Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst
Eppendorf 5 Prime, Inc. Introduction

It is not convenient in all instances to have blood drawn for gDNA extraction. The Eppendorf Perfect gDNA Blood Mini Kit was used to extract gDNA from saliva with only slight modifications to the protocol. The unique patent-pending trapping technology results in gDNA that is less sheared than the gDNA isolated using the common chaotropic bind-wash-and-elute technology. The gDNA also performs well in PCR as the main downstream application as well as in other downstream applications.

Materials

  • Perfect gDNA Blood Mini Kit
Required but not supplied:
  • Ethanol 95100%; pipette tips; Microcentrifuge; Eppendorf Thermo-mixer, water bath, or heat block at 70C; 15 ml centrifuge tubes.
  • 1x PBS (sufficient amounts are supplied in the kit for blood work, but additional amounts may be needed for saliva applications)
Method

Isolation of gDNA:

  1. Place 1 ml of saliva into a 15 ml centrifuge tube.
  2. Add 4 ml of 1x PBS.
  3. Centrifuge at 1,800 x g for 5 minutes
  4. Decant the supernatant. Add 200 l 1x PBS and re-suspend pellet.
  5. Add 20 l of Proteinase K solution into a 1.5 ml microcentrifuge tube. Transfer the re-suspension from step 4 into this same tube.
  6. Add 350 l Solution G1 to the microcentrifuge tube and mix.
  7. Incubate in Thermomixer at 70C, 900 rpm, for 10 minutes. A water bath may be used with intermittent vortexing of samples if a Thermomixer is not available.
  8. Centrifuge the sample for 3 minutes at 12,00016,000 x g.
  9. Add 200 l Solution G2 to the tube. Vortex vigorously for 5 seconds. Place a spin column in a fresh microcentrifuge tube. Transfer the sample to the spin column assembly by pouring or pipetting. Incubate the sample at room temperature for 1 minute.
  10. Centrifuge the sample for 2 minutes at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  11. Add 600 l Diluted Wash Buffer to the spin column. Centrifuge for 1 minute at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  12. Add 400 l Diluted Wash Buffer to the spin column. Centrifuge for 3 minutes at 12,00016,000 x g. Carefully remove the spin column without splashing Wash Buffer onto the bottom of the column. Place the spin column into a fresh microcentrifuge tube.
  13. Observe the filter membrane to make sure it is dry before proceeding. If the filter looks shiny, spin an additional 1 to 2 minutes before placing the spin column into the fresh microcentrifuge tube.
  14. Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
Gel Electrophoresis for Yield:
Determination
5% of each sample was run on a 0.6% agarose gel in 1x TBE. The gel was stained in ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes final extension
15C hold

Results

Average yields obtained from 1 ml of saliva vary from person to person, but are consistent when triplicate samples are processed for one person (see Fig. 1). In general, the yields are slightly less than the yields of 200 l of whole blood, but extremely high yields have also been observed. All samples perform equally well in PCR with no inhibition of amplification (see Fig.2).

Fig.1: Yields of gDNA isolated from two individuals using both the Perfect gDNA kit and the leading competitors kit gDNA was extracted from the saliva of two individuals in triplicate. 5% of each sample was run on a 0.6% agarose gel.

Top: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: EppendorfIndividual #1 Lanes 57: EppendorfIndividual #2 Bottom: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: CompetitorIndividual #1 Lanes 57: CompetitorIndividual #2 Fig. 2: PCR of gDNA isolated from saliva

Lane 1: GeneRuler Ladder Mix (Fermentas) Lane 2: Eppendorf: 50 ng gDNA template, individual #1; 536 bp fragment Lane 3: Eppendorf: 50 ng gDNA template, individual #1; 2 kb fragment Lane 4: Eppendorf: 50 ng gDNA template, individual #2; 536 bp fragment Lane 5: Eppendorf: 50 ng gDNA template, individual #2; 2 kb fragment Lane 6: Qiagen: 50 ng of gDNA template, individual #1; 536 bp fragment Lane 7: Competitor, 50 ng gDNA template, individual #1; 2 kb fragment Lane 8: Competitor, 50 ng gDNA template, individual #2; 536 bp fragment Lane 9: Competitor, 50 ng gDNA template, individual #2; 2 kb fragment Lane 10: 536 bp fragment no template control Lane 11: 2 kb fragment no template control Discussion

The Perfect gDNA Blood Mini Kit provides a versatile method of isolating gDNA from a variety of starting materials including saliva. The isolated DNA analyzed by gel electrophoresis shows consistent yield within triplicate samples from one individual. The DNA also appears to be significantly higher in molecular weight when isolated using the Perfect gDNA Blood Mini Kit in comparison to the competitor. The DNA in saliva can come from many sources including non-human origins such as bacteria and food particles. Success in amplification of the human beta-globin gene shows the presence of sufficient amounts of human gDNA for use in this downstream application. Overall, the Perfect gDNA Blood Mini Kit provides a fast, effective method for purifying gDNA from saliva.

References

  1. Use of the Polymerase Chain Reaction (PCR) process to amplify nucleic acids is covered by U.S. Patent Numbers 4683105 and 4683202 owned by Roche Molecular and requires a license

'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
8. Mouse Tail Genomic DNA Isolation Protocol(1)
9. Genomic DNA Isolation Protocol(1,2,3)
10. Basic Plasmid DNA Isolation Protocol
11. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:9/2/2015)... ... September 02, 2015 , ... Whitehouse Laboratories is excited ... Pharma Ed Resources upcoming educational seminar and training session on Extractable & Leachable ... conference will provide Updates & Case Studies on the Latest Compliance Implications of ...
(Date:9/2/2015)... ... September 02, 2015 , ... The TS5-Q is designed for ... content, to analysis of athletic performance. Producing high-resolution slow-motion video , the ... to process with the naked eye. , Slow motion sequences are commonly ...
(Date:9/1/2015)... , September 2, 2015 ... auf die Forschung und Entwicklung neuartiger Therapien ... chronisch-entzündliche Darmerkrankungen und Reizdarm konzentriert, erhält vom ... dass sein neues Medikament patentiert wird. Das ... Allergien bei Kindern verhindert und Entzündungen vorbeugt.   ...
(Date:9/1/2015)... The American Brain Tumor Association (ABTA) is now accepting ... program. LOIs are due no later than Wednesday, October ... Discovery Grants are one-year, $50,000 grants that fund high risk/high ... or treatment paradigms for adults and children with brain ... earliest stages, in the hopes that it spurs additional ...
Breaking Biology Technology:Whitehouse Laboratories to Participate in Pharm Ed Resources Extractables, Leachables, & Elemental Impurities Educational Seminar 2Whitehouse Laboratories to Participate in Pharm Ed Resources Extractables, Leachables, & Elemental Impurities Educational Seminar 3Fastec Introduces the Quad-HD TS5-Q High-Speed Camera 2Fastec Introduces the Quad-HD TS5-Q High-Speed Camera 3Das Patent von Swecure zur Verhinderung von Allergien bei Kindern wird in den USA zugelassen 2American Brain Tumor Association Seeks Innovative Concepts For Discovery Research Grants 2
... RNA later Tissue Collection: RNA ... Tissue and Cells. , ... processing or appropriate storage of the tissue or cell , ... followed by immediate disruption in lysis ...
... Isolation , , ... different tissues. A comparison of total RNase activities for 8 different , ... from pancreas to brain (Figure 1), which highlights the level of RNase ... , Figure 1. ...
... RNA interference, the biological mechanism ... (dsRNA) induces gene silencing by , ... revolutionizing the way researchers study gene function. For , ... expression of a particular gene in mammalian cell systems, ...
Cached Biology Technology:Stabilizing RNA in Fresh and Frozen Tissues for RNA Isolation 2Stabilizing RNA in Fresh and Frozen Tissues for RNA Isolation 3Stabilizing RNA in Fresh and Frozen Tissues for RNA Isolation 4RNase Activity in Mouse Tissue: Classification, Hierarchy, and Methods for Control 2RNase Activity in Mouse Tissue: Classification, Hierarchy, and Methods for Control 3RNAi: A How To for New Users 2RNAi: A How To for New Users 3RNAi: A How To for New Users 4RNAi: A How To for New Users 5RNAi: A How To for New Users 6RNAi: A How To for New Users 7RNAi: A How To for New Users 8RNAi: A How To for New Users 9
(Date:8/31/2015)... BURNABY, Canada , August 31, 2015 ... use of biometrics technology in government digitization projects to drive ... According to a recently published TechSci Research report, " India ... India is projected to grow at ... in the market is anticipated on account of extensive use ...
(Date:8/25/2015)... LAKE CITY and BELLEVUE, Wash. ... global leader in advanced robotic systems, announced today it ... robotic unmanned ground vehicle (UGV), at the National Tactical ... City.  The Guardian S is the ... the culmination of years of research and in-field trials ...
(Date:8/20/2015)... Aug. 20, 2015   Sensory, Inc ., ... the user experience and security of consumer electronics ... announced that its TrulySecure™ is the ... to be FIDO Certified™. The FIDO ... with the FIDO UAF (Universal Authentication Framework) 1.0 ...
Breaking Biology News(10 mins):India Biometrics Market to Grow at Over 35% Through 2020, Says TechSci Research 2India Biometrics Market to Grow at Over 35% Through 2020, Says TechSci Research 3Sarcos to Debut First-of-its-Kind Snake Robot 2Sarcos to Debut First-of-its-Kind Snake Robot 3TrulySecure From Sensory Becomes First Face and Voice Biometrics Technology to be FIDO UAF Certified 2TrulySecure From Sensory Becomes First Face and Voice Biometrics Technology to be FIDO UAF Certified 3TrulySecure From Sensory Becomes First Face and Voice Biometrics Technology to be FIDO UAF Certified 4TrulySecure From Sensory Becomes First Face and Voice Biometrics Technology to be FIDO UAF Certified 5
... , Can an abundance of sea otters help reverse a principal cause ... Cruz researchers suggest that a thriving sea otter population that keeps sea ... spreading kelp can absorb as much as 12 times the amount of ... ravenous sea urchins, the study finds. The theory is ...
... Carolina State University shows that exposure to the chemical bisphenol ... anxiety by causing significant gene expression changes in a specific ... found that a soy-rich diet can mitigate these effects. ... of species, and wanted to begin to understand why and ...
... Strathclyde spin-out company has been awarded 1.4 million to ... grant towards the total cost of building and testing ... of Machrihanish, Argyll, Scotland., The award was part of ... Deputy First Minister Nicola Sturgeon, aimed at helping Scottish ...
Cached Biology News:UC Santa Cruz study shows how sea otters can reduce CO2 in the atmosphere 2Study finds how BPA affects gene expression, anxiety; Soy mitigates effects 2University spin-out company shares in £7.9 million marine energy funding boost 2
... a direct antibiotic-based selection ... Recombinant selection depends solely ... the need for costly ... and inexpensive process provides ...
These stopping screens are for the biolistic PDS-1000 He and Hepta systems. Supplied as 500 screens....
... Geneious does sequence alignment, 3D structure ... and more; all in a single application. ... several NCBI databases, Uniprot, sort and filter ... how you want it, rapidly searching, filtering ...
... a comprehensive suite of advanced statistics ... to reliably extract biological signals from ... containing thousands of samples, Partek Genomics ... will analyze large data sets on ...
Biology Products: