Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst
Eppendorf 5 Prime, Inc. Introduction

It is not convenient in all instances to have blood drawn for gDNA extraction. The Eppendorf Perfect gDNA Blood Mini Kit was used to extract gDNA from saliva with only slight modifications to the protocol. The unique patent-pending trapping technology results in gDNA that is less sheared than the gDNA isolated using the common chaotropic bind-wash-and-elute technology. The gDNA also performs well in PCR as the main downstream application as well as in other downstream applications.

Materials

  • Perfect gDNA Blood Mini Kit
Required but not supplied:
  • Ethanol 95100%; pipette tips; Microcentrifuge; Eppendorf Thermo-mixer, water bath, or heat block at 70C; 15 ml centrifuge tubes.
  • 1x PBS (sufficient amounts are supplied in the kit for blood work, but additional amounts may be needed for saliva applications)
Method

Isolation of gDNA:

  1. Place 1 ml of saliva into a 15 ml centrifuge tube.
  2. Add 4 ml of 1x PBS.
  3. Centrifuge at 1,800 x g for 5 minutes
  4. Decant the supernatant. Add 200 l 1x PBS and re-suspend pellet.
  5. Add 20 l of Proteinase K solution into a 1.5 ml microcentrifuge tube. Transfer the re-suspension from step 4 into this same tube.
  6. Add 350 l Solution G1 to the microcentrifuge tube and mix.
  7. Incubate in Thermomixer at 70C, 900 rpm, for 10 minutes. A water bath may be used with intermittent vortexing of samples if a Thermomixer is not available.
  8. Centrifuge the sample for 3 minutes at 12,00016,000 x g.
  9. Add 200 l Solution G2 to the tube. Vortex vigorously for 5 seconds. Place a spin column in a fresh microcentrifuge tube. Transfer the sample to the spin column assembly by pouring or pipetting. Incubate the sample at room temperature for 1 minute.
  10. Centrifuge the sample for 2 minutes at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  11. Add 600 l Diluted Wash Buffer to the spin column. Centrifuge for 1 minute at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  12. Add 400 l Diluted Wash Buffer to the spin column. Centrifuge for 3 minutes at 12,00016,000 x g. Carefully remove the spin column without splashing Wash Buffer onto the bottom of the column. Place the spin column into a fresh microcentrifuge tube.
  13. Observe the filter membrane to make sure it is dry before proceeding. If the filter looks shiny, spin an additional 1 to 2 minutes before placing the spin column into the fresh microcentrifuge tube.
  14. Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
Gel Electrophoresis for Yield:
Determination
5% of each sample was run on a 0.6% agarose gel in 1x TBE. The gel was stained in ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes final extension
15C hold

Results

Average yields obtained from 1 ml of saliva vary from person to person, but are consistent when triplicate samples are processed for one person (see Fig. 1). In general, the yields are slightly less than the yields of 200 l of whole blood, but extremely high yields have also been observed. All samples perform equally well in PCR with no inhibition of amplification (see Fig.2).

Fig.1: Yields of gDNA isolated from two individuals using both the Perfect gDNA kit and the leading competitors kit gDNA was extracted from the saliva of two individuals in triplicate. 5% of each sample was run on a 0.6% agarose gel.

Top: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: EppendorfIndividual #1 Lanes 57: EppendorfIndividual #2 Bottom: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: CompetitorIndividual #1 Lanes 57: CompetitorIndividual #2 Fig. 2: PCR of gDNA isolated from saliva

Lane 1: GeneRuler Ladder Mix (Fermentas) Lane 2: Eppendorf: 50 ng gDNA template, individual #1; 536 bp fragment Lane 3: Eppendorf: 50 ng gDNA template, individual #1; 2 kb fragment Lane 4: Eppendorf: 50 ng gDNA template, individual #2; 536 bp fragment Lane 5: Eppendorf: 50 ng gDNA template, individual #2; 2 kb fragment Lane 6: Qiagen: 50 ng of gDNA template, individual #1; 536 bp fragment Lane 7: Competitor, 50 ng gDNA template, individual #1; 2 kb fragment Lane 8: Competitor, 50 ng gDNA template, individual #2; 536 bp fragment Lane 9: Competitor, 50 ng gDNA template, individual #2; 2 kb fragment Lane 10: 536 bp fragment no template control Lane 11: 2 kb fragment no template control Discussion

The Perfect gDNA Blood Mini Kit provides a versatile method of isolating gDNA from a variety of starting materials including saliva. The isolated DNA analyzed by gel electrophoresis shows consistent yield within triplicate samples from one individual. The DNA also appears to be significantly higher in molecular weight when isolated using the Perfect gDNA Blood Mini Kit in comparison to the competitor. The DNA in saliva can come from many sources including non-human origins such as bacteria and food particles. Success in amplification of the human beta-globin gene shows the presence of sufficient amounts of human gDNA for use in this downstream application. Overall, the Perfect gDNA Blood Mini Kit provides a fast, effective method for purifying gDNA from saliva.

References

  1. Use of the Polymerase Chain Reaction (PCR) process to amplify nucleic acids is covered by U.S. Patent Numbers 4683105 and 4683202 owned by Roche Molecular and requires a license

'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
8. Mouse Tail Genomic DNA Isolation Protocol(1)
9. Genomic DNA Isolation Protocol(1,2,3)
10. Basic Plasmid DNA Isolation Protocol
11. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:5/29/2015)... 29, 2015  Caris Life Sciences® today announced ... which researchers utilized Caris Molecular Intelligence®, the company,s ... therapeutic targets in patients with colorectal and pancreatic ... cell death protein 1 (PD-1) and its ligand, ... the 2015 American Society of Clinical Oncology Annual ...
(Date:5/29/2015)... Seoul Semiconductor (CEO: Chung-hoon Lee, ... on May 28th announced that it will increase ... its high efficient and high reliable LED product ... Seoul Semiconductor has developed efficient and reliable LED ... supplied LEDs for headlamps to global auto makers. ...
(Date:5/28/2015)... DUBLIN , May 28, 2015 ... Markets ( http://www.researchandmarkets.com/research/8h5hs2/animal ) has announced the ... "Animal Biotechnology - Technologies, Markets and ... http://photos.prnewswire.com/prnh/20130307/600769) , ,This report describes and ... in veterinary medicine and pharmaceuticals as ...
(Date:5/28/2015)... The Academy of Model Aeronautics Foundation will be celebrating the ... National Model Aviation Day was created to celebrate the hobby ... the general public. , The AMA has encouraged all of ... by hosting events in their own communities. More than 80 ... View our online event map to find an event ...
Breaking Biology Technology:Multi-Platform Molecular Profiling from Caris Life Sciences Identifies Clinically Actionable Targets for Novel Immunotherapy Drugs 2Multi-Platform Molecular Profiling from Caris Life Sciences Identifies Clinically Actionable Targets for Novel Immunotherapy Drugs 3Multi-Platform Molecular Profiling from Caris Life Sciences Identifies Clinically Actionable Targets for Novel Immunotherapy Drugs 4Seoul Semiconductor Increases the Global Automotive LED Market Share with its High Efficient and Reliable LEDs for Automotive Lightings 2Global Animal Biotechnology Report 2015 - Technologies, Markets and Companies Analysis to 2024 2Global Animal Biotechnology Report 2015 - Technologies, Markets and Companies Analysis to 2024 3Model flying pilots celebrate the Academy of Model Aeronautics Foundation’s Third Annual National Model Aviation Day 2
... Mass., Jan. 4, 2011 Interleukin Genetics, Inc. (OTC ... will present at the Biotech Showcase 2011, taking place ... 2011.  The corporate presentation will include a company overview ... January 10 at 3:45 p.m. in the Mission II ...
... 4, 2011 Reportlinker.com announces that a new ... Emerging Opportunities in Biosimilar and ... Executive SummaryThe biosimilar and ... in a grand manner following a series of ...
... Reportlinker.com announces that a new market research ... Financial Health of Biotechnology and Drugs Industry ... http://www.reportlinker.com/p0357094/Financial-Health-of-Biotechnology-and-Drugs-Industry-in-India-and-China.html The research services examines ... companies across 2 broad parameters- Excellence in financial ...
Cached Biology Technology:Interleukin Genetics, Inc. to Present at Biotech Showcase 2011 2Reportlinker Adds Emerging Opportunities in Biosimilar and Biobetter Drugs Markets 2Reportlinker Adds Financial Health of Biotechnology and Drugs Industry in India and China 2
(Date:5/19/2015)... -- Fingerprint Cards (FPC) has received an order ... FPC1035 from one if its module partners. Deliveries are planned ... and the sensors will be used by smartphone manufacturers in ... hereby amount to 740 MSEK to date. In addition to ... a number of smaller orders not separately communicated amounting to ...
(Date:5/14/2015)... NEW YORK , May 14, 2015 ... specializing in identity verification and online remote ... Instructure, a software-as-a-service (SaaS) company and creator ... Shared customers of the two companies will ... Proctortrack in Canvas. As a ...
(Date:5/8/2015)... SAN JOSE, Calif. , May 8, 2015 ... human interface solutions, today announced that members of the executive ... J.P. Morgan 43rd Annual Technology, Media and Telecom Conference ... Westin Waterfront Hotel in Boston, MA ... Date: May 27, 2015 Time: 2:45pm ET Location: The New ...
Breaking Biology News(10 mins):Fingerprint Cards Receives Touch Fingerprint Sensor Order of SEK 230 Million and Raises Revenue Guidance for 2015 2Verificient and Instructure Announce Alliance Partnership to Provide Online Proctoring for K-12 and Higher Education Institutions 2Synaptics to Present at Upcoming Investor Conferences 2
... Society of America (ESA) is proud to announce its ... Fellow acknowledges outstanding contributions in research, teaching, extension, or ... ESA Annual Meeting, which will be held from November ... Dr. Robert N. Coulson has ...
... of all life on earth, yet freshwater animals and ... ecosystem. The dominant causes are the many stressors ... over-fishing, invasions by alien species, dams, over-abstraction, many forms ... also highly sensitive to climate change which now exacerbates ...
... have suffered a stroke or who have been diagnosed ... Queen,s University Belfast. Dr Cathy Craig from Queen,s ... sensory devices for those who normally have difficulty controlling ... a grant of 860,924 from the European Research Council. ...
Cached Biology News:Entomological Society of America names new Fellows for 2008 2Entomological Society of America names new Fellows for 2008 3Entomological Society of America names new Fellows for 2008 4Entomological Society of America names new Fellows for 2008 5Entomological Society of America names new Fellows for 2008 6Entomological Society of America names new Fellows for 2008 7Entomological Society of America names new Fellows for 2008 8Entomological Society of America names new Fellows for 2008 9Entomological Society of America names new Fellows for 2008 10Water: stressed-out and overheated 2New sensory devices will aid Parkinson's and stroke patients 2
Goat polyclonal to Lipocalin 2...
Immunogen for A300-655A was a phosphorylated synthetic peptide, which represented a portion of human RNA Polymerase II (GeneID 5430) around serine 5 of the C-terminal repeat YSPTSPS....
Acetylcholinesterase from human and monkey....
Excellent safety and durability., Remote control can be easily operated in your hand., Constant voltage control with 2 sets of terminals., Precise and durable circuit design. ...
Biology Products: