Navigation Links
cMaster RTplusPCR System for increased sensitivity and product length ,,, in RT-PCR

Abstract

RT-PCR has become an essential method that allows researchers to determine the presence, structure and level of expression of an mRNA transcript in the organism, tissue or cell of interest. The basic protocol involves the synthesis of a cDNA copy of all the mRNA present in the sample, followed by amplification of the gene(s) of interest. Due to buffer incompatibilities, the two steps (RT and PCR) are often performed separately. While there are kits that combine the two steps into one, the limitations on sensitivity, due to the aforementioned buffer incompatibilities, are great. Eppendorf has designed a new kit with novel chemistries that allow for a more robust single-step RT-PCR reaction and even greater sensitivity in Two Step experiments. This paper examines the performance of this new kit.

Introduction

Reverse Transcription followed by PCR* (RT-PCR) is one of the most popular techniques for RNA analysis. One Step RT-PCR is the method of choice if many RNA samples need to be analyzed in parallel; the Two Step protocol is used for difficult targets or multiple target amplification from a single cDNA pool. The new Eppendorf cMaster RTplusPCR System enables the full range of RT-PCR applications. It contains a novel, recombinant reverse transcriptase, and a high fidelity PCR enzyme mix. In addition, the RTplusPCR buffer is formulated to adjust the Mg2+ concentration automatically, so that there is never a need for optimization of this critical component. This is achieved by weakly chelating Mg 2+ ions: when Mg2+ is present in excess, it is bound by the chelating agent, but as it is needed by the reaction (for Taq, or DNA), it is released. This novel technology increases the sensitivity and specificity of cMaster RTplusPCR. A single kit combines One- and Two Step RT-PCR protocols with high dynamic detection ranges and broad ranges of PCR product size (up to 5.3 kb for One Step reactions; up to 12.3 kb for Two Step protocols). The following experiments were designed to demonstrate the use of the kit in various applications.

The first experiment focuses on the extraordinary sensitivity of the new system with respect to One Step RT-PCR. Working with small amounts of target material is the most critical factor in One Step applications. Performing long range RT-PCR in a One Step protocol is no longer a problem as demonstrated in experiment two. The novel buffer system in the kit allows optimal processivity of both the reverse transcriptase and proofreading polymerase mix. The optional Two Step RT-PCR protocol provided in the system is adaptable to a wide range of templates. Experiment three depicts amplification of various templates. Whether moderately sized or very long, low- or high abundance, the new system offers a comprehensive
solution for all RT targets.

Materials and Methods

Eppendorf cMaster RTplusPCR System
Eppendorf Perfect RNA Eukaryotic Kit
All PCR* reactions were performed on the Eppendorf Mastercycler gradient.

Experiment 1: One Step, Sensitivity Test

Target for RT-PCR amplification: human Alpha Tubulin mRNA, a 500 fragment. Template RNA: total RNA purified from human HELA cells. Template concentrations in the reactions ranged from 1 g down to 10 pg. Protocol: Eppendorf cMaster RTplusPCR System, standard One Step RT-PCR protocol. 50 l reactions in 1:10 diluted RTplusPCR Buffer at 2.5 mM final Magnesium concentration.

Set-up for One Step RT-PCR reactions



Cycling program parameters



Experiment 2: One Step, Long Range

Target for RT-PCR amplification: human Tuberous Sclerosis Factor (hTSF) mRNA, a 5.3 kb fragment. Template RNA: total RNA purified from human HELA cells, template concentrations in the reactions are 100 and 10 ng.
Protocol: Eppendorf cMaster RTplusPCR Kit, special One Step
RT-PCR protocol for long templates.

Set-up for One Step RT-PCR reactions



Cycling program parameters



Experiment 3: Two Step RT-PCR

Targets for Two Step RT-PCR amplification:

Alpha Tubulin mRNA (mouse and human), 500 bp fragment
Tumor Necrosis Factor Receptor (TNFR1) mRNA (mouse and human), 1.3 kb fragment
Human Tuberous Sclerosis Factor (hTSF) mRNA, 5.3 kb fragment
Mouse Dynein mRNA, 12.3 kb fragment
Protocol: Eppendorf cMaster RTplusPCR Kit, Two Step RT-PCR
protocol for standard sized and long templates (manual). All reverse
transcription reactions were primed with 0.5 g Oligo(dT)20 primer.


Set-up for the first step RT reaction



Set-up for the second step PCR reaction



Set-up for RT reaction



Two step cycling program used for Tubulin and TNFR1



Three step cycling program used for hTSF and Dynein



Target size, elongation time and annealing temperatures used



Primers used

Tubulin forward: CACCCGTCTTCAGGGCTTCTTGGTTT
Tubulin reverse: CATTTCACCATCTGGTTGGCTGGCTC
TNFR forward: CCACCATCTCGGTCATCAGGATTGCCT
TNFR reverse: TTCTCATGGAAGCTATGGGTATCACAT
hTSF forward: GGAGTTTATCATCACCGCGGAAATACTGAGAG
hTSF reverse: TATTTCACTGACAGGCAATACCGTCCAAGG
Dynein forward: CGGCGCTGGAGGAGAA
Dynein reverse: AGGTGGTGGCTCAAACACAAAG

Results

Experiment 1: Sensitivity of One Step RT-PCR


Fig. 1: One Step RT-PCR amplification of an
Alpha Tubulin cDNA fragment from various
amounts of total RNA.
Lane 1: 1 g
Lane 2: 100 ng
Lane 3: 10 ng
Lane 4: 1 ng
Lane 5: 100 pg
Lane 6: 10 pg
M: 100 bp ladder (NEB)

The cMaster RTplusPCR System shows a high dynamic range of product yield depending on the amount of template RNA. Alpha Tubulin mRNA can be detected in HELA RNA down to 10 pg of total RNA.

Experiment 2: Long range One Step RT-PCR with various amounts of total RNA



Fig. 2: Long range One Step RT-PCR of the human
Tuberous Sclerosis Factor mRNA.
M: DNA Ruler LadderMix 0.110 kb (MBI Fermentas).
Lane 1: 100 ng total RNA
Lane 2: 10 ng total RNA
Lane 3: 0 ng total RNA (negative control)

As shown in Fig. 2, a 5.3 kb hTSF PCR product is detectable in 100 and 10 ng of total RNA using the One Step RT-PCR protocol. This is a very difficult PCR at best, and most manufacturers of RT-PCR kits do not even publish results of one-step protocols on templates this long. In contrast the Eppendorf kit can consistently and reliably amplify this product from 10 ng of RNA from HELA cells.

Experiment 3: Two Step RT-PCR of short, long, rare and abundant transcripts from various sources of total RNA.



Fig. 3: Two Step RT-PCR of multiple targets and RNA sources. M: DNA Ladder Mix 0.110 kb (MBI Fermentas).

RT-PCR was performed on five genes that exhibit various levels of expression. In order to maximize sensitivity the RT reaction was performed separately from the PCR reaction. In the case of Alpha Tubulin and TNFR1, we were able to use a two-step protocol and combined the annealing and elongation step into a single 68 C step. As shown in fig. 3, all reactions worked well regardless of fragment length or copy number. Even Dynein, an extremely rare transcript that is
very long (12.3 kb), was efficiently amplified with the cMaster RTplusPCR. These results were extremely reproducible and show that the Eppendorf kit can be expected to give reliable results for difficult RT-PCR reactions.

Details for Fig. 3



Discussion

The cMaster RT is designed to provide maximum flexibility for all demanding RT and RT-PCR applications. A recombinant homo-dimeric viral reverse transcriptase together with a unique formulation of the RTplusPCR buffer allows efficient cDNA synthesis over a broad temperature range (37 C60 C) and product size (0.2 kb12.5 kb). The cMaster RTplusPCR enzyme mix uses a blend of thermostable DNA polymerases with proofreading assisted fidelity and high extension rate. Performing the One Step procedure, sensitive detection out of smallest amounts of total RNA and amplification of up to 5.3 kb cDNAs is possible (see Fig. 1 and Fig. 2). The Two Step protocol enables multiple cDNA targets to be amplified from an RT reaction, extending the PCR product size up to 12.3 kb (see Fig. 3). To further extend flexibility, the RT-only option of the system can be used to combine cMaster RT with any PCR system or to generate cDNA probes for other downstream applications, e.g. hybridization experiments.





'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Single-cell RT-PCR Analysis of Paramecium Primaurelia with the Eppendorf cMaster RTplusPCR System
2. New Mammalian Two-Hybrid System Detects Protein-Protein Interactions
3. Assess the In Vivo Activation of Signal Transduction Pathways with PathDetect Reporting Systems
4. Generate Adenovirus Vectors in E. coli by Homologous Recombination with the AdEasy Adenoviral Vector System
5. New Yeast Cloning System for Producing Proteins with Native Amino Acid Sequences
6. Enhanced PCR Cloning System
7. prostar RT-PCR Systems for Robust High-Fidelity RNA Amplification
8. Performance Comparisons of Commercial RT-PCR Systems
9. Signal Transduction Reporting Systems Using Cis-Acting Enhancer Elements
10. Yeast Protein Production System Features High Yields and One-Step Purification
11. Detect Released Oligosaccharides Using the Eagle Eye II Still Video Imaging System
Post Your Comments:
(Date:3/30/2015)... - A new national Labour Market Information (LMI) report ... of new graduates entering the biotech sector. The BioTalent ... New Grads in Biotech," is sponsored in part by ... and features data collected from new graduates that participated ... 2013 to 2015. Among the interesting trends ...
(Date:3/30/2015)... PARK, N.J. , March 30, 2015 /PRNewswire/ ... (PAMORA) under development by Shionogi & Co., Ltd., ... phase III study (COMPOSE I) for the treatment ... chronic non-cancer pain receiving opioid therapy. Study results ... daily) statistically significantly improved the frequency of spontaneous ...
(Date:3/29/2015)... March 29, 2015 Caris Life ... study data showing the presence of PD-1 ... cancer samples. Using Caris Molecular Intelligence®, the ... identified expression of programmed cell death protein-1 ... histology while its ligand (PD-L1) expression was ...
(Date:3/27/2015)...  Neogen Corporation (NASDAQ: NEOG ) announced today ... plan in accordance with Securities and Exchange Commission rule ... Neogen Corporation, is a minority owner of this entity ... Herbert does not have control of this entity, ... only for a portion of the shares owned by ...
Breaking Biology Technology:New Report on Graduates in Canadian Biotech Industry Sheds Light on Hiring Practices 2New Report on Graduates in Canadian Biotech Industry Sheds Light on Hiring Practices 3New Report on Graduates in Canadian Biotech Industry Sheds Light on Hiring Practices 4Shionogi & Co., Ltd. Announces That Naldemedine Meets Primary Endpoint In A Phase 3 Study For The Treatment Of Opioid-Induced Constipation 2Shionogi & Co., Ltd. Announces That Naldemedine Meets Primary Endpoint In A Phase 3 Study For The Treatment Of Opioid-Induced Constipation 3Caris Life Sciences' Multiplatform Tumor Profiling Technology Identifies Expression of PD-1 and PD-L1 in Gynecologic Malignancies 2Caris Life Sciences' Multiplatform Tumor Profiling Technology Identifies Expression of PD-1 and PD-L1 in Gynecologic Malignancies 3Caris Life Sciences' Multiplatform Tumor Profiling Technology Identifies Expression of PD-1 and PD-L1 in Gynecologic Malignancies 4Neogen CEO adopts 10b5-1 Trading Plan 2
... YORK, May 20 Keryx Biopharmaceuticals, Inc. (the "Company") (Nasdaq: ... Bentsur as Chief Executive Officer of the Company. It is ... of Directors at the annual meeting of the board on ... Board of Directors, stated, "On behalf of the Board, I ...
... Germany will present itself as one of ... year,s BIO,International Convention. Under the "Breakthroughs in Regenerative ... insight into the,latest research results in the area ... and the regulatory framework conditions will be,introduced in ...
... May 20 deCODE genetics,(Nasdaq: DCGN ... isolation and,genotyping laboratory, which processes the company,s ... tests for several common,diseases, has been accredited ... a recent inspection. The U.S. Centers for ...
Cached Biology Technology:Keryx Biopharmaceuticals Announces Appointment of Ron Bentsur as Chief Executive Officer 2Keryx Biopharmaceuticals Announces Appointment of Ron Bentsur as Chief Executive Officer 3Keryx Biopharmaceuticals Announces Appointment of Ron Bentsur as Chief Executive Officer 4BIO International Convention 2009: Research Location Germany Presents Potential in Regenerative Medicine 2deCODE Genotyping Laboratory Receives College of American Pathologists Accreditation 2deCODE Genotyping Laboratory Receives College of American Pathologists Accreditation 3deCODE Genotyping Laboratory Receives College of American Pathologists Accreditation 4
(Date:3/3/2015)... , March 3, 2015 ... provider of advanced cryogenic logistics solutions for ... immunotherapies, stem cells, cell lines, clinical research ... medicine, today announced the expansion of its ... Centers, ("Fred Hutch") Clinical Research Division ...
(Date:3/2/2015)... , March 2, 2015   Neurotechnology , a ... introduced the SentiGaze Software Development Kit (SDK). ... applications that use off-the-shelf webcams to track eye movements ... at a monitor. Heatmaps can be used for applications ... of online advertising. The SDK can also be used ...
(Date:2/24/2015)... 24, 2015 This report analyzes the worldwide markets for ... Face Biometrics, and Voice Biometrics. The report provides separate comprehensive analytics ... , Europe , Asia-Pacific ... , and Latin America . Annual estimates ... a seven-year historic analysis is provided for these markets. Market data ...
Breaking Biology News(10 mins):Cryoport, Inc. Expands Support of Fred Hutchinson Cancer Research Center's Clinical Research Division 2Cryoport, Inc. Expands Support of Fred Hutchinson Cancer Research Center's Clinical Research Division 3Neurotechnology Releases SentiGaze SDK for Eye Movement Tracking Using Ordinary Webcams 2Neurotechnology Releases SentiGaze SDK for Eye Movement Tracking Using Ordinary Webcams 3World Face and Voice Biometrics Industry 2World Face and Voice Biometrics Industry 3World Face and Voice Biometrics Industry 4World Face and Voice Biometrics Industry 5World Face and Voice Biometrics Industry 6World Face and Voice Biometrics Industry 7World Face and Voice Biometrics Industry 8World Face and Voice Biometrics Industry 9World Face and Voice Biometrics Industry 10World Face and Voice Biometrics Industry 11World Face and Voice Biometrics Industry 12World Face and Voice Biometrics Industry 13World Face and Voice Biometrics Industry 14World Face and Voice Biometrics Industry 15World Face and Voice Biometrics Industry 16
... and Avalon Technology partner on new ... aviation-related ... Inc.,(OTC Bulletin Board: CTHH) ( http://www.catcherinc.com ), a leader ... Technology ( http://www.avalontechnology.com ), a leading,integrator of managed mobile ...
... resulting from higher CO2 could boost the amount ... new study looks at a poorly understood process ... Sayer, postdoctoral fellow at the Smithsonian Tropical Research ... University of Minnesotas Department of Ecology, Evolution and ...
... Boulder, CO, USA Two hundred years ago Lewis and ... deal of scientific research with its descriptions of territory acquired ... be disappointed by the absence of living megafauna, the area ... volume published by the Geological Society of America makes clear ...
Cached Biology News:CATCHER to be Deployed at Major U.S. Airline 2CATCHER to be Deployed at Major U.S. Airline 3CATCHER to be Deployed at Major U.S. Airline 4Complex carbon picture clearer 2
MOUSE ANTI HUMAN COMPLEMENT SC5B-9...
MOUSE ANTI SIMIAN VIRUS 5 Immunogen: Simian virus 5...
... Beagle serum is collected from fasted Beagle canines ... Available Anticoagulants: N-02: Citrate ... K2EDTA N-08: Potassium Oxalate N-10: ... N-05: ACD N-07: CPD ...
MOUSE ANTI BOVINE TROPONIN I...
Biology Products: