Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst
Eppendorf 5 Prime, Inc. Introduction

It is not convenient in all instances to have blood drawn for gDNA extraction. The Eppendorf Perfect gDNA Blood Mini Kit was used to extract gDNA from saliva with only slight modifications to the protocol. The unique patent-pending trapping technology results in gDNA that is less sheared than the gDNA isolated using the common chaotropic bind-wash-and-elute technology. The gDNA also performs well in PCR as the main downstream application as well as in other downstream applications.

Materials

  • Perfect gDNA Blood Mini Kit
Required but not supplied:
  • Ethanol 95100%; pipette tips; Microcentrifuge; Eppendorf Thermo-mixer, water bath, or heat block at 70C; 15 ml centrifuge tubes.
  • 1x PBS (sufficient amounts are supplied in the kit for blood work, but additional amounts may be needed for saliva applications)
Method

Isolation of gDNA:

  1. Place 1 ml of saliva into a 15 ml centrifuge tube.
  2. Add 4 ml of 1x PBS.
  3. Centrifuge at 1,800 x g for 5 minutes
  4. Decant the supernatant. Add 200 l 1x PBS and re-suspend pellet.
  5. Add 20 l of Proteinase K solution into a 1.5 ml microcentrifuge tube. Transfer the re-suspension from step 4 into this same tube.
  6. Add 350 l Solution G1 to the microcentrifuge tube and mix.
  7. Incubate in Thermomixer at 70C, 900 rpm, for 10 minutes. A water bath may be used with intermittent vortexing of samples if a Thermomixer is not available.
  8. Centrifuge the sample for 3 minutes at 12,00016,000 x g.
  9. Add 200 l Solution G2 to the tube. Vortex vigorously for 5 seconds. Place a spin column in a fresh microcentrifuge tube. Transfer the sample to the spin column assembly by pouring or pipetting. Incubate the sample at room temperature for 1 minute.
  10. Centrifuge the sample for 2 minutes at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  11. Add 600 l Diluted Wash Buffer to the spin column. Centrifuge for 1 minute at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  12. Add 400 l Diluted Wash Buffer to the spin column. Centrifuge for 3 minutes at 12,00016,000 x g. Carefully remove the spin column without splashing Wash Buffer onto the bottom of the column. Place the spin column into a fresh microcentrifuge tube.
  13. Observe the filter membrane to make sure it is dry before proceeding. If the filter looks shiny, spin an additional 1 to 2 minutes before placing the spin column into the fresh microcentrifuge tube.
  14. Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
Gel Electrophoresis for Yield:
Determination
5% of each sample was run on a 0.6% agarose gel in 1x TBE. The gel was stained in ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes final extension
15C hold

Results

Average yields obtained from 1 ml of saliva vary from person to person, but are consistent when triplicate samples are processed for one person (see Fig. 1). In general, the yields are slightly less than the yields of 200 l of whole blood, but extremely high yields have also been observed. All samples perform equally well in PCR with no inhibition of amplification (see Fig.2).

Fig.1: Yields of gDNA isolated from two individuals using both the Perfect gDNA kit and the leading competitors kit gDNA was extracted from the saliva of two individuals in triplicate. 5% of each sample was run on a 0.6% agarose gel.

Top: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: EppendorfIndividual #1 Lanes 57: EppendorfIndividual #2 Bottom: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: CompetitorIndividual #1 Lanes 57: CompetitorIndividual #2 Fig. 2: PCR of gDNA isolated from saliva

Lane 1: GeneRuler Ladder Mix (Fermentas) Lane 2: Eppendorf: 50 ng gDNA template, individual #1; 536 bp fragment Lane 3: Eppendorf: 50 ng gDNA template, individual #1; 2 kb fragment Lane 4: Eppendorf: 50 ng gDNA template, individual #2; 536 bp fragment Lane 5: Eppendorf: 50 ng gDNA template, individual #2; 2 kb fragment Lane 6: Qiagen: 50 ng of gDNA template, individual #1; 536 bp fragment Lane 7: Competitor, 50 ng gDNA template, individual #1; 2 kb fragment Lane 8: Competitor, 50 ng gDNA template, individual #2; 536 bp fragment Lane 9: Competitor, 50 ng gDNA template, individual #2; 2 kb fragment Lane 10: 536 bp fragment no template control Lane 11: 2 kb fragment no template control Discussion

The Perfect gDNA Blood Mini Kit provides a versatile method of isolating gDNA from a variety of starting materials including saliva. The isolated DNA analyzed by gel electrophoresis shows consistent yield within triplicate samples from one individual. The DNA also appears to be significantly higher in molecular weight when isolated using the Perfect gDNA Blood Mini Kit in comparison to the competitor. The DNA in saliva can come from many sources including non-human origins such as bacteria and food particles. Success in amplification of the human beta-globin gene shows the presence of sufficient amounts of human gDNA for use in this downstream application. Overall, the Perfect gDNA Blood Mini Kit provides a fast, effective method for purifying gDNA from saliva.

References

  1. Use of the Polymerase Chain Reaction (PCR) process to amplify nucleic acids is covered by U.S. Patent Numbers 4683105 and 4683202 owned by Roche Molecular and requires a license

'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:7/28/2014)... new method of building materials using light, developed by ... enable technologies that are often considered the realm of ... , Although cloaked starships won,t be a reality ... developed for constructing materials with building blocks a few ... control the way that light flies through them, and ...
(Date:7/28/2014)... July 28, 2014 Sapphire Energy, Inc. ... announced the appointment of biotechnology veteran James Levine ... of directors. Levine replaces Cynthia ,CJ, Warner, who is ... remain chairman of the company,s board of directors. ... mission to deliver commercial scale algae-based fuels has been ...
(Date:7/28/2014)... 2014 The Workgroup for Electronic Data ... use of health IT to create efficiencies in healthcare ... (HPID) Workgroup has developed an issue brief titled, ... Payer?” The HPID Workgroup, a part of WEDI’s Strategic ... for Medicare and Medicaid Services (CMS) to identify common ...
(Date:7/28/2014)... (PRWEB) July 28, 2014 ... China Lubricant Industry” is a professional and ... Lubricant market. The report introduces Lubricant basic ... industry chain structure and industry overview. This ... China’s domestic market as well as global ...
Breaking Biology Technology:Building 'invisible' materials with light 2Sapphire Energy Announces New CEO James Levine 2Sapphire Energy Announces New CEO James Levine 3WEDI’s HPID Workgroup Announces Release of Issue Brief: “What is the Difference Between a Health Plan and Payer?” 2Lubricant Market & Adhesion Promoter Industry (Globa, China) Analysis Now Available at DeepResearchReports.com 2Lubricant Market & Adhesion Promoter Industry (Globa, China) Analysis Now Available at DeepResearchReports.com 3Lubricant Market & Adhesion Promoter Industry (Globa, China) Analysis Now Available at DeepResearchReports.com 4
... Veracyte, Inc ., a molecular diagnostics company pioneering the ... of Mark Spring as chief financial officer. ... the Veracyte team," said Bonnie Anderson, Veracyte,s cofounder and ... and senior finance leader in both public and private ...
... Calif., Jan. 26, 2012 Cepheid (Nasdaq: CPHD ... of $80.1 million.  Net loss was $1.6 million, or $(0.03) ... net income of $1.3 million, or $0.02 per diluted share, ... quarter net loss reflected a one-time, non-cash charge to cost ...
... Lend Lease is pleased to announce the appointment of ... Sciences group in the Atlantic Region.  Tom rejoined Lend ... of the Raleigh, NC office, working closely with the regional ... Atlantic offices. He will report directly to Steve Eberling, ...
Cached Biology Technology:Veracyte Appoints Mark Spring as Chief Financial Officer 2Veracyte Appoints Mark Spring as Chief Financial Officer 3Cepheid Reports Fourth Quarter and Full Year 2011 Results 2Cepheid Reports Fourth Quarter and Full Year 2011 Results 3Cepheid Reports Fourth Quarter and Full Year 2011 Results 4Cepheid Reports Fourth Quarter and Full Year 2011 Results 5Cepheid Reports Fourth Quarter and Full Year 2011 Results 6Cepheid Reports Fourth Quarter and Full Year 2011 Results 7Cepheid Reports Fourth Quarter and Full Year 2011 Results 8Cepheid Reports Fourth Quarter and Full Year 2011 Results 9Cepheid Reports Fourth Quarter and Full Year 2011 Results 10Cepheid Reports Fourth Quarter and Full Year 2011 Results 11Lend Lease Announces the Appointment of Tom Chapman as Director Operations for the Life Sciences Group in the Atlantic Region 2
(Date:7/28/2014)... discovery of two additional coral communities showing signs of damage ... of the 2010 spill in the Gulf of Mexico. The ... professor of biology at Penn State University. A paper describing ... in the Gulf of Mexico will be published during the ... of the journal Proceedings of the National Academy of ...
(Date:7/28/2014)... Amundsen reached the South Pole in 1911, but new ... any human. , Using data from 16 ice cores ... including the South Pole, a group led by Joe ... Nevada, created the most accurate and precise reconstruction to ... new record, described in an article published today in ...
(Date:7/28/2014)... An international team of researchers led by the University ... rice. , The genetic information will enhance scientists, and ... as well as enable the development of new rice ... environmental stressors to help solve global hunger challenges. , ... Oryza glaberrima ) and evidence for independent domestication," was ...
Breaking Biology News(10 mins):Impact of Deepwater Horizon oil spill on coral is deeper and broader than predicted 2Lead pollution beat explorers to South Pole, persists today 2Lead pollution beat explorers to South Pole, persists today 3Generating a genome to feed the world: UA-led team sequences African rice 2Generating a genome to feed the world: UA-led team sequences African rice 3Generating a genome to feed the world: UA-led team sequences African rice 4
... research suggests a higher-protein, lower-carbohydrate energy-restricted diet has a ... and increasing lean muscle, particularly when the proteins come ... September issue of the Journal of Nutrition, ... healthy, premenopausal women. Each consumed either low, medium ...
... wastewater recycling processes may generate more greenhouse gases than ... reasons to continue keep wastewater recycling among the water-resource ... of a new paper by Amy Townsend-Small, assistant professor ... and a team of researchers from the University of ...
... whizzes at learning a second language, but that ability begins ... at the University of Washington,s Institute for Learning & Brain ... prowess at learning languages, with the hope that the findings ... study, the researchers report that the brains of babies raised ...
Cached Biology News:Foods rich in protein, dairy products help dieters preserve muscle and lose belly fat: study 2Wastewater recycling can multiply greenhouse gas emissions 2Wastewater recycling can multiply greenhouse gas emissions 3Bilingual babies' vocabulary linked to early brain differentiation 2Bilingual babies' vocabulary linked to early brain differentiation 3
... PCRx Enhancer System is ... polymerases to optimize PCR of ... 10X PCRX Enhancer Solution with ... higher primer specificity broader magnesium ...
6-carboxy-2',4,4',5',7,7'-hexachlorofluorescein, succinimidyl ester (6-HEX, SE) *single isomer*...
Mouse Exodus 2 - 12kDa...
Fibulin-2 (D-15)...
Biology Products: