Navigation Links
QIAGEN Instrument Service insist on the best in service and support

QIAGEN Instrument Service applies molecular biology and engineering expertise to guarantee you optimal performance in your molecular biology applications. QIAGEN Instrument Service provides customized agreements to fit your application requirements from small-scale research and general liquid-handling applications, to fully integrated automation systems for functional genomics, gene expression analysis, proteomics, and drug discovery.

QIAGEN Instrument Service offers:
  • A wide range of Service Support Agreements - flexible agreements for service coverage
  • Extended warranty coverage for our BioRobot systems and many other instrument brands
  • Guaranteed repairs and upgrades all parts are certified, with services offered in a timely manner
  • Comprehensive application support consultative services for creating and optimizing applications
  • Preventive maintenance for reduced downtime and traceable service histories
Cancer siRNA Oligo Set Version 1.0 for screening large numbers of genes using RNAi techniques The Cancer siRNA Oligo Set Version 1.0 is the first disease-specific short interfering RNA (siRNA) set for the life sciences market. This discovery tool allows gene-silencing studies of 139 human cancer-related genes for functional genomics studies using RNA interference (RNAi). The Cancer siRNA Oligo Set Version 1.0 offers:
  • A comprehensive set of genes - two siRNAs to each of 139 human cancerrelated genes and positive- and ne gative-control siRNAs
  • Efficient gene silencing high-purity, HPLC-purified siRNA
  • State-of-the-art siRNA design to maxmize gene-silencing potential
  • A cost-efficient method to study large numbers of genes economically
Cost-effective screening of multiple genes

The application of RNAi technology to mammalian cells has revolutionized the field of functional genomics. In RNAi, genespecific inhibition is mediated by short
double-stranded RNA (dsRNA) that has a short sequence homologous to a region of the mRNA transcribed from the target gene. The ability to simply, effectively, and specifically down-regulate the expression of genes in mammalian cells holds enormous scientific, commercial, and therapeutic potential. With the growing acceptance and adoption of siRNA, methodologies are required that offer an economical way to study larger numbers of genes. The Cancer siRNA Oligo Set provides a cost-efficient method by which a large number of cancerrelated genes can be studied.

Highly efficient silencing of cancer-related genes

The cancer-related genes in the Cancer siRNA Oligo Set were chosen in collaboration with leading academic cancer researchers (see Table 1 for a list of genes). Each siRNA has been designed using state-of-the-art criteria to give a high success rate in gene silencing. To increase the likelihood of efficiently silencing the expression of the target gene, 2 siRNAs are included for each gene. All siRNAs are synthesized using patented TOM-amidite chemistry to yield high-quality, high-purity, 21-nucleotide sense and antisense RNA oligonucleotides. The single-str anded oligos are purified by HPLC and annealed. The final siRNA duplex is
>97% pure. Table 1. Cancer-related genes in the Cancer siRNA Oligo Set Version 1.0 ABCB
ABCB4
ABCC1
ABL
AKAP13
AKT1
AKT2
APC
AR
ATM
BAD
BAG1
BAK1
BARD1
BAX
BCL2
BCL3
BCL6
BCR
BRAF
BRCA1
BRCA2
CBL
CCND1
CCNE1
CDH1 CDH13
CDK4
CDKN1A
CDKN1B
CDKN1C
CDKN2A
CDKN3
CHEK1
CHEK2
CRK
CSF1R
DCC
DEK
EEF1A2
EGFR
EIF3S3
EIF4E
ELK1
EPHA1
ERBB2
ERBB3
ERBB4
ERG
ESR1
ETS1
ETS2 FES
FGF3
FGF4
FGF6
FGFR1
FGFR2
FGR
FLI1
FOS
FYN
GADD45A
GADD45B
GADD45G
GLI
GNAI2
GRO1
HCC-4
HCK
HRAS
JUN
JUND
KA I1
KIT
KRAS2
LCK
MADH2 MADH4
MAF
MAFF
MAS1
MAX
MCF2
MDM2
MEL
MEN1
MET
MLH1
MOS
MPL
MSH2
MYB
MYB1
MYC
MYCL1
MYCN
NCOA1
NCOA3
NET1
NF1
NF2
NFKB2
NRAS NTRK1
PAX2
PDGFB
PGR
PIM1
PTCH
PTEN
RAF1
RARA
RB1
REL
RET
ROS1
RPS6KB1
RUNX1
SAS
SKI
SRC
TAL1
TGFBR1
TGFBR2
THRA
TIAM1
TLX1
TNFRSF1B
TNFRSF6 TP53
VAV1
VHL
WNT1
WNT2
WNT5A
WNT7B
WT1
YES1 In addition to 2 siRNAs to each of 139 cancer genes, the Cancer siRNA Oligo Set includes a positive control lamin A/C siRNA, 5 negative controls, and 4 fluorescein-labeled transfection controls, all supplied at 1 nmol. Comprehensive information is included, with gene list, GenBank accession numbers, and
sequences and positions of the siRNA within the relevant gene (see Table 2).
Table 2. Examples of siRNA target sequence information Gene
symbol
Accession
number
UniGene Target
location
Coding
region
siRNA target %GC
ABCB1 NM_000927 Hs.21330 889 4254264 AATGCGACAGGAGATAGGCTG 52 ABCB1 NM_000927 Hs.21330 2113 4254264 AAGCGAAGCAGTGGTTCAGGT 52 ABCB4 NM_018849 Hs.73812 2387 18735733 AACTCAATACGCGGCTAACAG 47 ABCB4 NM_018849 Hs.73812 3392 18735733 AAGAGGCCAACGCCTATGAGT 52 Summary By offering a large number of siRNAs at an economical price, the Cancer siRNA Set provides researchers with a valuableresearch tool to screen a large number of cancer-related genes. Used in conjunction with TransMessenger. Transfection Reagent, which provides highly efficient transfection of
siRNA, this set provides an excellent opportunity to clarify the genetic regulation of cancers using RNAi techniques. QIAGEN offers a custom siRNA Oligonucleotide Synthesis Service and a variety of library siRNA duplexes for common target genes. For further information see www.qiagen.com/sirna


'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. The QIAGEN Guide to Animal Cell Culture
2. The QIAGEN Guide to Animal Cell Culture
3. The QIAGEN Guide to Animal Cell Culture
4. The QIAGEN Guide to Animal Cell Culture
5. The QIAGEN Guide to Animal Cell Culture
6. The QIAGEN Guide to Animal Cell Culture
7. QIAGEN Multiplex PCR Handbook
8. QIAGEN Multiplex PCR Kit
9. QIAGEN Plasmid Kits
10. Laser microdissection and nucleic acid purification - a Leica - QIAGEN cooperation
11. QIAGEN PCR CloningPlus Kit
Post Your Comments:
*Name:
*Comment:
*Email:


(Date:5/26/2016)... , May 26, 2016 Despite the ... value in this space. Today,s pre-market research on ActiveWallSt.com directs ... Health Inc. (NASDAQ: RDUS ), Cerus Corp. (NASDAQ: ... ARWR ), and Five Prime Therapeutics Inc. (NASDAQ: ... briefings at: http://www.activewallst.com/ On ...
(Date:5/26/2016)... San Diego, CA (PRWEB) , ... May 26, ... ... assay development and manufacturing company, today announced several positive developments that position the ... As a result of the transaction, Craig F. Kinghorn has been appointed ...
(Date:5/25/2016)... ... May 25, 2016 , ... Lajollacooks4u has become a rising ... been rated one of its top attractions. Fortune 500 companies, such as Illumina, ... a unique and intimate team-building experience. , Each event kicks off with an olive ...
(Date:5/25/2016)... ... May 25, 2016 , ... The Ankle Plating ... options designed to address fractures of the distal tibia and fibula. This system ... Ankle Plating System 3 is composed of seven plate families that span the ...
Breaking Biology Technology:
(Date:3/15/2016)... -- Yissum Research Development Company of the Hebrew ... Hebrew University, announced today the formation of Neteera ... human biological indicators. Neteera Technologies has completed its first ... ... emissions from sweat ducts, enables reliable and speedy biometric ...
(Date:3/14/2016)... , Allemagne, March 14, 2016 ... http://www.apimages.com ) - --> - Renvoi : ... - --> --> ... solutions biométriques, fournit de nouveaux lecteurs d,empreintes digitales ... LF10 de DERMALOG sera utilisé pour produire des ...
(Date:3/11/2016)... India , March 11, 2016 ... a new market research report "Image Recognition Market by ... Application (Marketing and Advertising), by Deployment Type (On-Premises and ... Forecast To 2022", published by MarketsandMarkets, the global market ... 2015 to USD 29.98 Billion by 2020, at a ...
Breaking Biology News(10 mins):