Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:6/20/2013)... (PRWEB) June 20, 2013 The ... outcomes measurement because of variability in Patient-Reported Outcomes ... sensitivity of such scales to culture, their cross-cultural ... laboratory testing for the successful development of a ... steps for maximizing cross-cultural equivalence of scales assessing ...
(Date:6/20/2013)... 20, 2013 Based on its recent ... Sullivan presents bitop AG with the 2013 European ... The company,s path-breaking extremolyte platform enables a naturally-derived ... dry eye or dry nose syndrome, and respiratory ... to revolutionize how allergies are treated. ...
(Date:6/20/2013)... June 20, 2013 Over the years, ... has received many questions that can be summed up in ... Owner of GLM Displays, Matt Lunser, sat down and ... between his products and offer some useful tips on how ... , “This buyer's guide is meant to help our clients ...
(Date:6/20/2013)... Belatrix Software, the leading global Nearshore Agile ... latest initiative – the Belatrix Software Innovation University (BSIU). ... and business and technology executives to participate in a ... the initiative is to fuel business leaders with what ... innovation efforts. It’s that inspiration that has the ...
Breaking Biology Technology:Cross-Cultural Qualitative Research for Simultaneous Scale Development, New Life Science Webinar Hosted by Xtalks 2Frost & Sullivan Presents bitop AG with the 2013 New Product Innovation Award in the Extremolytes Therapeutics Market 2Frost & Sullivan Presents bitop AG with the 2013 New Product Innovation Award in the Extremolytes Therapeutics Market 3Frost & Sullivan Presents bitop AG with the 2013 New Product Innovation Award in the Extremolytes Therapeutics Market 4Belatrix Software Kicks off Major Innovation Effort and Invites Innovation Expert to Share How Agile + Design Thinking Accelerate Product Innovation 2
... 2011 K-V Pharmaceutical Company (NYSE:  KVa/KVb) announced today ... divest Nesher Pharmaceuticals, Inc., its generics subsidiary, and the ... Inc. for approximately $60 million in cash. The transaction ... KV,s 2012 fiscal year, subject to customary closing conditions. ...
... they left a trail of breadcrumbs to find their ... System (GPS), WiFi, and Bluetooth are the digital signals ... helping us find our location and map our routes. ... few exceptions, today,s firefighters still rely on 20th-century radios, ...
... Background : The U.S. House of Representatives ... appropriations bill, co-sponsored by Rep. Don Young (R-AK) and Rep. ... Drug Administration approval of salmon grown from AquaBounty Technologie,s AquAdvantage ... ten of the total 435 House members. ...
Cached Biology Technology:K-V Pharmaceutical Announces Divestiture of Generics Business to Zydus 2K-V Pharmaceutical Announces Divestiture of Generics Business to Zydus 3K-V Pharmaceutical Announces Divestiture of Generics Business to Zydus 4K-V Pharmaceutical Announces Divestiture of Generics Business to Zydus 5K-V Pharmaceutical Announces Divestiture of Generics Business to Zydus 6K-V Pharmaceutical Announces Divestiture of Generics Business to Zydus 7Wireless 'breadcrumbs' that wont become toast when baked...or soggy when hosed 2Wireless 'breadcrumbs' that wont become toast when baked...or soggy when hosed 3Statement by Ronald L. Stotish, Ph.D., President and CEO of AquaBounty Technologies 2
(Date:6/19/2013)... , June 20, 2013 Based ... market, Frost & Sullivan recognizes geneOnyx Limited with ... New Product Innovation. geneOnyx leverages a DNA testing ... create an on-the-spot genetic test for anti-aging cosmetics. ... DNA collection procedure from saliva to examine single ...
(Date:6/19/2013)... network in Tanzania is playing a vital role in ... west in response to climate and environmental changes, according ... Using data on savannah birds from the Tanzanian Bird ... over recent decades - the researchers found that they ... move to areas further west where dry seasons are ...
(Date:6/19/2013)... 2013   Mercy Medical Center ... for conducting on-demand, Hemoglobin A 1c ... as analysis of important red blood cell, ... new system enables the hospital to provide ... and their patients, which can improve treatment ...
Breaking Biology News(10 mins):Frost & Sullivan Applauds geneOnyx for its DNA Testing Solution for the Personalized Cosmeceuticals Market 2Frost & Sullivan Applauds geneOnyx for its DNA Testing Solution for the Personalized Cosmeceuticals Market 3Frost & Sullivan Applauds geneOnyx for its DNA Testing Solution for the Personalized Cosmeceuticals Market 4Protected areas provide African birds with stepping stones to survival 2Mercy Lab Offers Faster On-demand Diabetes Testing, Cellular Studies 2Mercy Lab Offers Faster On-demand Diabetes Testing, Cellular Studies 3Mercy Lab Offers Faster On-demand Diabetes Testing, Cellular Studies 4
... In much of Africa, a herd of cattle is ... dowry, funeral fund, symbol of wealth, and hedge against drought. ... cow to disease can spell ruin. Yet a grievous ... puts annual losses from disease at $40 billion, some twenty-five ...
... HOUSTON -- (Aug. 17, 2010) -- The most robust statistical ... Eve" -- the maternal ancestor of all living humans -- ... University study was based on a side-by-side comparison of 10 ... lived using a very different set of assumptions about the ...
... could lead to a brand new class of drugs to ... and back pain without numbing the whole body. ... Council (BBSRC) and working at UCL (University College London), have ... pain are regulated by molecules inside cells called small RNAs. ...
Cached Biology News:Cow vaccines go vroom 2Cow vaccines go vroom 3Mother of all humans lived 200,000 years ago 2Mother of all humans lived 200,000 years ago 3Scientists uncover Achilles heel of chronic inflammatory pain 2
... Shimadzus GCMS-QP2010s Gas Chromatograph/Mass Spectrometer, utilizing ... the GCMS-QP2010 Plus, offers high throughput ... an excellent performance-to-cost ratio. Like the ... constant linear velocity for optimum separation, ...
... combines a single-channel sample processing head, an ... reagent dispenser all in one compact, affordable ... pipette tips, the Precision XS autoclavable and ... available for transferring larger volumes. Intuitive Precision ...
... world of discovery races ever faster, you need ... fast track. So our constant focus is on ... research. Thats why our Biomek 3000 Laboratory Automation ... advanced as it is flexible. By integrating all ...
... Zymeds MaxArray Rabbit Tissue Arrays contain 60 ... slides. Each package contains 4 unstained slides and ... your reference. Each slide contains 15 different tissues ... 60 tissue samples per slide. Each tissue sample ...
Biology Products: