCCT
TNFR reverse: TTCTCATGGAAGCTATGGGTATCACAT
hTSF forward: GGAGTTTATCATCACCGCGGAAATACTGAGAG
hTSF reverse: TATTTCACTGACAGGCAATACCGTCCAAGG
Dynein forward: CGGCGCTGGAGGAGAA
Dynein reverse: AGGTGGTGGCTCAAACACAAAG

Results

Experiment 1: Sensitivity of One Step RT-PCR


Fig. 1: One Step RT-PCR amplification of an
Alpha Tubulin cDNA fragment from various
amounts of total RNA.
Lane 1: 1 g
Lane 2: 100 ng
Lane 3: 10 ng
Lane 4: 1 ng
Lane 5: 100 pg
Lane 6: 10 pg
M: 100 bp ladder (NEB)

The cMaster RTplusPCR System shows a high dynamic range of product yield depending on the amount of template RNA. Alpha Tubulin mRNA can be detected in HELA RNA down to 10 pg of total RNA.

Experiment 2: Long range One Step RT-PCR with various amounts of total RNA



Fig. 2: Long range One Step RT-PCR of the human
Tuberous Sclerosis Factor mRNA.
M: DNA Ruler LadderMix 0.110 kb (MBI Fermentas).
Lane 1: 100 ng total RNA
Lane 2: 10 ng total RNA
Lane 3: 0 ng total RNA (negative control)

As shown in Fig. 2, a 5.3 kb hTSF PCR product is detectable in 100 and 10 ng of total RNA using the One Step RT-PCR protocol. This is a very difficult PCR at best, and most manufacturers of RT-PCR kits do not even publish results of one-step protocols on templates this long. In contrast the Eppendorf kit can consistently and reliably amplify this product from 10 ng of RNA from HELA cells.

Experiment 3: Two Step RT-PCR of short, long, rare and abundant transcripts from various sources of total RNA.



Fig. 3: Two Step RT-PCR of multiple targets and RNA sources. M: DNA Ladder Mix 0.110 kb (MBI Fermentas).

RT-PCR was performed on five genes that exhibit various levels of expression. In order to maximize sensitivity the RT reaction was performed separately from the PCR reaction. In the case of Alpha Tubulin and TNFR1, we were able to use a two-step protocol and combined the annealing and elongation step into a single 68 C step. As shown in fig. 3, all reactions worked well regardless of fragment length or copy number. Even Dynein, an extremely rare transcript that is
very long (12.3 kb), was efficiently amplified with the cMaster RTplusPCR. These results were extremely reproducible and show that the Eppendorf kit can be expected to give reliable results for difficult RT-PCR reactions.

Details for Fig. 3



Discussion

The cMaster RT is designed to provide maximum flexibility for all demanding RT and RT-PCR applications. A recombinant homo-dimeric viral reverse transcriptase together with a unique formulation of the RTplusPCR buffer allows efficient cDNA synthesis over a broad temperature range (37 C60 C) and product size (0.2 kb12.5 kb). The cMaster RTplusPCR enzyme mix uses a blend of thermostable DNA polymerases with proofreading assisted fidelity and high extension rate. Performing the One Step procedure, sensitive detection out of smallest amounts of total RNA and amplification of up to 5.3 kb cDNAs is possible (see Fig. 1 and Fig. 2). The Two Step protocol enables multiple cDNA targets to be amplified from an RT reaction, extending the PCR product size up to 12.3 kb (see Fig. 3). To further extend flexibility, the RT-only option of the system can be used to combine cMaster RT with any PCR system or to generate cDNA probes for other downstream applications, e.g. hybridization experiments.





'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Single-cell RT-PCR Analysis of Paramecium Primaurelia with the Eppendorf cMaster RTplusPCR System
2. New Mammalian Two-Hybrid System Detects Protein-Protein Interactions
3. Assess the In Vivo Activation of Signal Transduction Pathways with PathDetect Reporting Systems
4. Generate Adenovirus Vectors in E. coli by Homologous Recombination with the AdEasy Adenoviral Vector System
5. New Yeast Cloning System for Producing Proteins with Native Amino Acid Sequences
6. Enhanced PCR Cloning System
7. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
8. Performance Comparisons of Commercial RT-PCR Systems
9. Signal Transduction Reporting Systems Using Cis-Acting Enhancer Elements
10. Yeast Protein Production System Features High Yields and One-Step Purification
11. Detect Released Oligosaccharides Using the Eagle Eye II Still Video Imaging System
Post Your Comments:
(Date:6/30/2015)... , June 30, 2015  Juniper Pharmaceuticals, ... focused on developing therapeutics that address unmet medical ... George Elston will present at the ... Wednesday, July 8, 2015Time: , 4:45 PM EDTLocation: ... (live & archive): , www.juniperpharma.com, under  ,Investor, ...
(Date:6/30/2015)... Church, VA (PRWEB) , ... June 30, 2015 ... ... and strategy services to the federal government, announced in a paper published this ... scientists uncovered a potential problem with the diagnostic techniques currently used to detect ...
(Date:6/30/2015)... 2015  Custom Computer Specialists, Inc. ("Custom"), a leading ... silver sponsors of the Primary Care Development Corporation,s ("PCDC") ... lending their support of PCDC,s mission to expand access ... its founding in 1993, PCDC has been a key ... has financed over 100 completed primary care projects, valued ...
(Date:6/30/2015)... WATERLOO, ONTARIO (PRWEB) , ... June 30, 2015 ... ... case studies prior to launching SmartArch — a revolutionary new archwire that allows ... will provide further clinical evidence of the efficacy of SmartArch. “We’re thrilled about ...
Breaking Biology Technology:Juniper Pharmaceuticals to Present at Cantor Fitzgerald Inaugural Healthcare Conference on July 8, 2015 2Noblis and Government Scientists Identify New Genomic Signatures of Ebola Using Whole Genomic Sequencing and Innovative BioVelocity Analytics Tool 2Noblis and Government Scientists Identify New Genomic Signatures of Ebola Using Whole Genomic Sequencing and Innovative BioVelocity Analytics Tool 3Noblis and Government Scientists Identify New Genomic Signatures of Ebola Using Whole Genomic Sequencing and Innovative BioVelocity Analytics Tool 4Custom Computer Specialists Announces Sponsorship Of The Primary Care Development Corporation's Corporate Circle 2New case studies for SmartArch orthodontic archwire paves way to product launch later this year 2
... EDMONTON , May 11 /PRNewswire/ ... focused on developing medical device,products for use in ... has,received regulatory concurrence from the United States Food ... Occlusin(R) 500 Artificial,Embolization Device (OCL 500) in the ...
... GeneLink, Inc. (OTC Bulletin Board: GNLK), a leading consumer genomics biotech ... , , , ... , , ... Q4 2009 Comparable quarter gross profit improvement over Q1 2009 of 37% Q1 ...
... Cumberland Pharmaceuticals Inc. ( CPIX) and Phebra Pty Ltd. ... approval for marketing and sale in Australia . Acetadote, an injectable ... Goods Administration (TGA), the government agency responsible for regulating drugs and medical ... , , ...
Cached Biology Technology:IMBiotechnologies Receives FDA Clearance to Market Occlusin(R) 500 Biodegradable Microspheres in the U.S. 2IMBiotechnologies Receives FDA Clearance to Market Occlusin(R) 500 Biodegradable Microspheres in the U.S. 3GeneLink Reports First Quarter Gains 2Acetadote(R) Approved in Australia for Treatment of Acetaminophen Poisoning 2Acetadote(R) Approved in Australia for Treatment of Acetaminophen Poisoning 3Acetadote(R) Approved in Australia for Treatment of Acetaminophen Poisoning 4Acetadote(R) Approved in Australia for Treatment of Acetaminophen Poisoning 5
(Date:6/16/2015)... Fingerprint Cards (FPC) raises the revenue ... amount to at least 340 MSEK to that it will ... in market growth and orders received the revenue guidance for ... for 2015 will exceed 1,500 MSEK to an updated guidance ... Due to receipt of orders of touch fingerprint ...
(Date:6/15/2015)... NEW YORK , June 15, 2015 ... released today from Telstra reveals the majority of US consumers ... recognise them via biometrics, such as fingerprint and voiceprint, instead ... usernames. According to Telstra,s " Mobile Identity   ... " report, with smartphones now the primary channel ...
(Date:6/12/2015)... 12, 2015  Securus Technologies, a leading provider ... public safety, investigation, corrections and monitoring, announced the ... electronically capture, analyze and identify participants of a ... This system can: , ... and subsequent sign-on process is actually the person ...
Breaking Biology News(10 mins):Fingerprint Cards Raises the Revenue Guidance for Q2 2015 and for the Full Year 2015 2Fingerprint Cards Raises the Revenue Guidance for Q2 2015 and for the Full Year 2015 3One in Four US Consumers Would Share Their DNA With Their Bank to Secure Financial and Personal Information, Telstra Report Finds 2One in Four US Consumers Would Share Their DNA With Their Bank to Secure Financial and Personal Information, Telstra Report Finds 3One in Four US Consumers Would Share Their DNA With Their Bank to Secure Financial and Personal Information, Telstra Report Finds 4Securus Announces Patent Issued for Authorized Presence Verification During Video Visitation 2
... species of bacteria with cholesterol-busting properties has been discovered ... Dr Oliver Drzyzga and colleagues isolated the new bug, ... findings are reported in the current issue of the ... A steroid found in all body tissues, cholesterol ...
... Through sophisticated statistical analyses and advanced computer ... genomic patterns of human population structure around ... insights into the history of human evolution, ... populations, and the relationships among populations. ...
... By snipping off parts of male genitalia and reducing ... researchers induced a suite of changes in female reproduction, ... attempts by the females. "To the best of our ... female choice following experimental manipulation of both male and ...
Cached Biology News:Researchers gain genome-wide insights into patterns of the world's human population structures 2Researchers gain genome-wide insights into patterns of the world's human population structures 3
Purified anti-SOCS3...
Tumor Suppressor Sampler Kit 10 mu g each...
AMAP Multi Site-directed Mutagenesis Kit Research Focus: other Storage Temperature: -20C Shipping Temperature: dry ice...
Umbilical cord blood eosinophils, For immunohistochemistry (IHC)...
Biology Products: