Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:12/24/2014)... Md. , Dec. 24, 2014  United ... today that Medtronic, Inc. (NYSE: MDT ... the U.S. Food and Drug Administration (FDA) for ... implantable drug infusion system (including a newly developed ... (treprostinil) Injection delivered intravenously to patients with ...
(Date:12/24/2014)... “Preparative & Process Chromatography Market ... (Columns, Solvents, Buffers, Valves, Guages, Seals), Accessories, Services, ... Forecasts to 2019” provides a detailed overview of ... trends, and strategies impacting the preparative and process ... of the revenue and share analysis. , ...
(Date:12/24/2014)... On Friday, December 19, 2014, ... Omnibus and Continuing Resolution Appropriations Act of 2015, ... condition eligible to receive funding through the Congressionally ... Department of Defense (DoD). The Hydrocephalus Association (HA), ... Hill, is celebrating this victory for the over ...
(Date:12/24/2014)... The report expects global cell isolation and expansion market ... a carefully analyzed data about the vital drivers, restraints, ... Full Copy of Report @ http://bit.ly/1yUxy0T , ... expansion will keep witnessing growth at an impressive CAGR ... driven by rapid technological advancements, government funding and investments, ...
Breaking Biology Technology:United Therapeutics Announces Submission Of Pre-Market Approval Application For Implantable Drug Infusion System To Deliver Remodulin 2United Therapeutics Announces Submission Of Pre-Market Approval Application For Implantable Drug Infusion System To Deliver Remodulin 3United Therapeutics Announces Submission Of Pre-Market Approval Application For Implantable Drug Infusion System To Deliver Remodulin 4Preparative and Process Chromatography Market is expected to reach $9 billion by 2019 - New Report by Marketsandmarkets 2Preparative and Process Chromatography Market is expected to reach $9 billion by 2019 - New Report by Marketsandmarkets 3Preparative and Process Chromatography Market is expected to reach $9 billion by 2019 - New Report by Marketsandmarkets 4Rare Brain Condition Now Eligible for Department of Defense Research Dollars 2The Cell Expansion Market is Expected to Reach $14.8 billion by 2019 - New Research Report by MarketsandMarkets 2The Cell Expansion Market is Expected to Reach $14.8 billion by 2019 - New Research Report by MarketsandMarkets 3
... the,Battelle National Biodefense Institute, LLC raised enough money ... Board,s Community Agency,School Services., "Having the required ... some,parents are challenged with given the cost," said ... for several years to provide all children in,Frederick ...
... --,China-Biotics, Inc. (OTC Bulletin Board: CHBT) ... specializing in the manufacture,research, development, marketing ... it signed a one-year contract with ... to supply probiotics for,Square Pharmaceutical,s probiotics-based ...
... NovaRx Corporation announced today,that the company ... of,Lucanix(R) (belagenpumatucel-L) in the treatment of advanced ... enrolled in the study was treated by,Dr. ... the University,of California, San Diego School of ...
Cached Biology Technology:BNBI Employees Donate 1,000 Backpacks to Frederick County School Children 2China-Biotics, Inc. Continues to Broaden Bulk Additives Client Base 2China-Biotics, Inc. Continues to Broaden Bulk Additives Client Base 3NovaRx Initiates Pivotal Phase III Clinical Trial in Lung Cancer Patients 2NovaRx Initiates Pivotal Phase III Clinical Trial in Lung Cancer Patients 3NovaRx Initiates Pivotal Phase III Clinical Trial in Lung Cancer Patients 4
(Date:12/17/2014)... , Dec. 15, 2014  HITLAB SM ... Practices (GCP) audit to confirm its adherence to ... This accomplishment enables HITLAB to conduct regulated smart ... highest principles for patient safety and research quality. ... healthcare access, quality, and delivery with innovative technology," ...
(Date:12/15/2014)... 12, 2014 Research and Markets ... the "Global Facial Recognition Market 2015-2019" ... http://photos.prnewswire.com/prnh/20130307/600769 Facial recognition is ... Facial recognition system measures the overall facial feature ... mouth, and the distance between eyes. Facial recognition ...
(Date:12/11/2014)... ST. PAUL, Minn. , Dec. 10, 2014 ... in wireless physiologic monitoring, has released a new ... changing needs of preclinical toxicology researchers. M series, ... to help toxicologists collect the best possible physiologic ... studies. Adding functional endpoints to toxicology ...
Breaking Biology News(10 mins):HITLAB Completes GCP Audit for FDA Smart Device & App Compliance 2Global Facial Recognition Market 2015-2019: Key Vendors are 3M Cogent, Cognitec Systems, NEC and Safran Group 2Global Facial Recognition Market 2015-2019: Key Vendors are 3M Cogent, Cognitec Systems, NEC and Safran Group 3New telemetry implants expected to change how large animal toxicology studies are conducted 2
... North telescope and W.M. Keck Observatory on Hawaii,s Mauna Kea, ... first-ever direct images identifying a multi-planet system around a normal ... make the initial discovery of two of the planets in ... 2007. Then, on Oct. 25, 2007, and in the summer ...
... microorganism discovered in the open ocean may force scientists to ... ocean ecosystems. A paper describing the new findings appears ... . A research team led by Jonathan Zehr, a ... the new microbe by analyzing its genetic material, even though ...
... life started remains a major challenge for science. At ... Science, conference in Sicily in October, scientists discussed two ... systems theory to the chemistry that preceded early life. ... evidence about what Earth was like when life evolved. ...
Cached Biology News:Planetary "first family" discovered by astronomers using Gemini and Keck Observatories 2Mysterious microbe plays important role in ocean ecology 2Mysterious microbe plays important role in ocean ecology 3Complex systems and Mars missions help understand how life began 2Complex systems and Mars missions help understand how life began 3
Bethyl Laboratories packages antibodies, conjugates and calibrators to provide quantitative ELISA kits. Each kit contains the following components, sufficient for 1000 single well assays....
Request Info...
Bethyl Laboratories packages antibodies, conjugates and calibrators to provide quantitative ELISA kits. Each kit contains the following components, sufficient for 1000 single well assays....
... and IHC Protocol Development ,Antibody Titer ... in Animal or Human Cells and ... and Tissues ,Peroxidase, Alkaline Phosphatase, Immunogold, ... Electron Microscopy ,Protein Localization in Transgenic ...
Biology Products: