Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:5/29/2015)... 29, 2015  Caris Life Sciences® today announced ... which researchers utilized Caris Molecular Intelligence®, the company,s ... therapeutic targets in patients with colorectal and pancreatic ... cell death protein 1 (PD-1) and its ligand, ... the 2015 American Society of Clinical Oncology Annual ...
(Date:5/29/2015)... Seoul Semiconductor (CEO: Chung-hoon Lee, ... on May 28th announced that it will increase ... its high efficient and high reliable LED product ... Seoul Semiconductor has developed efficient and reliable LED ... supplied LEDs for headlamps to global auto makers. ...
(Date:5/28/2015)... May 28, 2015 ... has announced the addition of Jain ... Technologies, Markets and Companies"  to their ... report describes and evaluates animal biotechnology ... and pharmaceuticals as well as improvement ...
(Date:5/28/2015)... IN (PRWEB) May 28, 2015 The Academy ... National Model Aviation Day on August 15, 2015. National Model ... aviation nation-wide and to introduce model flying to the general ... 2,350 chartered clubs to participate in the celebration by hosting ... registered to host National Model Aviation Day events. View ...
Breaking Biology Technology:Multi-Platform Molecular Profiling from Caris Life Sciences Identifies Clinically Actionable Targets for Novel Immunotherapy Drugs 2Multi-Platform Molecular Profiling from Caris Life Sciences Identifies Clinically Actionable Targets for Novel Immunotherapy Drugs 3Multi-Platform Molecular Profiling from Caris Life Sciences Identifies Clinically Actionable Targets for Novel Immunotherapy Drugs 4Seoul Semiconductor Increases the Global Automotive LED Market Share with its High Efficient and Reliable LEDs for Automotive Lightings 2Global Animal Biotechnology Report 2015 - Technologies, Markets and Companies Analysis to 2024 2Global Animal Biotechnology Report 2015 - Technologies, Markets and Companies Analysis to 2024 3Model flying pilots celebrate the Academy of Model Aeronautics Foundation’s Third Annual National Model Aviation Day 2
... (Nasdaq and SWX: BMRN) announced today that Asubio,Pharma ... received marketing,approval from the Japanese Ministry of Health, ... Biopten(R) (sapropterin dihydrochloride), which,contains the same active ingredient ... patients with phenylketonuria (PKU). BioMarin will receive a,milestone ...
... and EM Holdings B.V. (the,"Concerned Shareholders") are disappointed ... in Biovail ,s press release issued earlier today., ... date has been misinformation,coming from Biovail. Once again, ... tactics," stated Bruce Brydon, one of the Concerned ...
... Party Administrators,Alliance (TPAA) announced today the appointment of ... nation,s first alliance of third party,administrators and provides ... its members., Oelschlager brings hands-on experience in ... assets he believes will further the,organization,s reach and ...
Cached Biology Technology:Biopten (Sapropterin Dihydrochloride) Approved by Japanese Ministry of Health for the Treatment of PKU 2Biopten (Sapropterin Dihydrochloride) Approved by Japanese Ministry of Health for the Treatment of PKU 3Biopten (Sapropterin Dihydrochloride) Approved by Japanese Ministry of Health for the Treatment of PKU 4The TPAA Names Mark Oelschlager President 2
(Date:4/21/2015)... Canada , April 21, 2015 ... and evolving government policies are boosting access control systems ... According to a recently published report by ... Opportunities, 2020 ", the access control systems market in ... nearly USD1.2 billion by 2020.The access control systems market ...
(Date:4/20/2015)... The announcement comes as demand ... Management (GRM), Ireland,s foremost records management ... built up an impressive track record of clients within the ... the records management sector in Dubai . ... staffbase and employ a further eight staff members at its ...
(Date:4/14/2015)...  HYPR Corp. today announced it has joined ... tm , an industry consortium transforming online authentication ... technology and collaborate to deliver open specifications for ... and private, and easier to use. ... sensitive user information and eliminates the dependency on ...
Breaking Biology News(10 mins):Saudi Arabia Access Control Systems Market to Touch USD1.2 Billion by 2020 Says TechSci Research 2Saudi Arabia Access Control Systems Market to Touch USD1.2 Billion by 2020 Says TechSci Research 3Glenbeigh Records Management Wins Contract With Dubai Islamic Bank 2Glenbeigh Records Management Wins Contract With Dubai Islamic Bank 3HYPR Corp. Joins the FIDO Alliance 2HYPR Corp. Joins the FIDO Alliance 3
... Cancer Research Foundation, a non-profit organization focused on ... recipients of the Dale F. Frey Award for ... funding to scientists completing a prestigious Damon Runyon ... highest expectations and are most likely to make ...
... been in use for decades. But manufacturers are ... new developments: Substantial influences of the microscopic material ... directly. The synthetic polymer molecules are simply too ... team of physicists led by professor Andreas Bausch ...
... are developing technology that could ultimately sequence a person,s ... cost of current commercial techniques. The researchers have ... lead to an ultrafast commercial DNA sequencing tool within ... published this month in the journal , Nano Letters ...
Cached Biology News:Damon Runyon Cancer Research Foundation awards breakthrough scientists 2Muscle filaments make mechanical strain visible 2Your genome in minutes: New technology could slash sequencing time 2Your genome in minutes: New technology could slash sequencing time 3
Peptide-affinity Purified Polyclonal Antibody to Prolactin Releasing Hormone Receptor (GPR10)...
Applications: Western blotting ...
Mitochondria/Cytosol Fractionation Kit Research Focus: other Storage Temperature: 4C Shipping Temperature: 4C...
... With increasing age, the autofluorescent ... of many cell types, including neurons. ... complicate the use of fluorescence microscopy ... of its broad excitation and emission ...
Biology Products: