Navigation Links
cMaster RTplusPCR System for increased sensitivity and product length ,,, in RT-PCR

Abstract

RT-PCR has become an essential method that allows researchers to determine the presence, structure and level of expression of an mRNA transcript in the organism, tissue or cell of interest. The basic protocol involves the synthesis of a cDNA copy of all the mRNA present in the sample, followed by amplification of the gene(s) of interest. Due to buffer incompatibilities, the two steps (RT and PCR) are often performed separately. While there are kits that combine the two steps into one, the limitations on sensitivity, due to the aforementioned buffer incompatibilities, are great. Eppendorf has designed a new kit with novel chemistries that allow for a more robust single-step RT-PCR reaction and even greater sensitivity in Two Step experiments. This paper examines the performance of this new kit.

Introduction

Reverse Transcription followed by PCR* (RT-PCR) is one of the most popular techniques for RNA analysis. One Step RT-PCR is the method of choice if many RNA samples need to be analyzed in parallel; the Two Step protocol is used for difficult targets or multiple target amplification from a single cDNA pool. The new Eppendorf cMaster RTplusPCR System enables the full range of RT-PCR applications. It contains a novel, recombinant reverse transcriptase, and a high fidelity PCR enzyme mix. In addition, the RTplusPCR buffer is formulated to adjust the Mg2+ concentration automatically, so that there is never a need for optimization of this critical component. This is achieved by weakly chelating Mg 2+ ions: when Mg2+ is present in excess, it is bound by the chelating agent, but as it is needed by the reaction (for Taq, or DNA), it is released. This novel technology increases the sensitivity and specificity of cMaster RTplusPCR. A single kit combines One- and Two Step RT-PCR protocols with high dynamic detection ranges and broad ranges of PCR product size (up to 5.3 kb for One Step reactions; up to 12.3 kb for Two Step protocols). The following experiments were designed to demonstrate the use of the kit in various applications.

The first experiment focuses on the extraordinary sensitivity of the new system with respect to One Step RT-PCR. Working with small amounts of target material is the most critical factor in One Step applications. Performing long range RT-PCR in a One Step protocol is no longer a problem as demonstrated in experiment two. The novel buffer system in the kit allows optimal processivity of both the reverse transcriptase and proofreading polymerase mix. The optional Two Step RT-PCR protocol provided in the system is adaptable to a wide range of templates. Experiment three depicts amplification of various templates. Whether moderately sized or very long, low- or high abundance, the new system offers a comprehensive
solution for all RT targets.

Materials and Methods

Eppendorf cMaster RTplusPCR System
Eppendorf Perfect RNA Eukaryotic Kit
All PCR* reactions were performed on the Eppendorf Mastercycler gradient.

Experiment 1: One Step, Sensitivity Test

Target for RT-PCR amplification: human Alpha Tubulin mRNA, a 500 fragment. Template RNA: total RNA purified from human HELA cells. Template concentrations in the reactions ranged from 1 g down to 10 pg. Protocol: Eppendorf cMaster RTplusPCR System, standard One Step RT-PCR protocol. 50 l reactions in 1:10 diluted RTplusPCR Buffer at 2.5 mM final Magnesium concentration.

Set-up for One Step RT-PCR reactions



Cycling program parameters



Experiment 2: One Step, Long Range

Target for RT-PCR amplification: human Tuberous Sclerosis Factor (hTSF) mRNA, a 5.3 kb fragment. Template RNA: total RNA purified from human HELA cells, template concentrations in the reactions are 100 and 10 ng.
Protocol: Eppendorf cMaster RTplusPCR Kit, special One Step
RT-PCR protocol for long templates.

Set-up for One Step RT-PCR reactions



Cycling program parameters



Experiment 3: Two Step RT-PCR

Targets for Two Step RT-PCR amplification:

Alpha Tubulin mRNA (mouse and human), 500 bp fragment
Tumor Necrosis Factor Receptor (TNFR1) mRNA (mouse and human), 1.3 kb fragment
Human Tuberous Sclerosis Factor (hTSF) mRNA, 5.3 kb fragment
Mouse Dynein mRNA, 12.3 kb fragment
Protocol: Eppendorf cMaster RTplusPCR Kit, Two Step RT-PCR
protocol for standard sized and long templates (manual). All reverse
transcription reactions were primed with 0.5 g Oligo(dT)20 primer.


Set-up for the first step RT reaction



Set-up for the second step PCR reaction



Set-up for RT reaction



Two step cycling program used for Tubulin and TNFR1



Three step cycling program used for hTSF and Dynein



Target size, elongation time and annealing temperatures used



Primers used

Tubulin forward: CACCCGTCTTCAGGGCTTCTTGGTTT
Tubulin reverse: CATTTCACCATCTGGTTGGCTGGCTC
TNFR forward: CCACCATCTCGGTCATCAGGATTGCCT
TNFR reverse: TTCTCATGGAAGCTATGGGTATCACAT
hTSF forward: GGAGTTTATCATCACCGCGGAAATACTGAGAG
hTSF reverse: TATTTCACTGACAGGCAATACCGTCCAAGG
Dynein forward: CGGCGCTGGAGGAGAA
Dynein reverse: AGGTGGTGGCTCAAACACAAAG

Results

Experiment 1: Sensitivity of One Step RT-PCR


Fig. 1: One Step RT-PCR amplification of an
Alpha Tubulin cDNA fragment from various
amounts of total RNA.
Lane 1: 1 g
Lane 2: 100 ng
Lane 3: 10 ng
Lane 4: 1 ng
Lane 5: 100 pg
Lane 6: 10 pg
M: 100 bp ladder (NEB)

The cMaster RTplusPCR System shows a high dynamic range of product yield depending on the amount of template RNA. Alpha Tubulin mRNA can be detected in HELA RNA down to 10 pg of total RNA.

Experiment 2: Long range One Step RT-PCR with various amounts of total RNA



Fig. 2: Long range One Step RT-PCR of the human
Tuberous Sclerosis Factor mRNA.
M: DNA Ruler LadderMix 0.110 kb (MBI Fermentas).
Lane 1: 100 ng total RNA
Lane 2: 10 ng total RNA
Lane 3: 0 ng total RNA (negative control)

As shown in Fig. 2, a 5.3 kb hTSF PCR product is detectable in 100 and 10 ng of total RNA using the One Step RT-PCR protocol. This is a very difficult PCR at best, and most manufacturers of RT-PCR kits do not even publish results of one-step protocols on templates this long. In contrast the Eppendorf kit can consistently and reliably amplify this product from 10 ng of RNA from HELA cells.

Experiment 3: Two Step RT-PCR of short, long, rare and abundant transcripts from various sources of total RNA.



Fig. 3: Two Step RT-PCR of multiple targets and RNA sources. M: DNA Ladder Mix 0.110 kb (MBI Fermentas).

RT-PCR was performed on five genes that exhibit various levels of expression. In order to maximize sensitivity the RT reaction was performed separately from the PCR reaction. In the case of Alpha Tubulin and TNFR1, we were able to use a two-step protocol and combined the annealing and elongation step into a single 68 C step. As shown in fig. 3, all reactions worked well regardless of fragment length or copy number. Even Dynein, an extremely rare transcript that is
very long (12.3 kb), was efficiently amplified with the cMaster RTplusPCR. These results were extremely reproducible and show that the Eppendorf kit can be expected to give reliable results for difficult RT-PCR reactions.

Details for Fig. 3



Discussion

The cMaster RT is designed to provide maximum flexibility for all demanding RT and RT-PCR applications. A recombinant homo-dimeric viral reverse transcriptase together with a unique formulation of the RTplusPCR buffer allows efficient cDNA synthesis over a broad temperature range (37 C60 C) and product size (0.2 kb12.5 kb). The cMaster RTplusPCR enzyme mix uses a blend of thermostable DNA polymerases with proofreading assisted fidelity and high extension rate. Performing the One Step procedure, sensitive detection out of smallest amounts of total RNA and amplification of up to 5.3 kb cDNAs is possible (see Fig. 1 and Fig. 2). The Two Step protocol enables multiple cDNA targets to be amplified from an RT reaction, extending the PCR product size up to 12.3 kb (see Fig. 3). To further extend flexibility, the RT-only option of the system can be used to combine cMaster RT with any PCR system or to generate cDNA probes for other downstream applications, e.g. hybridization experiments.





'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Single-cell RT-PCR Analysis of Paramecium Primaurelia with the Eppendorf cMaster RTplusPCR System
2. New Mammalian Two-Hybrid System Detects Protein-Protein Interactions
3. Assess the In Vivo Activation of Signal Transduction Pathways with PathDetect Reporting Systems
4. Generate Adenovirus Vectors in E. coli by Homologous Recombination with the AdEasy Adenoviral Vector System
5. New Yeast Cloning System for Producing Proteins with Native Amino Acid Sequences
6. Enhanced PCR Cloning System
7. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
8. Performance Comparisons of Commercial RT-PCR Systems
9. Signal Transduction Reporting Systems Using Cis-Acting Enhancer Elements
10. Yeast Protein Production System Features High Yields and One-Step Purification
11. Detect Released Oligosaccharides Using the Eagle Eye II Still Video Imaging System
Post Your Comments:
(Date:8/3/2015)... At the 11th hour, ... the shortfall of Jude Liversage,s campaign so ... first time.      (Photo: http://photos.prnewswire.com/prnh/20150803/254228 ... The Selective Dorsal Rhizotomy (SDR) procedure reduced ... out his wish to kick a ball around like ...
(Date:8/3/2015)... Medical, Inc. (Nasdaq: AEMD ), the pioneer in ... announced that it will host its First Quarter Fiscal ... 13, 2015 at 4:30 p.m. Eastern Time. ... fiscal 2016 first quarter results.  A recorded version of ... the call at the Investor Relations portion of the ...
(Date:8/3/2015)... (PRWEB) , ... August 03, 2015 , ... ... TLD5000 diaphragm vacuum pumps to its comprehensive line of analytical laboratory equipment. With ... valves, these versatile pumps provide a chemically resistant and maintenance-free solution for a ...
(Date:7/30/2015)... Marshall, MN (PRWEB) , ... July 31, 2015 , ... ... Ralco Enrichment Center at the Lyon County Fair to be held August 5-9 in ... more about where their meals come from and how agriculture impacts their daily lives. ...
Breaking Biology Technology:Cerebral Palsy Operation by The Portland Hospital Allows a Boy to Stand Properly for the First Time 2Cerebral Palsy Operation by The Portland Hospital Allows a Boy to Stand Properly for the First Time 3Aethlon Medical To Host First Quarter Fiscal 2016 Investor Call on August 13, 2015 2Sterlitech Launches New Line of Vacuum Pumps 2Ralco Announces Primary Sponsorship of Ralco Enrichment Center at Lyon County Fair 2
... Facility, NEW YORK, Oct. 27 NeoStem, Inc. ... pre-disease collection,processing and long-term storage of adult stem cells ... on a private placement financing,in the amount of $250,000. ... stem cell collection network in the New York City ...
... Nile Therapeutics,Inc., (Nasdaq: NLTX ), announced today ... 7th Annual BIO Investor Forum on Thursday,October 30th, at ... Francisco., Mr. Strumph will provide an overview of ... interim data from Nile,s Phase 2a,study for its lead ...
... BURR RIDGE, Ill., Oct. 27 GSI ... company specializing in,printed electronics; sensors, electrodes, electroluminescent ... with NTERA, Inc. for,flexible printed display technologies. ... the NanoChromics(TM) technology has now been produced ...
Cached Biology Technology:NeoStem Secures $250,000 in an Above Market Financing and Expands Its Relationship With New England Cryogenic Center, Inc. 2NeoStem Secures $250,000 in an Above Market Financing and Expands Its Relationship With New England Cryogenic Center, Inc. 3Nile Therapeutics to Present at the 7th Annual BIO Investor Forum 2Electrochromic Display Technology Announcement 2
(Date:7/31/2015)... de 2015 BGI llevará a cabo la 10ª ... al 25 de octubre de 2015, en ... su décimo aniversario este año. Desde su inauguración en ... reuniones anuales más influyentes del mundo en los campos ... científicas más dinámicas, entusiastas y amenas. ICG-10 ...
(Date:7/31/2015)... 31, 2015 NXT-ID, Inc. (NASDAQ: NXTD ) ... on the growing mobile commerce market and creator of ... provisional patent 62/198989 for ELECTRONIC CRYPTO-CURRENCY MANAGEMENT ... method to advance crypto-currencies such as Bitcoin into the ... uniform way to manage all payments.  ...
(Date:7/23/2015)... 23, 2015 Aware, Inc. (NASDAQ: AWRE ), ... financial results for its second quarter ended June 30, 2015.  ... was $4.5 million, a decrease of 33% compared to $6.8 ... the second quarter of 2015 was $0.3 million, or $0.01 ... per diluted share, in the same period a year ago.  ...
Breaking Biology News(10 mins):La 10ª Conferencia Internacional sobre Genómica (ICG-10) comienza en octubre 2La 10ª Conferencia Internacional sobre Genómica (ICG-10) comienza en octubre 3NXT-ID Patents Electronic Crypto-Currency Management Technology 2NXT-ID Patents Electronic Crypto-Currency Management Technology 3NXT-ID Patents Electronic Crypto-Currency Management Technology 4Aware, Inc. Reports Second Quarter 2015 Financial Results 2Aware, Inc. Reports Second Quarter 2015 Financial Results 3Aware, Inc. Reports Second Quarter 2015 Financial Results 4Aware, Inc. Reports Second Quarter 2015 Financial Results 5Aware, Inc. Reports Second Quarter 2015 Financial Results 6
... traced the origin of Plasmodium vivax , the second-worst ... published this week in Nature Communications . Until recently, ... were found only in Asian macaques, leading researchers to believe ... The study, led by researchers from the Perelman School of ...
... DNA sequencing technologies have enormous potential for the ... these new technologies, researchers are able to greatly ... key to applications including plant breeding and physiology. ... (or phylogenetic) relationships among different plant species have ...
... a spectrum of signals from hormones within a plant. ... in the roots of plants, and their journey to ... plant development. Though these phytohormones have been identified in ... within plants was previously poorly understood. Now, a ...
Cached Biology News:The parasite that escaped out of Africa 2The parasite that escaped out of Africa 3The parasite that escaped out of Africa 4Sequencing hundreds of nuclear genes in the sunflower family now possible 2Sequencing hundreds of nuclear genes in the sunflower family now possible 3Roots to shoots: Hormone transport in plants deciphered 2
... As research demands continue to grow, the ... spectral information has become necessary, especially when ... colors. The innovative C1si Confocal Microscope System ... and spectral capability not available in conventional ...
... is described by end-users to be "a ... fundamentals of light microscopy and electronic imaging. ... it does not require much space and ... lab environment. The DM-BA300 combines Motic's own ...
... for individual and parallel agitation control ,Single ... DASGIP vessels, featuring range of stirring speeds ... 16 overhead drives can be operated as ... and cellferm-pro® for microbiology and cell culture. ...
... Life Science LAS-3000 imaging system combines ... simplified user interface, providing significantly improved ... of modularities. The system is especially ... perfect standard system for Western blotting ...
Biology Products: