Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:11/21/2014)... November 21, 2014 Why did Stephen ... Albert Einstein so instantly recognizable? Why have they become ... astronomer and author Hilton Ratcliffe seeks out the answers ... at all to do with science. In " Stephen ... , November 21, 2014), Ratcliffe puts it plainly: ...
(Date:11/21/2014)... and SAN DIEGO , Nov. ... today announced that President and CEO Marc Hedrick , M.D. ... DATE:   Thursday, December 4, 2014 TIME:    ... here or paste this URL into your browser,s ... that investors pre-register to save time and receive event updates. ...
(Date:11/18/2014)... 2014 pH measurement and control is ... pharmaceutical, chemical, and food and beverage industries. But what ... how do pH sensors work? METTLER TOLEDO has produced ... process industries with these questions and more. , METTLER ... the process industries. The actual sensor, the pH electrode, ...
(Date:11/18/2014)... (PRWEB) November 18, 2014 ... (PTMEG) Industry is professional and in-depth report ... Polytetrahydrofuran basic information, including its definition, characterization, ... industry outline. This exploration covers the worldwide ... worldwide industry examination covering macroeconomic environment & ...
Breaking Biology Technology:“Stephen Hawking Smoked My Socks” Sparks Controversy in Science World 2“Stephen Hawking Smoked My Socks” Sparks Controversy in Science World 3“Stephen Hawking Smoked My Socks” Sparks Controversy in Science World 4Cytori Therapeutics to Provide Corporate Update and Investor Presentation on December 4 through a Live, Interactive Webcast 2Cytori Therapeutics to Provide Corporate Update and Investor Presentation on December 4 through a Live, Interactive Webcast 3Cytori Therapeutics to Provide Corporate Update and Investor Presentation on December 4 through a Live, Interactive Webcast 4pH Guide from METTLER TOLEDO Explains Measurement, Theory and Practice of pH Applications 2PTMEG Market: 2019 Global Polytetrahydrofuran Industry Development Trends & Analysis Now at DeepResearchReports.com 2PTMEG Market: 2019 Global Polytetrahydrofuran Industry Development Trends & Analysis Now at DeepResearchReports.com 3
... Mo., Dec. 8 An investor group in Trinity,Biotech ... developer and manufacturer of,diagnostic products, has reconfigured the slate ... special meeting of the company,s shareholders,that the group is ... behalf of,the group, announced that Robert S. Winter, the ...
... 8 Rigel,Pharmaceuticals, Inc. (Nasdaq: RIGL ) today ... will participate in a panel,discussion at the 2008 RBC Capital ... Inflammation and Rheumatology", will take,place on Wednesday, December 10, 2008 ... New York City. , ...
... ATS Medical, Inc.,(Nasdaq: ATSI ), manufacturer and marketer ... received FDA clearance for the,marketing of the ATS 3f(R) Aortic ... improved valve holder accessory device. , ... While the ATS 3f Aortic Bioprosthesis ...
Cached Biology Technology:Investor Group Reconfigures Proposed Slate of Replacement Directors for Trinity Biotech 2ATS Medical Provides Update on US Commercialization of Its ATS 3f Aortic Bioprosthesis 2ATS Medical Provides Update on US Commercialization of Its ATS 3f Aortic Bioprosthesis 3
(Date:11/5/2014)... Santamaria, associate professor of biology in the UTSA ... in the nation selected to receive a two-year ... for Exploratory Research (EAGER). The funding supports President ... researchers to create new technology that will demystify ... complex behaviors in neuroscience are broken into the ...
(Date:11/4/2014)... University School of Medicine announced today that it ... funded by the Bill & Melinda Gates Foundation. ... Gynecology and Reproductive Sciences; and Vice Chair of ... of Medicine will pursue an innovative global health ... to Assess Fetal Neurodevelopment.", Grand Challenges Explorations (GCE) ...
(Date:11/4/2014)... , Nov. 4, 2014   Neurotechnology ... today announced that the latest version of its ... the Ongoing MINEX evaluation organized by ... fingerprint algorithms using the INCITS 378 fingerprint standard ... requirement in public tenders in the ...
Breaking Biology News(10 mins):UTSA biology professor awarded $300,000 NSF grant for brain research 2UTSA biology professor awarded $300,000 NSF grant for brain research 3Temple University School of Medicine receives Grand Challenges Explorations grant 2Neurotechnology Places Second in Ongoing MINEX Ranking for Fingerprint Matching Algorithms 2Neurotechnology Places Second in Ongoing MINEX Ranking for Fingerprint Matching Algorithms 3
... are the only males that actually become pregnant and give ... The Year awards their attitude towards their offspring can ... findings from Texas A&M University researchers. Kim Paczolt and Adam ... male pipefish can be a nurturing father as it tends ...
... This release is available in French ... switches on an extremely important process for the proper ... fast-track transportation pathway of ,cargo, to and from the ... can have severe consequences, leading to numerous diseases such ...
... National Medical Center have discovered that African American ... more likely to have low levels of vitamin D ... supports recent research that suggests vitamin D plays a ... healthy. Vitamin D deficiency has been recently linked to ...
Cached Biology News:A marine Mr. Mom: Male pipefish gives birth, but some are deadbeat dads, study shows 2Getting turned on 2Getting turned on 3Study: Low levels of vitamin D linked to higher rates of asthma in African-American kids 2
... Kit provides a fast and simple procedure ... protein samples. The kit is based on ... as an ion exchanger. Salts such as ... affinities for Norgens resin and are easily ...
... 435 is an affordable, compact benchtop ... slides, providing a broad array of ... acquires high-resolution images with high-performance laser ... excitation and emission filter changers, and ...
... The ProteoSpin CBED Maxi Kit provides a ... of dilute protein solutions for buffer exchange, and ... samples. The kit is based on spin-column chromatography ... exchanger. Salts such as MgCl 2 , NaCl, ...
... hybridization chamber assembly (1 each) Components ... chamber user guide plastic tweezersChambers are ... cleaned and reused. The chamber is designed ... kits and all custom oligo microarrays, in ...
Biology Products: