Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol

Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:11/25/2009)...,, MARKHAM,ON,Nov.25/PRNewswire/-Cytochromatoda...ofDirectors.Dr.MoldtwillreplaceMr.UlrikSporkastheN...fBoardmembersremainsunchangedatsixmembers. ,, "...okforwardtobenefitingfromhisexperienceandguidancea...ngCKD-focusedspecialtypharmaceuticalcompany,"state...
(Date:11/24/2009)...,, HOUSTON,Nov.24/PRNewswire-FirstCall/--IES(Na...ndcommunicationssystemsandservicesforthecommercial...titscommercialbusinessgrouphasbeenawardedacontract...fortheLevel4bio-safetylab(BSL-4)replacementfacilit...Diseases(USAMRIID)atFortDetrickinFrederick,Md. ,...
(Date:11/24/2009)...,, REYKJAVIK,Iceland,November24/PRNewswire-Firs...nouncedthatithasreceivednoticefrom,theNasdaqStockM...spendedasofNovember30,2009andaForm25-NSEwillbefile...removedeCODE,scommonstock,fromlistingonNasdaq,unle...icationsPanel.Thecompanyhasfiledsuchanappeal,which...
(Date:11/24/2009)...,, SANMATEO,Calif.,Nov.24/PRNewswire-FirstCall/...companyfocusedondevelopingandcommercializingnovelp...Tonno,PresidentandChiefExecutiveOfficer,isschedule...ference,tobeheldDecember1-2,2009atTheNewYorkPalace...Ghiglieri,ChiefFinancialOfficer,willbeavailabletor...
Breaking Biology Technology:Cytochroma Announces Appointment of Peter Moldt to Board of Directors 2Integrated Electrical Services Awarded Contract to Provide Electrical Systems for U.S. Army Medical Research Institute of Infectious Diseases 2deCODE Receives Delisting Notice From Nasdaq, Plans to Appeal 2deCODE Receives Delisting Notice From Nasdaq, Plans to Appeal 3NeurogesX to Present at Piper Jaffray Health Care Conference 2NeurogesX to Present at Piper Jaffray Health Care Conference 3
...ces,Holdings, Inc. (Nasdaq: ADLS ), today announc...bcast at 10:30 am (EST) on Tuesday, January 22,200...nouncement that was,made yesterday by the US Food ...eting of the Anti-Infective Drugs Advisory Committ...al design for community acquired,pneumonia (CAP).,...
...der in clinical,solutions for radiation therapy an... utilizing Elekta technology to implement clinical...(VMAT)*. With the recent CE designation of,VMAT in...rsden Hospital in,Sutton, UK and General Hospital ...MAT solution., VMAT is a significant improvement ...
... to the,recent comments by certain plaintiff law f...ts, CellCyte Genetics Corporation (the "Company") ...g claims are without merit and,will be shown to be...etained the international law firm of Duane Morris...sly in these matters. Concurrently, the Company,wi...
Other Biology Technology:Advanced Life Sciences to Host Conference Call to Discuss Announcement Made Yesterday by FDA to Conduct Advisory Panel on CAP Drug Development 2Advanced Life Sciences to Host Conference Call to Discuss Announcement Made Yesterday by FDA to Conduct Advisory Panel on CAP Drug Development 3Elekta Announces First Two Clinical Sites Using VMAT Cancer Treatment Capability 2Elekta Announces First Two Clinical Sites Using VMAT Cancer Treatment Capability 3CellCyte Genetics Corp. Responds to Plaintiff Law Firm Press Releases 2CellCyte Genetics Corp. Responds to Plaintiff Law Firm Press Releases 3
(Date:11/23/2009)....C. The community-associated strain of the deadly...ant to most common antibioticsposes a far greater ...its way into hospitals, according to a study in th.... , The new threat is easily picked up in fitne...as increased the overall burden of MRSA within hos...
(Date:11/23/2009)... by the Wildlife Conservation Society says that we...the Republic of Congopart of the "mother lode" of ... becoming increasingly threatened by growing human... protection of the swamp forests adjacent to the s...recent surveys confirmed that high densities of th...
(Date:11/23/2009)...Ill. A new study provides "incontrovertible evide...he island of Sumatra about 73,000 years ago defore...the epicenter, researchers report. , The volcano...into the atmosphere, leaving a crater (now the wor... long and 35 kilometers wide. Ash from the event h...
Breaking Biology News(10 mins):New study finds MRSA on the rise in hospital outpatients 2A year after discovery, Congo's 'mother lode' of gorillas remains vulnerable 2Supervolcano eruption -- in Sumatra -- deforested India 73,000 years ago 2Potential Skin Cancer Breakthrough Tested at Scottsdale Healthcare Published Today in New England Journal of Medicine 4938 1Potential Skin Cancer Breakthrough Tested at Scottsdale Healthcare Published Today in New England Journal of Medicine 4938 2Potential Skin Cancer Breakthrough Tested at Scottsdale Healthcare Published Today in New England Journal of Medicine 4938 3Potential Skin Cancer Breakthrough Tested at Scottsdale Healthcare Published Today in New England Journal of Medicine 4938 4Martek Announces Third Quarter 2009 Financial Results 56082 1Martek Announces Third Quarter 2009 Financial Results 56082 2Martek Announces Third Quarter 2009 Financial Results 56082 3Martek Announces Third Quarter 2009 Financial Results 56082 4Martek Announces Third Quarter 2009 Financial Results 56082 5Martek Announces Third Quarter 2009 Financial Results 56082 6Martek Announces Third Quarter 2009 Financial Results 56082 7Martek Announces Third Quarter 2009 Financial Results 56082 8Martek Announces Third Quarter 2009 Financial Results 56082 9Martek Announces Third Quarter 2009 Financial Results 56082 10Martek Announces Third Quarter 2009 Financial Results 56082 11Martek Announces Third Quarter 2009 Financial Results 56082 12Gentiva 28R 29 Health Services Completes Acquisition of Home Health Agency 56080 1Gentiva 28R 29 Health Services Completes Acquisition of Home Health Agency 56080 2Gentiva 28R 29 Health Services Completes Acquisition of Home Health Agency 56080 3
... Research has shown for the first time that human ...rface epithelium (OSE) cells derived from adult hu...SE cells developed in vitro into mature eggs suita...yo. These findings, published today in the Open Ac...y, offer important new strategies for use in in vi...
... Scientists at Washington University School of Med...indow of opportunity" was critical to their earlie...ic pig tissues. , In those experiments, published...they didn,t have to give anti-rejection drugs to d...plants. They had expected rats that received no im...
... Researchers at UCLA and the Veterans Affairs Grea...rgest and most comprehensive study in comparing th...reating hepatitis B -- a disease affecting 350 mil...of Internal Medicine, the study may help physician...hers note that a degree of uncertainly exists on h...
Other Biology News:Human Eggs Can Develop From Ovarian Surface Cells In Vitro 2Precise Timing Enabled Pig-to-rat Transplants To Cure Diabetes 2Precise Timing Enabled Pig-to-rat Transplants To Cure Diabetes 3UCLA study assesses cost-effectiveness of Hepatitis B drugs 2UCLA study assesses cost-effectiveness of Hepatitis B drugs 3
... is commonly used as a fusion partner when express...as been reported to enhance the production and in ...When expressed in a soluble, properly folded form,...ilized glutathione. Gentle elution is achieved wit...
...ly of positioners, offering longer travel while ma... patterns mimic the MX80 family, allowing users to...ets to build multi-axis systems., , Miniature lin...ons to 5 gs , Velocities to 3 m/s , Encoder resolu...
...is from the C-terminal end of the mouse retinoic a...nce extends from amino acids 429 to 448 of RAR*. ...nus): C - P - S - V - S - P - S - S - V - E - N - ...inal cysteine has been added to facilitate conjuga...
...ity ready-to-use cryopreserved neural stem cells (...th and lineage commitment. Just thaw and plate the... in the format you need for a tissue-like mixture ...ytes and oligodendrocytes. Better than neurosphere...
Biology Products: