Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes fina
'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:3/27/2015)... NEW YORK , 27. März 2015 ... Vilcek Prize in Biomedical Science für seine ... wie Proteine zwischen Zellkompartimenten transportiert werden, sowie ... den Zellen zur Reaktion auf Stress nutzen, ... zusammenhängt. Dr. Walter ist Professor für Biochemie ...
(Date:3/27/2015)... 27, 2015   SurePure, Inc . (OTCQB: ... today that the Company has completed the verification ... of SurePure ("SURP") securities on OTCQB, an electronic ... and development stage companies. On March ... eligibility requirements designed to improve marketplace integrity and ...
(Date:3/27/2015)... 27, 2015 Working in collaboration with ... London , Richmond Pharmacology is the first ... 3 study for an investigational RNAi therapeutic being developed for ... the nerves and heart. Read press release ... Based at St Georges University of London ...
(Date:3/27/2015)... , March 27, 2015  CASI Pharmaceuticals, Inc. ... the acquisition, development and commercialization of innovative therapeutics addressing ... market with a commercial focus on China ... and 12 months ended December 31, 2014.  ... million), or ($0.05) per share, for the three months ...
Breaking Biology Technology:Deutschstämmiger Zellbiologe Peter Walter gewinnt den Vilcek Prize in Biomedical Science 2015 2Deutschstämmiger Zellbiologe Peter Walter gewinnt den Vilcek Prize in Biomedical Science 2015 3Deutschstämmiger Zellbiologe Peter Walter gewinnt den Vilcek Prize in Biomedical Science 2015 4SurePure Completes Verification and Approved for Trading on the OTCQB Marketplace 2CASI Pharmaceuticals Reports 2014 Fourth Quarter And Full Year Financial Results 2CASI Pharmaceuticals Reports 2014 Fourth Quarter And Full Year Financial Results 3CASI Pharmaceuticals Reports 2014 Fourth Quarter And Full Year Financial Results 4CASI Pharmaceuticals Reports 2014 Fourth Quarter And Full Year Financial Results 5CASI Pharmaceuticals Reports 2014 Fourth Quarter And Full Year Financial Results 6
... Pa., Sept. 23 Environmental,Tectonics Corporation,s (Amex: ... announced the sale and placement of two BARA-MED(R) ... The,Shoreline Facility was established in Corpus Christi, Texas, ... care medical center in the region. The,facility offers ...
... Premacure to Initiate Phase II Trial for IPLEX(TM) ... UPPSALA, Sweden, Sept. 23 ,Insmed Inc. (Nasdaq CM: ... and Premacure AB, a biopharmaceutical company,dedicated to the ... due to premature birth, today noted the presentation ...
... Vein Recognition Device Helps BayCare Accurately,Identify Patients, ... Patient Privacy, SUNNYVALE, Calif., Sept. 23 ... leading supplier of innovative computer products,including hard ... announced that BayCare Health System, the largest ...
Cached Biology Technology:Environmental Tectonics Corporation Announces a Multiple Sale for Monoplace Hyperbaric Chambers 2Environmental Tectonics Corporation Announces a Multiple Sale for Monoplace Hyperbaric Chambers 3Insmed and Premacure Cite Study Results Demonstrating Potential Effectiveness of IPLEX(TM) in Preventing Blindness in Premature Infants 2Insmed and Premacure Cite Study Results Demonstrating Potential Effectiveness of IPLEX(TM) in Preventing Blindness in Premature Infants 3Insmed and Premacure Cite Study Results Demonstrating Potential Effectiveness of IPLEX(TM) in Preventing Blindness in Premature Infants 4Insmed and Premacure Cite Study Results Demonstrating Potential Effectiveness of IPLEX(TM) in Preventing Blindness in Premature Infants 5Fujitsu PalmSecure and HT Systems' PatientSecure Selected by BayCare Health System to Protect Patient Confidentiality and Prevent Medical Identity Theft 2Fujitsu PalmSecure and HT Systems' PatientSecure Selected by BayCare Health System to Protect Patient Confidentiality and Prevent Medical Identity Theft 3Fujitsu PalmSecure and HT Systems' PatientSecure Selected by BayCare Health System to Protect Patient Confidentiality and Prevent Medical Identity Theft 4Fujitsu PalmSecure and HT Systems' PatientSecure Selected by BayCare Health System to Protect Patient Confidentiality and Prevent Medical Identity Theft 5
(Date:3/20/2015)... -- NXT-ID, Inc. (NASDAQ: NXTD ) ("NXT-ID" or ... growing mobile commerce market, announces its biometric payment technology, ... featured in 2015 "I Want That" International CES Special, ... the DIY Network.   DIY,s "I Want ... site of the 2015 International CES for a firsthand ...
(Date:3/19/2015)... March 19, 2015  NXT-ID, Inc. (NASDAQ: NXTD ... on the growing mobile commerce market, announces its biometric payment ... clip that aired this week on Washington DC,s ... In a segment "The Next Great Thing", host ... way to pay, and ,a really big breakthrough in mobile ...
(Date:3/17/2015)... Minn. , March 17, 2015 ... technology company specializing in clinical study management systems, ... be in attendance at ARENA,s Outsourcing in Clinical ... NC.  This event provides an excellent forum for ... easy-to-use, flexible and affordable software-as-a-service (SaaS) eClinical technology ...
Breaking Biology News(10 mins):NXT-ID's Wocket Biometric Smart Wallet to Air on "I Want That" International CES Special 2NXT-ID's Wocket Biometric Smart Wallet to Air on "I Want That" International CES Special 3NXT-ID's Wocket Smart Wallet Featured on Fox News Segment, "The Next Great Thing" 2NXT-ID's Wocket Smart Wallet Featured on Fox News Segment, "The Next Great Thing" 3Connect With MedNet Solutions At Outsourcing In Clinical Trials Southeast 2
... BERKELEY, CA -- A link between the immune system ... themselves of obsolete or toxic parts may one day ... other deadly infectious diseases. Scientists with the U.S. Department ... have discovered proteins residing in both systems that point ...
... A study in the Sept. 21 on-line edition ... interaction of a critical molecule involved in cell death ... blocking this molecule, called Cyclophilin D (CypD), and development ... for the prevention and treatment of Alzheimer,s disease, according ...
... It seems that our brain can correct speech errors in ... Niels Schiller and Lesya Ganushchak, NWO researchers in Leiden, made ... errors. This research can contribute to improvements in the treatment ... language. Our brain is fairly good at preventing ...
Cached Biology News:Proteomics study yields clues as to how tuberculosis might be thwarting the immune system 2Proteomics study yields clues as to how tuberculosis might be thwarting the immune system 3Mitochondria could be a target for therapeutic strategy for Alzheimer's disease patients 2Brain recognizes verbal 'oh dear' wave 2
... is a new product number, created ... If showing no availability yet, please ... (Z71,487-9) or contact customer service for ... 100 mm, No. of sidearm 4 ...
... pYD1 Yeast Display Vector is specifically designed ... the surface of Saccharomyces cerevisiae. Displayed proteins ... interact with known or putative ligands. pYD1 ... consists of two domains Aga1 and Aga2 ...
Packaging: 6 bottles for 1 l ready-to-use-solution ID clarifier: ready-to-use solution ...
... Polyclonal Antibody against Aph-1a (Aph-1aL,S ... The gamma secretase is a multiprotein ... and Pen-2; all four proteins are ... gamma secretase complex catalyzes cleavage of ...
Biology Products: