Navigation Links
QIAGEN Instrument Service insist on the best in service and support

QIAGEN Instrument Service applies molecular biology and engineering expertise to guarantee you optimal performance in your molecular biology applications. QIAGEN Instrument Service provides customized agreements to fit your application requirements from small-scale research and general liquid-handling applications, to fully integrated automation systems for functional genomics, gene expression analysis, proteomics, and drug discovery.

QIAGEN Instrument Service offers:
  • A wide range of Service Support Agreements - flexible agreements for service coverage
  • Extended warranty coverage for our BioRobot systems and many other instrument brands
  • Guaranteed repairs and upgrades all parts are certified, with services offered in a timely manner
  • Comprehensive application support consultative services for creating and optimizing applications
  • Preventive maintenance for reduced downtime and traceable service histories
Cancer siRNA Oligo Set Version 1.0 for screening large numbers of genes using RNAi techniques The Cancer siRNA Oligo Set Version 1.0 is the first disease-specific short interfering RNA (siRNA) set for the life sciences market. This discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics studies using RNA interference (RNAi). The Cancer siRNA Oligo Set Version 1.0 offers:
  • A comprehensive set of genes - two siRNAs to each of 139 human cancerrelated genes and positive- and ne gative-control siRNAs
  • Efficient gene silencing high-purity, HPLC-purified siRNA
  • State-of-the-art siRNA design to maxmize gene-silencing potential
  • A cost-efficient method to study large numbers of genes economically
Cost-effective screening of multiple genes

The application of RNAi technology to mammalian cells has revolutionized the field of functional genomics. In RNAi, genespecific inhibition is mediated by short
double-stranded RNA (dsRNA) that has a short sequence homologous to a region of the mRNA transcribed from the target gene. The ability to simply, effectively, and specifically down-regulate the expression of genes in mammalian cells holds enormous scientific, commercial, and therapeutic potential. With the growing acceptance and adoption of siRNA, methodologies are required that offer an economical way to study larger numbers of genes. The Cancer siRNA Oligo Set provides a cost-efficient method by which a large number of cancerrelated genes can be studied.

Highly efficient silencing of cancer-related genes

The cancer-related genes in the Cancer siRNA Oligo Set were chosen in collaboration with leading academic cancer researchers (see Table 1 for a list of genes). Each siRNA has been designed using state-of-the-art criteria to give a high success rate in gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-str anded oligos are purified by HPLC and annealed. The final siRNA duplex is
>97% pure. Table 1. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB
YES1 In addition to 2 siRNAs to each of 139 cancer genes, the Cancer siRNA Oligo Set includes a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled transfection controls, all supplied at 1 nmol. Comprehensive information is included, with gene list, GenBank accession numbers, and
sequences and positions of the siRNA within the relevant gene (see Table 2).
Table 2. Examples of siRNA target sequence information Gene
UniGene Target
siRNA target %GC
ABCB1 NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1 NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4 NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4 NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52 Summary By offering a large number of siRNAs at an economical price, the Cancer siRNA Set provides researchers with a valuableresearch tool to screen a large number of cancer-related genes. Used in conjunction with TransMessenger. Transfection Reagent, which provides highly efficient transfection of
siRNA, this set provides an excellent opportunity to clarify the genetic regulation of cancers using RNAi techniques. QIAGEN offers a custom siRNA Oligonucleotide Synthesis Service and a variety of library siRNA duplexes for common target genes. For further information see



Page: All 1 2 3 4 5 6

Related biology technology :

1. The QIAGEN Guide to Animal Cell Culture
2. The QIAGEN Guide to Animal Cell Culture
3. The QIAGEN Guide to Animal Cell Culture
4. The QIAGEN Guide to Animal Cell Culture
5. The QIAGEN Guide to Animal Cell Culture
6. The QIAGEN Guide to Animal Cell Culture
7. QIAGEN Multiplex PCR Handbook
8. QIAGEN Multiplex PCR Kit
9. QIAGEN Plasmid Kits
10. Laser microdissection and nucleic acid purification - a Leica - QIAGEN cooperation
11. QIAGEN PCR CloningPlus Kit
Post Your Comments:

(Date:8/7/2019)... ... ... Locus Agricultural Solutions (Locus AG) reports record levels of carbon sequestered in ... ® , which is pulling up to 121% more carbon into the soil than ... from the treatment of almonds, cherries, turf/sod, grapes and citrus across the U.S., as ...
(Date:8/6/2019)... ... August 06, 2019 , ... Shoreline Biome, ... the strain level, has announced partnerships with six international distributors. , The ... research organizations in Australia, Benelux, Indonesia, Korea, Malaysia, Myanmar, New Zealand, Singapore, the ...
(Date:8/6/2019)... EDWARDSVILLE, Ill. (PRWEB) , ... August 06, 2019 ... ... to Southern Illinois University Edwardsville for the launch of a community project that ... , The three-year grant supports the project, entitled “A Youth-Led Citizen Science Network ...
(Date:7/30/2019)... ... July 30, 2019 , ... ... team building and cooking events company. Not only has the company already hosted ... started offering Private Cooking Parties to its guests. , With Lajollacooks4u’s Private Cooking ...
Breaking Biology Technology:
(Date:8/14/2019)... Fla. (PRWEB) , ... August 14, 2019 , ... ... to broadcast 4Q/2019, will explore how developments in microbiome therapeutics are helping to ... local listings for more information. , Advancements will educate about the DECODE.DESIGN.CURE™ technology ...
(Date:8/14/2019)... ... August 14, 2019 , ... Join Jonathan Riek, PhD, VP, ... on Tuesday, September 10, 2019 at 1pm EDT to learn about two common imaging ... , NAFLD is the most common diffuse liver disease, with a worldwide prevalence ...
(Date:8/14/2019)... JOLLA, Calif. (PRWEB) , ... August 14, 2019 , ... ... insight into their future children, announces inclusion in the 38th annual Inc. 500|5000 ... been eligible to apply. To qualify, companies must have been founded and generating revenue ...
Breaking Biology News(10 mins):