Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
8. Mouse Tail Genomic DNA Isolation Protocol(1)
9. Genomic DNA Isolation Protocol(1,2,3)
10. Basic Plasmid DNA Isolation Protocol
11. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:12/22/2014)... - RepliCel Life Sciences Inc. (OTCQB: REPCF) (TSX.V: RP), ... development of autologous cell therapies, announced today the publication ... in conjunction with co-authors from Kyoto University and the ... ongoing clinical research using dermal sheath cup (DSC) cells ... The paper entitled " Hair Follicle Dermal Stem Cells ...
(Date:12/22/2014)... Calif. , Dec. 22, 2014  ( www.competitivehealth.com ... CoPatient, an online medical bill review and advocacy service, ... in the FREE WellCard Savings discount health services marketplace. ... bill that was more than they expected to pay. ... reduce health care costs, WellCard Savings is pleased to ...
(Date:12/22/2014)... Fertility Associates of Memphis has announced a new ... network of more than 20 contributing fertility practices ... access to a national pool of frozen donor ... of Memphis is the only fertility clinic in the ... Dr. William Kutteh , director of Fertility Associates of ...
(Date:12/19/2014)... BioPlus Specialty Pharmacy (BioPlus), one of ... Nick Maroulis, Pharm.D. to the newly created position of ... this position, Dr. Maroulis will continue to manage the ... our multi-site pharmacies as the company expands. Dr. Maroulis ... time he has served in many different capacities in ...
Breaking Biology Technology:Newly Released Peer-Reviewed Publication Further Validates RepliCel's Use of Dermal Sheath Cup Cells to Treat Pattern Baldness 2Newly Released Peer-Reviewed Publication Further Validates RepliCel's Use of Dermal Sheath Cup Cells to Treat Pattern Baldness 3Newly Released Peer-Reviewed Publication Further Validates RepliCel's Use of Dermal Sheath Cup Cells to Treat Pattern Baldness 4Newly Released Peer-Reviewed Publication Further Validates RepliCel's Use of Dermal Sheath Cup Cells to Treat Pattern Baldness 5WellCard Savings Announces CoPatient Medical Bill Review Service for Members 2Fertility Associates of Memphis Announces Partnership with Donor Egg Bank USA 2Fertility Associates of Memphis Announces Partnership with Donor Egg Bank USA 3BioPlus Specialty Pharmacy Promotes Dr. Nick Maroulis to Vice President of Specialty Pharmacy Services 2
... 4, 2011 Enox Biopharma, Inc., a leader in the ... today announced that it has appointed John C. Rewcastle, Ph.D., ... Enox, Dr. Rewcastle served as Medical Director of EDAP TMS ... Medical, a private medical device company. Prior to this, he ...
... Keryx Biopharmaceuticals, Inc. (Nasdaq: KERX ) today announced ... presenting at the 29th Annual J.P. Morgan Healthcare Conference, being ... in San Francisco. Mr. Bentsur,s presentation is scheduled to take ... p.m. EST). A live audio webcast of Mr. ...
... 4, 2011 Reportlinker.com announces ... report is available in its ... title=,The 2011 Clinical Chemistry And ... Product Development Opportunities And Business ...
Cached Biology Technology:Enox Biopharma, Inc. Appoints Dr. John Rewcastle as CEO 2Enox Biopharma, Inc. Appoints Dr. John Rewcastle as CEO 3Keryx Biopharmaceuticals to Present at 29th Annual J.P. Morgan Healthcare Conference 2Reportlinker Adds The 2011 Clinical Chemistry And Immunodiagnostics Markets US, Europe, Japan: Product Development Opportunities And Business Expansion Strategies For Instrument And Reagent Suppliers 2
(Date:12/3/2014)...   Marvin Test Solutions , a trusted ... military, aerospace, and manufacturing organizations, today announced the ... TS-900 PXI semiconductor test platform . The TS-960 ... to customers at a fraction of the footprint ... "Our semiconductor customers asked for ...
(Date:11/21/2014)... 2014 According to a new ... (Video, RFID, Access Control, Intrusion Detection, Parking Management, Under ... Component Service Geography - Global Forecasts to 2020", published ... to be around $25 Billion in 2014 and is ... a CAGR of 8.69%. Browse 116 market ...
(Date:11/21/2014)... 20, 2014 Strict laws against distracted driving ... the North American and European automotive sector towards gesture ... recognition systems that are intuitive and able to retrieve ... industry. New analysis from Frost & ... in Europe and ...
Breaking Biology News(10 mins):Marvin Test Solutions Brings New Capabilities to PXI-Based Semiconductor Test with TS-960 2Marvin Test Solutions Brings New Capabilities to PXI-Based Semiconductor Test with TS-960 3Industrial Security Systems Market Worth $38 Billion by 2020 2Industrial Security Systems Market Worth $38 Billion by 2020 3Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 2Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 3Gesture Recognition Intensifies with the Rise of In-car Smartphone Integration, Says Frost & Sullivan 4
... Soybean production has continued to increase in the Northeast ... the crop and many experienced growers planting alongside corn crops. ... with a corn planter in 30-inch rows instead of 7.5-inch ... a Cornell University scientist, investigated the response of two soybean ...
... L. Boren announced today that OU is establishing an ... expertise to benefit Oklahoma and the nation, including emerging ... led by a national expert, who will be appointed ... million gift from Corix, a multi-utility infrastructure company, which ...
... grant totaling $2.2 million shows how the University of ... using technology to advance the cutting-edge field of personalized ... their genetic make-up. The grant also highlights the ... Institute (CCTSI) to bring scientific discoveries to the bedside ...
Cached Biology News:OU establishes a new water and sustainability institute 2OU establishes a new water and sustainability institute 3Personalizing medicine 2Personalizing medicine 3
... Radiolabeled Ligands\n\nReceptor-related research has long been enabled ... ligands selected to keep pace with new ... products and services for receptor research and ... If you do not find exactly what ...
... and SYBR Safe DNA Gel Stain combo offers these ... buying these same products separately ... bromide Eliminates risks to ... and RNA fragments from 100 bp to >30 kb. ...
... easily imported for data analysis , Automatic grid, ... template assignment ... Extensive background and signal options to optimize, ... results , ...
... MATra-si Reagent optimized for siRNA applications, contains ... with the nucleic acid of interest. Exploiting ... is then rapidly drawn towards and delivered ... transfection. MATra-si Reagent can be used for ...
Biology Products: