Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst
Eppendorf 5 Prime, Inc. Introduction

It is not convenient in all instances to have blood drawn for gDNA extraction. The Eppendorf Perfect gDNA Blood Mini Kit was used to extract gDNA from saliva with only slight modifications to the protocol. The unique patent-pending trapping technology results in gDNA that is less sheared than the gDNA isolated using the common chaotropic bind-wash-and-elute technology. The gDNA also performs well in PCR as the main downstream application as well as in other downstream applications.

Materials

  • Perfect gDNA Blood Mini Kit
Required but not supplied:
  • Ethanol 95100%; pipette tips; Microcentrifuge; Eppendorf Thermo-mixer, water bath, or heat block at 70C; 15 ml centrifuge tubes.
  • 1x PBS (sufficient amounts are supplied in the kit for blood work, but additional amounts may be needed for saliva applications)
Method

Isolation of gDNA:

  1. Place 1 ml of saliva into a 15 ml centrifuge tube.
  2. Add 4 ml of 1x PBS.
  3. Centrifuge at 1,800 x g for 5 minutes
  4. Decant the supernatant. Add 200 l 1x PBS and re-suspend pellet.
  5. Add 20 l of Proteinase K solution into a 1.5 ml microcentrifuge tube. Transfer the re-suspension from step 4 into this same tube.
  6. Add 350 l Solution G1 to the microcentrifuge tube and mix.
  7. Incubate in Thermomixer at 70C, 900 rpm, for 10 minutes. A water bath may be used with intermittent vortexing of samples if a Thermomixer is not available.
  8. Centrifuge the sample for 3 minutes at 12,00016,000 x g.
  9. Add 200 l Solution G2 to the tube. Vortex vigorously for 5 seconds. Place a spin column in a fresh microcentrifuge tube. Transfer the sample to the spin column assembly by pouring or pipetting. Incubate the sample at room temperature for 1 minute.
  10. Centrifuge the sample for 2 minutes at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  11. Add 600 l Diluted Wash Buffer to the spin column. Centrifuge for 1 minute at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  12. Add 400 l Diluted Wash Buffer to the spin column. Centrifuge for 3 minutes at 12,00016,000 x g. Carefully remove the spin column without splashing Wash Buffer onto the bottom of the column. Place the spin column into a fresh microcentrifuge tube.
  13. Observe the filter membrane to make sure it is dry before proceeding. If the filter looks shiny, spin an additional 1 to 2 minutes before placing the spin column into the fresh microcentrifuge tube.
  14. Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
Gel Electrophoresis for Yield:
Determination
5% of each sample was run on a 0.6% agarose gel in 1x TBE. The gel was stained in ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes final extension
15C hold

Results

Average yields obtained from 1 ml of saliva vary from person to person, but are consistent when triplicate samples are processed for one person (see Fig. 1). In general, the yields are slightly less than the yields of 200 l of whole blood, but extremely high yields have also been observed. All samples perform equally well in PCR with no inhibition of amplification (see Fig.2).

Fig.1: Yields of gDNA isolated from two individuals using both the Perfect gDNA kit and the leading competitors kit gDNA was extracted from the saliva of two individuals in triplicate. 5% of each sample was run on a 0.6% agarose gel.

Top: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: EppendorfIndividual #1 Lanes 57: EppendorfIndividual #2 Bottom: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: CompetitorIndividual #1 Lanes 57: CompetitorIndividual #2 Fig. 2: PCR of gDNA isolated from saliva

Lane 1: GeneRuler Ladder Mix (Fermentas) Lane 2: Eppendorf: 50 ng gDNA template, individual #1; 536 bp fragment Lane 3: Eppendorf: 50 ng gDNA template, individual #1; 2 kb fragment Lane 4: Eppendorf: 50 ng gDNA template, individual #2; 536 bp fragment Lane 5: Eppendorf: 50 ng gDNA template, individual #2; 2 kb fragment Lane 6: Qiagen: 50 ng of gDNA template, individual #1; 536 bp fragment Lane 7: Competitor, 50 ng gDNA template, individual #1; 2 kb fragment Lane 8: Competitor, 50 ng gDNA template, individual #2; 536 bp fragment Lane 9: Competitor, 50 ng gDNA template, individual #2; 2 kb fragment Lane 10: 536 bp fragment no template control Lane 11: 2 kb fragment no template control Discussion

The Perfect gDNA Blood Mini Kit provides a versatile method of isolating gDNA from a variety of starting materials including saliva. The isolated DNA analyzed by gel electrophoresis shows consistent yield within triplicate samples from one individual. The DNA also appears to be significantly higher in molecular weight when isolated using the Perfect gDNA Blood Mini Kit in comparison to the competitor. The DNA in saliva can come from many sources including non-human origins such as bacteria and food particles. Success in amplification of the human beta-globin gene shows the presence of sufficient amounts of human gDNA for use in this downstream application. Overall, the Perfect gDNA Blood Mini Kit provides a fast, effective method for purifying gDNA from saliva.

References

  1. Use of the Polymerase Chain Reaction (PCR) process to amplify nucleic acids is covered by U.S. Patent Numbers 4683105 and 4683202 owned by Roche Molecular and requires a license

'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:9/2/2014)... NEW PROVIDENCE, N.J. , Sept. 2, ... a corporate sponsor for MassBio,s 20th Annual Golf Classic, ... MassBioEd Foundation. The event will be held on September ... Plymouth, Massachusetts . The ... Massachusetts through educational programs, workforce development, ...
(Date:9/2/2014)... Press attending the Project LIBERTY Grand Opening have ... people and events in Emmetsburg on Sept. 3. The ... day. Additionally, we will do our best to help ... well as representatives from the local community. Any advance ... remember to RSVP to Matt Merritt (matt.merritt@poetdsm.com) to receive ...
(Date:9/2/2014)... Opertech Bio, Inc., a company that ... approach to sensory evaluation, today announced the issuance ... Patent and Trademark Office, encompassing high-throughput sensory discrimination ... taste evaluation technology called Microtiter Operant Gustometer or ... for rapid characterization of taste sensory properties,” said ...
(Date:9/2/2014)... 2, 2014 /PRNewswire/ - BIOREM Inc. (TSXV: BRM) ("Biorem" or "the ... orders consist of three large odour control systems for waste ... "These orders are consistent with the market resurgence in ... , President and CEO. "After a difficult period of restraint ... beginning to see sales growth. Our lower cost structure, technology ...
Breaking Biology Technology:Linde helps fund STEM education in Massachusetts 2Linde helps fund STEM education in Massachusetts 3Press agenda for Project LIBERTY Grand Opening 2Press agenda for Project LIBERTY Grand Opening 3Press agenda for Project LIBERTY Grand Opening 4Press agenda for Project LIBERTY Grand Opening 5Opertech Bio Receives U.S. Patent for High-Throughput Taste Evaluation Technology 2
...  Aug. 23, 2011 Reliv International , Inc. ... Science Center today announced a new joint research and ... the latest soy and plant biotechnology research. ... some of the nation,s leading biotech researchers to develop ...
... MedNet Solutions, a global life sciences technology solutions company ... that MedNet has once again been recognized by Inc. ... in the United States.  MedNet is greatly honored to be ... since, as noted by Inc . magazine, "this prestigious ...
... YORK, Aug. 23, 2011 Reportlinker.com ... report is available in its catalogue: ... Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & ... (2010-2015) http://www.reportlinker.com/p0595074/Biochips-Market-DNA-Microarrays-Lab-on-Chip-Protein-Microarrays-Tissue--Cell-Arrays-Trends--Global-Forecast-2010-2015.html#utm_source=prnewswire&utm_medium=pr&utm_campaign=Genomics ...
Cached Biology Technology:New Partnership Bolsters Reliv's Access to Plant Biotech Research 2New Partnership Bolsters Reliv's Access to Plant Biotech Research 3MedNet Solutions Achieves the Inc. 5000 List Five Years in a Row 2Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 2Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 3Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 4Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 5Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 6Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 7Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 8Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 9Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 10Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 11Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 12Biochips Market (DNA Microarrays, Lab-on-Chip, Protein Microarrays, Tissue & Cell Arrays) Trends & Global Forecast (2010-2015) 13
(Date:9/2/2014)... published in the September issue of The ... novel strategy to diagnose the leading cause of ... damage has occurred. This advance involves quantifying the ... endothelium of retinal vessels. Using new probes developed ... early molecular development of diabetic retinopathy. , "My ...
(Date:9/2/2014)... perching birds, that migrate by night tend to fly ... reach their destinations. This seasonal difference in flight speed ... migratory flights, says researcher Cecilia Nilsson of Lund University ... Sociobiology . , Nilsson, in a group led ... measure over three years the speed by which birds ...
(Date:9/2/2014)... A study published in the September 2014 issue ... of Child and Adolescent Psychiatry found that ... had an increased risk of developing diabetes if ... from the nationwide Danish registers, a group of ... Aalborg University Hospital, Denmark, studied 48,299children and adolescents ...
Breaking Biology News(10 mins):Molecular probes permit doctors to detect diabetic retinopathy before vision fails 2Migrating birds sprint in spring, but take things easy in autumn 2Risk of diabetes in children and adolescents exposed to antipsychotics 2
... A new study led by York University researchers finds ... marked decrease in performance as a result of their blood ... of Pediatrics, reports that participants, athletic prowess was sapped by ... abilities also declined as a result. "Physical activity ...
... that optical microscopy can,t be used to "see" something ... is wont, clever science has once again overturned conventional ... of the Lawrence Berkeley National Laboratory (Berkeley Lab) Steven ... the use of optical microscopy to ,image objects or ...
... Prostate cancer is the second leading cause of ... cases diagnosed in the US in 2009 (Jemal 2009). ... risk factors for inflammation and prostate diseases including benign ... Sanjay Gupta, MS, PhD, Carter Kissell associate professor & ...
Cached Biology News:Diabetes shouldn't deter young athletes: York U study 2Diabetes shouldn't deter young athletes: York U study 3Correcting a trick of the light brings molecules into view 2Correcting a trick of the light brings molecules into view 3Correcting a trick of the light brings molecules into view 4Mechanism for link between high fat diet and risk of prostate cancer and disorders unveiled 2
UGT1A6 (D-20)...
... the Lone Wolf valve has the highest ... valve available on the market. This VSO ... performance, and ensures maximum accuracy., Achieves ... control and patient comfort. , Maintains ideal ...
Normal Hamster Serum...
...
Biology Products: