Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:8/3/2015)... 3, 2015  MiMedx Group, Inc. (NASDAQ: MDXG ... tissue and patent-protected processes to develop and market advanced ... Spine, Sports Medicine, Ophthalmic and Dental sectors of healthcare, ... th Annual Canaccord|Genuity Growth Conference in ... and CEO, William C. Taylor , President and ...
(Date:8/3/2015)... DOVER, Delaware , August 3, 2015 ... engaged in the commercialization of its Bio-electrical Signal Therapy ... the noninvasive treatment of hard to heal chronic wounds, ... distribution agreement with Chemipal, an Israeli distributor specializing in ... BST device. Chemipal is a 70 years ...
(Date:7/31/2015)... July 31, 2015 In today,s fast ... help them drive positive health outcomes, improve profitability ... of patient care in their communities. At ThoughtSpot ... and conference, AmerisourceBergen announced a new set of ... Administration Organization and help independent pharmacies endure the ...
(Date:7/30/2015)... AACC welcomed thousands of medical professionals ... Meeting & Clinical Lab Expo in ... showcased revolutionary advancements in clinical testing technology and ... to diagnose patients quickly and accurately and make ... As of Wednesday, July 29, more than ...
Breaking Biology Technology:MiMedx To Present At 35th Annual Canaccord|Genuity Growth Conference 2E-QURE Corp Signs Second Distribution Agreement in Israel 2E-QURE Corp Signs Second Distribution Agreement in Israel 3AmerisourceBergen Unveils Suite of Enhanced Capabilities for Independent Pharmacies at ThoughtSpot 2015 2AmerisourceBergen Unveils Suite of Enhanced Capabilities for Independent Pharmacies at ThoughtSpot 2015 3Innovative Research on Cancer, Heart Disease, and Infectious Diseases Draws More than 17,500 Attendees to 2015 AACC Annual Meeting 2Innovative Research on Cancer, Heart Disease, and Infectious Diseases Draws More than 17,500 Attendees to 2015 AACC Annual Meeting 3Innovative Research on Cancer, Heart Disease, and Infectious Diseases Draws More than 17,500 Attendees to 2015 AACC Annual Meeting 4
... will potentially enable access to MRI exams for ... implantable cardiac ... Boston,Scientific Corporation (NYSE: BSX ) and Surgi-Vision, ... development arrangement for,magnetic resonance imaging (MRI)-safe technology. Physician implanters ...
... ... 2008, FT. MYERS, Fla., April 15 ... the,Securities and Exchange Commission its annual report on Form 10-KSB for the,year ended ... http://www.SEC.gov ., The audited financial statements for the year ended December ...
... April 15 Arpida Ltd.,(SWX: ARPN) today announced ... Thursday,17 April 2008 at 8.30am CET. In this ... need and developments in the area of anti-infective,drugs ... meeting of the Anti-Infective,Drugs Advisory Committee. During that ...
Cached Biology Technology:Boston Scientific and Surgi-Vision Announce Licensing Agreement for MRI-Safe Technology 2Boston Scientific and Surgi-Vision Announce Licensing Agreement for MRI-Safe Technology 3NeoGenomics Files Annual Report on Form 10-KSB with the SEC 2Arpida Announces Conference Call on 17 April 2Arpida Announces Conference Call on 17 April 3
(Date:7/9/2015)... July 9, 2015  Synaptics Inc. (NASDAQ: SYNA ), ... that it will report financial results for the fourth ... 2015 after the close of market. The company will ... at 2:00 p.m. PT (5:00 p.m. ET), during which ... participate on the live call, analysts and investors should ...
(Date:7/9/2015)... , July 9, 2015  Unchained Labs just ... its acquisition of Avid Nano. Avid Nano designs, ... (DLS) systems.    Also today, Unchained ... and easiest to use protein sizing system. The ... a protein,s hydrodynamic size, size distribution, aggregation population ...
(Date:7/8/2015)... 8, 2015 Summary Pancreatic cancer is ... most fatal, with a mortality rate of 10.9 deaths ... pancreatic cancer patients has highlighted a significant need for ... being met by the current market. A highly ... with varying molecule types and mechanisms of action, which ...
Breaking Biology News(10 mins):Synaptics to Report Fourth Quarter, Fiscal Year 2015 Results on July 30 2Unchained Labs just can't get enough, acquires Avid Nano, rocks out the new pUNk! 2Frontier Pharma: Pancreatic Cancer - Identifying and Commercializing First-in-Class Innovation 2Frontier Pharma: Pancreatic Cancer - Identifying and Commercializing First-in-Class Innovation 3
... be placing their unborn children at increased risk of ... of construction workers in the Netherlands, conducted in part ... low birth weight and birth defects to paternal, airborne ... cleansers. , The study, although preliminary in its parent-reported ...
... on the eyes" may hit closer to the mark than ... the University of California, San Diego, and published in the ... depend on mental processing ease, or being "easy on the ... what your mind has been trained on," Winkielman said. "A ...
... human infants have located the source of a 30-year-old mystery ... , Scientists have known of the mouse line's naturally occurring ... of Medicine in St. Louis are the first to identify ... and the origins of the disease. , "The gene ...
Cached Biology News:Solvent exposure linked to birth defects in babies of male painters 2Beauty and the brain 2Beauty and the brain 3Scientists solve 30-year-old mystery of mutant mouse's kidney woes 2Scientists solve 30-year-old mystery of mutant mouse's kidney woes 3