Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
8. Mouse Tail Genomic DNA Isolation Protocol(1)
9. Genomic DNA Isolation Protocol(1,2,3)
10. Basic Plasmid DNA Isolation Protocol
11. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:9/30/2014)... 2014  RegeneRx Biopharmaceuticals, Inc. (OTC: RGRX) ("the ... received a Canadian Patent for Inhibition or Reversal ... includes claims using thymosin beta 4, various fragments ... these purposes.  The patent will expire in 2021. ... www.regenerx.com ) RegeneRx is focused ...
(Date:9/30/2014)... Hungary , September 30, 2014 ... and intuitive browsing of chemistry in documents ... chemistry software solutions and consulting services for life ... chemical information and generate Markush structures from documents. ... an organizations intellectual property, however generating and understanding ...
(Date:9/30/2014)... OriginOil Inc. (OTC/QB: OOIL), developer of Electro ... up large quantities of water, announced today that in ... the launch of the company's CLEAN-FRACâ„¢ industrial grade demonstrator ... STW Resources . , Immediately upon startup, the ... and achieved a 99.8% reduction in Turbidity on flowback ...
(Date:9/30/2014)... Md., Sept. 30, 2014 BioHealth Innovation, ... commercializing market-relevant biohealth innovations and increasing access to early-stage ... today that venture capitalist, Tania Fernandez , Ph.D., ... Dr. Fernandez will be a member of the management ... provide up to $50 million in seed and early-stage ...
Breaking Biology Technology:RegeneRx Receives Canadian Patent for Inhibition or Reversal of Skin Aging 2ChemAxon Introduces ChemCurator for Chemical Information Extraction and Markush Structure Creation 2OriginOil, Inc. Report to Shareholders: Blue Gold in West Texas 2Seasoned Life Sciences Venture Capitalist Tania Fernandez Joins BHI to Help Manage New BioHealth Gap Fund 2
... , ... , , , Antibodies ... arrays) or as biopharmaceutical therapeutics. In,all cases the successful production ... criteria include: protein identification,quantitation and the monitoring of purity and ...
... , ... , , , ... of the Agilent 2100 bioanalyzer in combination,with the Protein 200 Plus ... denaturing gel-elctrophoresis (SDSPAGE).,The results showed that the Agilent 2100 bioanalyzer provides,fast ...
... , ... , , , , ... an siRNA sequence,for a target gene, which are of,high importance ... crucial.,An efficient method to optimize,transfection and gene silencing,is critical for ...
Cached Biology Technology:Quality control of antibodies using the,2100 bioanalyzer and the Protein 200,Plus assay 2Quality control of antibodies using the,2100 bioanalyzer and the Protein 200,Plus assay 3Comparison of different protein,quantitation methods 2Comparison of different protein,quantitation methods 3Comparison of different protein,quantitation methods 4Comparison of different protein,quantitation methods 5Comparison of different protein,quantitation methods 6Comparison of different protein,quantitation methods 7Comparison of different protein,quantitation methods 8Comparison of different protein,quantitation methods 9Confirming gene silencing,mechanism by pGFP/GFP22 ,siRNA co-transfection 2Confirming gene silencing,mechanism by pGFP/GFP22 ,siRNA co-transfection 3Confirming gene silencing,mechanism by pGFP/GFP22 ,siRNA co-transfection 4
(Date:9/30/2014)... Salk professor and Howard Hughes Medical Institute investigator, ... named recipients in the 2014 round of grants ... the BRAIN (Brain Research through Advancing Innovative Neurotechnologies) ... announced September 30, provides more than $3 million ... years. , The BRAIN Initiative, launched last year, ...
(Date:9/30/2014)... water may increase the risk of stillbirth and ... by a Boston University School of Public Health ... Environmental Health , compared 1,091 PCE-exposed pregnancies ... Cape Cod, Ma., where water was contaminated in ... the installation of vinyl-lined asbestos cement pipes. PCE ...
(Date:9/30/2014)... live in almost any aquatic environment on Earth, but ... species are pushed to the limit. The amount of ... critical for how different species cope in the future, ... of Gothenburg, published in the scientific journal Proceedings ... continues apace thanks to increasing levels of greenhouse gases ...
Breaking Biology News(10 mins):Salk scientists receive $3 million for BRAIN Initiative grant 2Contaminated water linked to pregnancy complications, BU study finds 2Shape up quickly -- applies to fish, too! 2
... in ecological or environmental conservation remains contentious the ... demand that governments regulate and encourage restoration projects; ... corporations makes such interventions politically difficult. However, ... a handful of developing nations, alongside South Africa, ...
... , RIVERSIDE, Calif. Alan McHughen , a ... University of California, Riverside, has been chosen by the ... Sciences to receive a 2011-2012 Jefferson Science Fellowship ... selected for the fellowships this year. Successful ...
... is redefining the rules by which we live and at ... level, several areas of the globe are in danger of ... and maybe, one day, live in floating houses. Depending ... others in their adjustment to the effects of global warming, ...
Cached Biology News:UC Riverside plant biotechnologist receives prestigious Jefferson Science Fellowship 2UC Riverside plant biotechnologist receives prestigious Jefferson Science Fellowship 3Floating houses 2Floating houses 3
Collected from animals that are 16 to 18 months old. Sterile, Cell culture tested, ID clarifier: USA Origin...
... 20-HETE is a cytochrome P450 (CYP450) metabolite ... the renal and cerebral vasculature. In rat ... mediates pressure-induced autoregulatory vasoconstriction. 20-HETE is excreted ... of free 20-HETE (20-40 pg/ml in human ...
... GPS-M Mutagenesis System enables you to insert ... into,your target DNA by in vitro transposition. ... Tn7-based,transposon randomly into the DNA target. Target ... or purified,chromosomal DNA, depending on your interests ...
A set of five peptides which can be used to calibrate a Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) or Electrospray Ionization (ESI) mass spectrometer....
Biology Products: