Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
8. Mouse Tail Genomic DNA Isolation Protocol(1)
9. Genomic DNA Isolation Protocol(1,2,3)
10. Basic Plasmid DNA Isolation Protocol
11. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:8/22/2014)... 2014 Research and Markets has ... Enzymes, Kits, & Reagents (Cloning, Epigenetics, PCR, Restriction Digestion, ... their offering. The global molecular biology ... and is expected to grow at a CAGR of ... enzymes, kits, & reagents find applications in a large ...
(Date:8/22/2014)... 2014 Nerium International, the go-to, ... the spotlight again. Nerium will showcase its signature ... Body Contouring Cream to Hollywood’s elite at the ... the 66th Primetime Emmy® Awards. , Developed from ... clinical trials show that NeriumAD night cream dramatically ...
(Date:8/22/2014)... Greenville, SC (PRWEB) August 22, 2014 ... that indisputable acknowledgement is a national disgrace. Furthermore, ... part in establishing the current, deplorable state of ... outlined "5 great mistakes," to merely serve as ... convey the extent of colossal failure(s) that have ...
(Date:8/21/2014)... & Rockville, MD (PRWEB) August 21, 2014 ... (ITI) is making progress in its development of JRC-LAMP-vax, ... Japanese red cedar pollen. Phase IC studies began this ... real solution to hay fever. , The Japanese red ... 35 million people in Japan. Mountain Cedar pollen wreaks ...
Breaking Biology Technology:Global Molecular Biology Enzymes, Kits, & Reagents (Cloning, Epigenetics, PCR, Restriction Digestion, Sequencing) Market - Forecast to 2018 2Global Molecular Biology Enzymes, Kits, & Reagents (Cloning, Epigenetics, PCR, Restriction Digestion, Sequencing) Market - Forecast to 2018 3Nerium International Joins Television’s Biggest Stars at Backstage Creations Giving Suite at the 66th Primetime Emmy Awards 2Nerium International Joins Television’s Biggest Stars at Backstage Creations Giving Suite at the 66th Primetime Emmy Awards 35 Great Mistakes in Healthcare and How to Fix Them by Dr. Ira Williams 2Relief for Allergy Sufferers Finally in Sight: Immunomic Therapeutics Closes in on Treatment for Hay Fever in Japan, U.S. 2Relief for Allergy Sufferers Finally in Sight: Immunomic Therapeutics Closes in on Treatment for Hay Fever in Japan, U.S. 3Relief for Allergy Sufferers Finally in Sight: Immunomic Therapeutics Closes in on Treatment for Hay Fever in Japan, U.S. 4
... With the first observation of thermoelectric effects at ... transistors have a nanoscale cooling effect that reduces their ... William King and electrical and computer engineering professor Eric ... April 3 advance online edition of the journal ...
... conventional optical instruments, light cannot be focused to spot ... effects. An important approach to beat this diffraction ... an allusion to their radiofrequency counterparts. They have the ... nanometer-scale dimensions, which are orders of magnitude smaller than ...
... Diego have produced the first high resolution structure of a ... was published in a paper in this week,s early online ... of Sciences by a team of chemists headed by ... UCSD. The scientists said the ability to carry structural ...
Cached Biology Technology:Self-cooling observed in graphene electronics 2Transmission lines for nanofocusing of infrared light 2Transmission lines for nanofocusing of infrared light 3
(Date:8/21/2014)... aimed at improving the food intake, health and quality ... is among three projects at the University of Waterloo ... Canadian Institutes of Health Research (CIHR). , Professor ... at Waterloo, and a Schlegel research chair in nutrition ... investigate why many Canadians living in long-term care homes ...
(Date:8/21/2014)... that has implications for life in other extreme environments, ... system, LSU Associate Professor of Biological Sciences Brent Christner ... or NSF, this week published a paper confirming that ... 800 meters (2600 feet) beneath the surface of the ... that more than 400 subglacial lakes and numerous rivers ...
(Date:8/21/2014)... heard of the water window? It consists of radiations ... not absorbed by the water in biological tissues. New ... coherent radiations within the water window. These could be ... high-contrast image of the biological samples or to be ... identifies the physical mechanism needed to efficiently generate the ...
Breaking Biology News(10 mins):Grants will fund landmark aging research at Waterloo 2800 meters beneath Antarctic ice sheet, subglacial lake holds viable microbial ecosystems 2800 meters beneath Antarctic ice sheet, subglacial lake holds viable microbial ecosystems 3800 meters beneath Antarctic ice sheet, subglacial lake holds viable microbial ecosystems 4Water window imaging opportunity 2
... tiny organic aerosols floating in the atmosphere emitted ... characteristics as a group that scientists can generalize their ... The groundbreaking research by Colette Heald, assistant professor in ... was highlighted this month on the cover of the ...
... closely associated with the African savanna -- fierce lions, ... players when it comes to shaping the ecosystem. ... be the termite, say ecologists who,ve found that these ... Kenya via a network of uniformly distributed colonies. Termite ...
... For marine iguanas living in the Galapagos Islands, an ... while others survive. Scientists have long believed that the ... on the animals, ability to secrete the stress hormone ... a spigot by controlling how the body expends energy ...
Cached Biology News:Colorado State University scientist simplifies aerosols for modeling 2The star of Africa's savanna ecosystems may be the lowly termite 2The star of Africa's savanna ecosystems may be the lowly termite 3 Study sheds light on how marine animals survive stress 2
EDG-1CT (endothelial cell differentiation gene-1, C terminal)...
Mouse Anti-human CD11b/Mac-1alpha, clone LM2/1, Monoclonal Antibody...
Mouse monoclonal [1-N-14] to Adenovirus Type 7 hexon C11 Immunogen: Purified Adenovirus type 7 Specificity: This antibody is specific for Adenovirus type 7 hexon C11....
... Kir2.1 protein. The epitope is specific ... in any other known protein.,SPECIES REACTIVITIES: ... in rabbit, bovine, porcine and guinea ... rat and mouse (17/19 residues) and ...
Biology Products: