Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:10/20/2014)... , Oct. 20, 2014 Asterias Biotherapeutics, ... Company has signed a Notice of Grant Award ... (CIRM), effective October 1, 2014.  The NGA provides ... and the release of additional grant funds pursuant ... award for clinical development of Asterias, product, AST-OPC1. ...
(Date:10/20/2014)... PureTech , a science and technology development ... today the closing of a $55 million growth ... a $120 Billion group of funds. The funding ... forward and to advance new healthcare related products ... really go for the big ideas that can ...
(Date:10/19/2014)... 19, 2014 The Latin American hardware ... in Latin America with analysis and forecast of revenue. ... and is expected to reach $2,366.8 million by 2018, ... , Browse through the TOC of the Latin American ... the in-depth analysis provided. It also provides a glimpse ...
(Date:10/19/2014)... The Asian Automatic patient billing report defines and segments ... revenue. The Automatic patient billing market in Asia is ... at a developing CAGR of 7.2% from 2013 to ... Automatic patient billing market, to get an idea of ... of the segmentation of this market in the same ...
Breaking Biology Technology:Asterias Biotherapeutics Announces Notice of Grant Award with CIRM for Phase 1/2a Clinical Trial of AST-OPC1 in Complete Cervical Spinal Cord Injury 2Asterias Biotherapeutics Announces Notice of Grant Award with CIRM for Phase 1/2a Clinical Trial of AST-OPC1 in Complete Cervical Spinal Cord Injury 3Asterias Biotherapeutics Announces Notice of Grant Award with CIRM for Phase 1/2a Clinical Trial of AST-OPC1 in Complete Cervical Spinal Cord Injury 4PureTech Announces Expansion with Oversubscribed $55M Funding Round 2PureTech Announces Expansion with Oversubscribed $55M Funding Round 3PureTech Announces Expansion with Oversubscribed $55M Funding Round 4PureTech Announces Expansion with Oversubscribed $55M Funding Round 5PureTech Announces Expansion with Oversubscribed $55M Funding Round 6The Latin American hardware encryption display market is expected to reach $2,366.8 million by 2018 - New Report by MicroMarket Monitor 2The Latin American hardware encryption display market is expected to reach $2,366.8 million by 2018 - New Report by MicroMarket Monitor 3The Asian Automatic patient billing market is estimated to grow to around $463.9 million by 2018 - New Report by MicroMarket Monitor 2The Asian Automatic patient billing market is estimated to grow to around $463.9 million by 2018 - New Report by MicroMarket Monitor 3
... , Carsten-Peter Carstens Anna Waesche ,Stratagene , ... ,BL21-Gold cells * called the BL21-CodonPlus ... E. coli argU,ileY, and leuW tRNA genes. This modification ... to express in conventional E. coli,hosts due to the ...
... PCR mutagenesis kit produces a unique , mutational spectrum , ... , , ... Stratagene , , , ... The , GeneMorph PCR , mutagenesis kit ...
... precast gels* eliminate the need to manually pour gels, ... means no more gels,lost to bubbles or leaking.All CastAway ... 60 days from the date of manufacture, with no,detectable ... 32 Preformed Wells , Stratagene adds a new 6% ...
Cached Biology Technology:Codon Bias-Adjusted BL21 Derivatives for Protein Expression 2Codon Bias-Adjusted BL21 Derivatives for Protein Expression 3Codon Bias-Adjusted BL21 Derivatives for Protein Expression 4Codon Bias-Adjusted BL21 Derivatives for Protein Expression 5Codon Bias-Adjusted BL21 Derivatives for Protein Expression 6Codon Bias-Adjusted BL21 Derivatives for Protein Expression 7Randomize Gene Sequences with New PCR Mutagenesis Kit 2Randomize Gene Sequences with New PCR Mutagenesis Kit 3Randomize Gene Sequences with New PCR Mutagenesis Kit 4Randomize Gene Sequences with New PCR Mutagenesis Kit 5Randomize Gene Sequences with New PCR Mutagenesis Kit 6Randomize Gene Sequences with New PCR Mutagenesis Kit 7Randomize Gene Sequences with New PCR Mutagenesis Kit 8Randomize Gene Sequences with New PCR Mutagenesis Kit 9Randomize Gene Sequences with New PCR Mutagenesis Kit 10Randomize Gene Sequences with New PCR Mutagenesis Kit 11Four New CastAway Precast Gels 2
(Date:10/14/2014)... in Cancer Research shows SIRT6—a protein known ... promote the development of skin cancers by turning on ... sun-damaged skin cells. , Previously considered protective, SIRT6 is ... that help regulate genomic stability and prevent some of ... DNA damage, which can lead to cancer. This study, ...
(Date:10/14/2014)... a new kind of stem cell that can become either ... vessels, according to a study published today in the journal ... cell type contradicts current theory on how organs arise from ... origins of, and future treatment for, liver cancer., Thanks to ... complex being made up of more than 200 cell types. ...
(Date:10/14/2014)... week, an international team of researchers, led by the ... the journal Nature Genetics a brief genomic ... varieties of the tomato plant. , The C.M. Rick ... important role in this study by providing seed of ... This study, which builds on the first tomato genome ...
Breaking Biology News(10 mins):Two-faced gene: SIRT6 prevents some cancers but promotes sun-induced skin cancer 2Stem cell discovery challenges dogma on how fetus develops; holds insights for liver cancer and reg 2Stem cell discovery challenges dogma on how fetus develops; holds insights for liver cancer and reg 3
... the Center for Integrated Manufacturing Studies at Rochester Institute ... which blends 20 percent ethanol with gasoline, reduces the ... with traditional gasoline or E10 blends. In addition, the ... or maintenance in conventional internal combustion engines. The ...
... have identified some two million species, where can you ... that unites them all? A vastly improved database gives ... evolutionary relationships among living things. TreeBASE ... study evolutionary trees was first developed in the ...
... of a chemical family they hope will lead to ... specifically against a childhood tumor, according to research led ... chemical is the first small-molecule inhibitor to target the ... childhood eye tumor retinoblastoma as well as certain cases ...
Cached Biology News:E20 fuel reduces carbon monoxide and hydrocarbon emissions in automobiles 2Database gives access to the latest findings about the tree of life 2Database gives access to the latest findings about the tree of life 3Advances reported in quest for drugs targeting childhood cancer 2
... Super-Sensitive, Super-Dark, Super-Small! ... with the ChemiDoc-It Imaging System. High-sensitivity ... produces low-background noise and wide dynamic ... a short exposure time. The light-tight ...
Mouse monoclonal [X223] to Lamin B1 + B2 - Nuclear Envelope Marker ( Abpromise for all tested applications). entrezGeneID: 4001 SwissProtID: P20700...
... Evidence Based Oligonucleotide) Genome Set and MEEBO ... Set contain a collection of open source ... exons, allowing interrogation of thousands of genes. ... Stanford University and UCSF, the sets enable ...
odz, odd Oz/ten-m homolog 1 [Source:RefSeq_peptide;Acc:NP_055068] Antigen: Recombinant Protein Epitope Signature Tag (PrEST)....
Biology Products: