Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst
Eppendorf 5 Prime, Inc. Introduction

It is not convenient in all instances to have blood drawn for gDNA extraction. The Eppendorf Perfect gDNA Blood Mini Kit was used to extract gDNA from saliva with only slight modifications to the protocol. The unique patent-pending trapping technology results in gDNA that is less sheared than the gDNA isolated using the common chaotropic bind-wash-and-elute technology. The gDNA also performs well in PCR as the main downstream application as well as in other downstream applications.

Materials

  • Perfect gDNA Blood Mini Kit
Required but not supplied:
  • Ethanol 95100%; pipette tips; Microcentrifuge; Eppendorf Thermo-mixer, water bath, or heat block at 70C; 15 ml centrifuge tubes.
  • 1x PBS (sufficient amounts are supplied in the kit for blood work, but additional amounts may be needed for saliva applications)
Method

Isolation of gDNA:

  1. Place 1 ml of saliva into a 15 ml centrifuge tube.
  2. Add 4 ml of 1x PBS.
  3. Centrifuge at 1,800 x g for 5 minutes
  4. Decant the supernatant. Add 200 l 1x PBS and re-suspend pellet.
  5. Add 20 l of Proteinase K solution into a 1.5 ml microcentrifuge tube. Transfer the re-suspension from step 4 into this same tube.
  6. Add 350 l Solution G1 to the microcentrifuge tube and mix.
  7. Incubate in Thermomixer at 70C, 900 rpm, for 10 minutes. A water bath may be used with intermittent vortexing of samples if a Thermomixer is not available.
  8. Centrifuge the sample for 3 minutes at 12,00016,000 x g.
  9. Add 200 l Solution G2 to the tube. Vortex vigorously for 5 seconds. Place a spin column in a fresh microcentrifuge tube. Transfer the sample to the spin column assembly by pouring or pipetting. Incubate the sample at room temperature for 1 minute.
  10. Centrifuge the sample for 2 minutes at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  11. Add 600 l Diluted Wash Buffer to the spin column. Centrifuge for 1 minute at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  12. Add 400 l Diluted Wash Buffer to the spin column. Centrifuge for 3 minutes at 12,00016,000 x g. Carefully remove the spin column without splashing Wash Buffer onto the bottom of the column. Place the spin column into a fresh microcentrifuge tube.
  13. Observe the filter membrane to make sure it is dry before proceeding. If the filter looks shiny, spin an additional 1 to 2 minutes before placing the spin column into the fresh microcentrifuge tube.
  14. Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
Gel Electrophoresis for Yield:
Determination
5% of each sample was run on a 0.6% agarose gel in 1x TBE. The gel was stained in ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes final extension
15C hold

Results

Average yields obtained from 1 ml of saliva vary from person to person, but are consistent when triplicate samples are processed for one person (see Fig. 1). In general, the yields are slightly less than the yields of 200 l of whole blood, but extremely high yields have also been observed. All samples perform equally well in PCR with no inhibition of amplification (see Fig.2).

Fig.1: Yields of gDNA isolated from two individuals using both the Perfect gDNA kit and the leading competitors kit gDNA was extracted from the saliva of two individuals in triplicate. 5% of each sample was run on a 0.6% agarose gel.

Top: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: EppendorfIndividual #1 Lanes 57: EppendorfIndividual #2 Bottom: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: CompetitorIndividual #1 Lanes 57: CompetitorIndividual #2 Fig. 2: PCR of gDNA isolated from saliva

Lane 1: GeneRuler Ladder Mix (Fermentas) Lane 2: Eppendorf: 50 ng gDNA template, individual #1; 536 bp fragment Lane 3: Eppendorf: 50 ng gDNA template, individual #1; 2 kb fragment Lane 4: Eppendorf: 50 ng gDNA template, individual #2; 536 bp fragment Lane 5: Eppendorf: 50 ng gDNA template, individual #2; 2 kb fragment Lane 6: Qiagen: 50 ng of gDNA template, individual #1; 536 bp fragment Lane 7: Competitor, 50 ng gDNA template, individual #1; 2 kb fragment Lane 8: Competitor, 50 ng gDNA template, individual #2; 536 bp fragment Lane 9: Competitor, 50 ng gDNA template, individual #2; 2 kb fragment Lane 10: 536 bp fragment no template control Lane 11: 2 kb fragment no template control Discussion

The Perfect gDNA Blood Mini Kit provides a versatile method of isolating gDNA from a variety of starting materials including saliva. The isolated DNA analyzed by gel electrophoresis shows consistent yield within triplicate samples from one individual. The DNA also appears to be significantly higher in molecular weight when isolated using the Perfect gDNA Blood Mini Kit in comparison to the competitor. The DNA in saliva can come from many sources including non-human origins such as bacteria and food particles. Success in amplification of the human beta-globin gene shows the presence of sufficient amounts of human gDNA for use in this downstream application. Overall, the Perfect gDNA Blood Mini Kit provides a fast, effective method for purifying gDNA from saliva.

References

  1. Use of the Polymerase Chain Reaction (PCR) process to amplify nucleic acids is covered by U.S. Patent Numbers 4683105 and 4683202 owned by Roche Molecular and requires a license

'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:12/19/2014)... Mass. , Dec. 18, 2014  Decision Resources ... dental biomaterial market will grow moderately through 2023 ... procedures and growing awareness of dental biomaterials all spur ... markets such as China and ... will bring dental procedures within reach for a larger ...
(Date:12/17/2014)... NY (PRWEB) December 16, 2014 The ... changes since 2013, which is why IBISWorld updated its ... industry continues to benefit from an intensified focus on ... proposal for new emission standards for power plants and ... operators. According to IBISWorld Industry Analyst Sarah Kahn, “a ...
(Date:12/17/2014)... RIDGE, N.J. (PRWEB) December 17, 2014 ... (Euronext: IPN; ADR: IPSEY), today ... mg (referred to as Somatuline®) was approved by ... the treatment of gastroenteropancreatic neuroendocrine tumors (GEP-NETs) in ... locally advanced or metastatic disease to improve progression-free ...
(Date:12/17/2014)... Park, CA (PRWEB) December 17, 2014 ... announces today that it has entered into a ... Midland Company (ADM) to apply DNA2.0’s proprietary protein ... enzyme engineering process. , “We are extremely excited ... ProteinGPS engineering platform. This proprietary bioengineering technology ...
Breaking Biology Technology:Asia Pacific Dental Biomaterial Market Will Grow Strongly Through 2023 2Asia Pacific Dental Biomaterial Market Will Grow Strongly Through 2023 3Activated Carbon Manufacturing in the US Industry Market Research Report Has Been Updated from IBISWorld 2Activated Carbon Manufacturing in the US Industry Market Research Report Has Been Updated from IBISWorld 3Ipsen Announces the FDA Approval of Somatuline® Depot® (lanreotide) Injection for the Treatment of Gastroenteropancreatic Neuroendocrine Tumors 2Ipsen Announces the FDA Approval of Somatuline® Depot® (lanreotide) Injection for the Treatment of Gastroenteropancreatic Neuroendocrine Tumors 3Ipsen Announces the FDA Approval of Somatuline® Depot® (lanreotide) Injection for the Treatment of Gastroenteropancreatic Neuroendocrine Tumors 4Ipsen Announces the FDA Approval of Somatuline® Depot® (lanreotide) Injection for the Treatment of Gastroenteropancreatic Neuroendocrine Tumors 5Ipsen Announces the FDA Approval of Somatuline® Depot® (lanreotide) Injection for the Treatment of Gastroenteropancreatic Neuroendocrine Tumors 6Ipsen Announces the FDA Approval of Somatuline® Depot® (lanreotide) Injection for the Treatment of Gastroenteropancreatic Neuroendocrine Tumors 7Ipsen Announces the FDA Approval of Somatuline® Depot® (lanreotide) Injection for the Treatment of Gastroenteropancreatic Neuroendocrine Tumors 8ADM and DNA2.0 Enter Into Protein Engineering Technology Access and Service Agreement 2
... stock held by American Red Cross, in a ... in PRDT to 77%, - American Red Cross to ... MONTREAL and CAMBRIDGE, England, April 9 /PRNewswire-FirstCall/ -,ProMetic ... a Letter of Intent ("LOI") to acquire the American ...
... April 9 Francis S. Collins, M.D., ... Genome Project, has been named,recipient of the ... Center for Ethics and Excellence at Case ... ), The Inamori Ethics Prize honors ...
... Genetic Engineering,and Biotechnology News (GEN), http://www.genengnews.com ... on New Polymeric Drug Delivery Systems, on,Thursday, April ... is institute professor, chemical and biomedical engineering,Massachusetts Institute ... innovator in modern drug delivery," says John Sterling,Editor-in-Chief ...
Cached Biology Technology:ProMetic to obtain controlling stake in Pathogen Removal and Diagnostic Technologies Inc. 2ProMetic to obtain controlling stake in Pathogen Removal and Diagnostic Technologies Inc. 3ProMetic to obtain controlling stake in Pathogen Removal and Diagnostic Technologies Inc. 4ProMetic to obtain controlling stake in Pathogen Removal and Diagnostic Technologies Inc. 5ProMetic to obtain controlling stake in Pathogen Removal and Diagnostic Technologies Inc. 6ProMetic to obtain controlling stake in Pathogen Removal and Diagnostic Technologies Inc. 7Leading Geneticist Francis Collins Named First Recipient of the Inamori Ethics Prize at Case Western Reserve University 2Leading Geneticist Francis Collins Named First Recipient of the Inamori Ethics Prize at Case Western Reserve University 3Leading Geneticist Francis Collins Named First Recipient of the Inamori Ethics Prize at Case Western Reserve University 4Genetic Engineering and Biotechnology News (GEN) Presents Exclusive Podcast with Robert Langer, Ph.D. on New Polymeric Drug Delivery Systems 2
(Date:12/10/2014)... WINSTON-SALEM, N.C. , Dec. 9, 2014  Wake Forest ... medical education building for its School of Medicine. Funding ... a larger capital campaign that will be publicly launched ... will be located in the former 60 series R.J. ... Forest Innovation Quarter. Construction will begin immediately with plans ...
(Date:12/10/2014)... , December 9, 2014 ... BCARD Platform   ... meeting scheduling solutions for business-to-business (B2B) events, today ... leader in mobile near-field communication (NFC), Bluetooth low ...      (Logo: http://photos.prnewswire.com/prnh/20140612/691055) , Jifflenow will ...
(Date:12/4/2014)... Dec. 3, 2014  Crossmatch™, a leading provider ... its DigitalPersona ® Pro Enterprise software and ... deployed throughout First Bank branch locations in ... Carolina and Virginia. First Bank, a progressive ... Pines, North Carolina , selected the Crossmatch ...
Breaking Biology News(10 mins):Wake Forest Baptist to Build New Medical Education Facility In Wake Forest Innovation Quarter 2Wake Forest Baptist to Build New Medical Education Facility In Wake Forest Innovation Quarter 3Wake Forest Baptist to Build New Medical Education Facility In Wake Forest Innovation Quarter 4Jifflenow And ITN International Bring Cutting-Edge Badge Scanning Technology To B2B Events 2Jifflenow And ITN International Bring Cutting-Edge Badge Scanning Technology To B2B Events 3First Bank Partners with Crossmatch to Increase Log In Security 2First Bank Partners with Crossmatch to Increase Log In Security 3
... (Tuesday, April 1, 2008) Identifying genes that ... mouse used to be a monumental task. New ... effective for even the smallest laboratories. This months ... www.cshprotocols.org/TOCs/toc4_08.dtl ) highlights a method for screening the mouse ...
... be the cruelest month? , ... reminiscent of 1993 and 1994, back-to-back years of serious flooding, with ... damage, damaging and destroying more than 50,000 homes and killing at ... Parallels this year include abnormally high levels of precipitation ...
... Like sentinels at their posts, an array of buoys ... on duty in the Stellwagen Bank National Marine Sanctuary ... months, recording sounds from whales, fish, ships and other ... will analyze the biological sounds to help develop a ...
Cached Biology News:Cold Spring Harbor Protocols features methods to screen genomes and analyze evolution 2Geologist decries floodplain development 2Geologist decries floodplain development 3Researchers to develop ocean sanctuary 'noise budget' to evaluate potential impact on marine mammals 2Researchers to develop ocean sanctuary 'noise budget' to evaluate potential impact on marine mammals 3
Human TFPI Affinity Purified Polyclonal Ab Protein Family: Coagulation, Inflammation, Serine Protease Regulators...
Prostaglandin E2 Luminex Standard Product Lines: Unspecified...
Rabbit polyclonal to HMGB1 (rating: ****) ( Abpromise for all tested applications). entrezGeneID: 3146 SwissProtID: P09429...
Eppendorf tube holder, for Tube rack 175 x 12 mm, 100. Category: Chromatography Systems & Accessories, Systems....
Biology Products: