Navigation Links
Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini ,,, Kit

Jennifer Halcome, Laura Pollock, and Michele Nelson Hurst
Eppendorf 5 Prime, Inc. Introduction

It is not convenient in all instances to have blood drawn for gDNA extraction. The Eppendorf Perfect gDNA Blood Mini Kit was used to extract gDNA from saliva with only slight modifications to the protocol. The unique patent-pending trapping technology results in gDNA that is less sheared than the gDNA isolated using the common chaotropic bind-wash-and-elute technology. The gDNA also performs well in PCR as the main downstream application as well as in other downstream applications.

Materials

  • Perfect gDNA Blood Mini Kit
Required but not supplied:
  • Ethanol 95100%; pipette tips; Microcentrifuge; Eppendorf Thermo-mixer, water bath, or heat block at 70C; 15 ml centrifuge tubes.
  • 1x PBS (sufficient amounts are supplied in the kit for blood work, but additional amounts may be needed for saliva applications)
Method

Isolation of gDNA:

  1. Place 1 ml of saliva into a 15 ml centrifuge tube.
  2. Add 4 ml of 1x PBS.
  3. Centrifuge at 1,800 x g for 5 minutes
  4. Decant the supernatant. Add 200 l 1x PBS and re-suspend pellet.
  5. Add 20 l of Proteinase K solution into a 1.5 ml microcentrifuge tube. Transfer the re-suspension from step 4 into this same tube.
  6. Add 350 l Solution G1 to the microcentrifuge tube and mix.
  7. Incubate in Thermomixer at 70C, 900 rpm, for 10 minutes. A water bath may be used with intermittent vortexing of samples if a Thermomixer is not available.
  8. Centrifuge the sample for 3 minutes at 12,00016,000 x g.
  9. Add 200 l Solution G2 to the tube. Vortex vigorously for 5 seconds. Place a spin column in a fresh microcentrifuge tube. Transfer the sample to the spin column assembly by pouring or pipetting. Incubate the sample at room temperature for 1 minute.
  10. Centrifuge the sample for 2 minutes at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  11. Add 600 l Diluted Wash Buffer to the spin column. Centrifuge for 1 minute at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  12. Add 400 l Diluted Wash Buffer to the spin column. Centrifuge for 3 minutes at 12,00016,000 x g. Carefully remove the spin column without splashing Wash Buffer onto the bottom of the column. Place the spin column into a fresh microcentrifuge tube.
  13. Observe the filter membrane to make sure it is dry before proceeding. If the filter looks shiny, spin an additional 1 to 2 minutes before placing the spin column into the fresh microcentrifuge tube.
  14. Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
Gel Electrophoresis for Yield:
Determination
5% of each sample was run on a 0.6% agarose gel in 1x TBE. The gel was stained in ethidium bromide. Intensity as well as size of the band was observed.

PCR:
gDNA was isolated from the saliva of three individuals (see protocol). From each individual sample, 50 ng of purified gDNA was used as a template in 30 l PCR reactions. Two different sized targets of the human beta-globin gene were amplified. The following Eppendorf PCR reagents were used with the concentrations or amounts specified in parenthesis:

  • Taq DNA Polymerase (0.05 Units/l)
  • 10x Taq DNA Polymerase Buffer (1x)
  • 25 mM MgCl2 (0.5 mM)
  • dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.

536 bp target:
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

2 kb fragment:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes final extension
15C hold

Results

Average yields obtained from 1 ml of saliva vary from person to person, but are consistent when triplicate samples are processed for one person (see Fig. 1). In general, the yields are slightly less than the yields of 200 l of whole blood, but extremely high yields have also been observed. All samples perform equally well in PCR with no inhibition of amplification (see Fig.2).

Fig.1: Yields of gDNA isolated from two individuals using both the Perfect gDNA kit and the leading competitors kit gDNA was extracted from the saliva of two individuals in triplicate. 5% of each sample was run on a 0.6% agarose gel.

Top: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: EppendorfIndividual #1 Lanes 57: EppendorfIndividual #2 Bottom: Lane 1: Lambda Hind III Marker (NEB) Lanes 24: CompetitorIndividual #1 Lanes 57: CompetitorIndividual #2 Fig. 2: PCR of gDNA isolated from saliva

Lane 1: GeneRuler Ladder Mix (Fermentas) Lane 2: Eppendorf: 50 ng gDNA template, individual #1; 536 bp fragment Lane 3: Eppendorf: 50 ng gDNA template, individual #1; 2 kb fragment Lane 4: Eppendorf: 50 ng gDNA template, individual #2; 536 bp fragment Lane 5: Eppendorf: 50 ng gDNA template, individual #2; 2 kb fragment Lane 6: Qiagen: 50 ng of gDNA template, individual #1; 536 bp fragment Lane 7: Competitor, 50 ng gDNA template, individual #1; 2 kb fragment Lane 8: Competitor, 50 ng gDNA template, individual #2; 536 bp fragment Lane 9: Competitor, 50 ng gDNA template, individual #2; 2 kb fragment Lane 10: 536 bp fragment no template control Lane 11: 2 kb fragment no template control Discussion

The Perfect gDNA Blood Mini Kit provides a versatile method of isolating gDNA from a variety of starting materials including saliva. The isolated DNA analyzed by gel electrophoresis shows consistent yield within triplicate samples from one individual. The DNA also appears to be significantly higher in molecular weight when isolated using the Perfect gDNA Blood Mini Kit in comparison to the competitor. The DNA in saliva can come from many sources including non-human origins such as bacteria and food particles. Success in amplification of the human beta-globin gene shows the presence of sufficient amounts of human gDNA for use in this downstream application. Overall, the Perfect gDNA Blood Mini Kit provides a fast, effective method for purifying gDNA from saliva.

References

  1. Use of the Polymerase Chain Reaction (PCR) process to amplify nucleic acids is covered by U.S. Patent Numbers 4683105 and 4683202 owned by Roche Molecular and requires a license

'"/>

Source:


Page: All 1 2 3 4 5 6

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. High-Throughput Isolation of Total RNA
3. Simple Isolation of RNA from Tissue and Cultured Cells
4. Fast Isolation of Total RNA from Small Numbers of Cells
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Isolation of Microorganisms
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Basic Plasmid DNA Isolation Protocol
10. Protocol for RNA Isolation Using TRIzol Reagent with Phase Lock Gel-Heavy
11. RNA-free Plasmid DNA Isolation Protocol
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Isolation Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit

(Date:9/22/2014)... September 22, 2014 Pearl's Premium Ultra ... in drought tolerant grass seed this week with the ... The announcement coincides with the fact that it is ... as many believe. , As of the date ... favorable reviews by industry experts and the media including: ...
(Date:9/22/2014)... SANTA CLARA, Calif. , Sept. 22, 2014 ... ), the leading source of health information, today released ... that provide novel insights regarding physician and patient perspectives ...  Dr. Eric Topol , a leading authority in ... as both Editor-in-Chief of Medscape and Chief Academic Officer ...
(Date:9/22/2014)... DUBLIN , September 22, 2014 ... has announced the addition of the "Global ... offering.      (Logo: http://photos.prnewswire.com/prnh/20130307/600769) ... are added to a system to detect and ... Reagents are generally used in laboratories to prepare, ...
(Date:9/22/2014)... researchers at the USC Viterbi School of Engineering, ... microfluidic system quickly and cheaply by simply snapping ... systems are used in many fields including engineering, ... of fluids for use in applications such as ... testing, and synthetic chemistry. Traditionally, microfluidic devices are ...
Breaking Biology Technology:Pearl's Premium Ultra Low Maintenance Lawn Seed Announces A Major Breakthrough In Drought Tolerant Grass Seed 2WebMD/Medscape Digital Technology Survey Reveals Unique Insights Into How Patients and Physicians Perceive the Role, Potential and Risks Associated with Digital Health Technologies 2WebMD/Medscape Digital Technology Survey Reveals Unique Insights Into How Patients and Physicians Perceive the Role, Potential and Risks Associated with Digital Health Technologies 3WebMD/Medscape Digital Technology Survey Reveals Unique Insights Into How Patients and Physicians Perceive the Role, Potential and Risks Associated with Digital Health Technologies 4Global Biotechnology Reagents Market 2014-2018: Key Vendors are Agilent, BD Biosciences, Bio-Rad, F. Hoffmann-La Roche, Sigma-Aldrich and Thermo Fisher 2Global Biotechnology Reagents Market 2014-2018: Key Vendors are Agilent, BD Biosciences, Bio-Rad, F. Hoffmann-La Roche, Sigma-Aldrich and Thermo Fisher 3Lego-like modular components make building 3-D 'labs-on-a-chip' a snap 2Lego-like modular components make building 3-D 'labs-on-a-chip' a snap 3Lego-like modular components make building 3-D 'labs-on-a-chip' a snap 4Lego-like modular components make building 3-D 'labs-on-a-chip' a snap 5
... Inc. (PDL, the Company) (NASDAQ: PDLI ) today ... other conditions, $135 million aggregate principal amount of new convertible ... statement filed with the U.S. Securities and Exchange Commission (SEC) ... the underwriters a 13-day overallotment option to purchase up to ...
... SPRING, Md., May 9, 2011 The U.S. Food and ... public relating to the development of a user fee ...   (Logo: http://photos.prnewswire.com/prnh/20090824/FDALOGO ) ... as a microorganism, plant, or animal cell, while small ...
... 2011 Accuray Incorporated (Nasdaq: ... radiosurgery, announced today that the U.S. Securities and Exchange ... Statement relating to the previously announced acquisition of TomoTherapy ... registration statement will first be mailed to TomoTherapy shareholders ...
Cached Biology Technology:PDL BioPharma, Inc. Announces Proposed $135 Million Public Offering of New Convertible Senior Notes Due 2015 2PDL BioPharma, Inc. Announces Proposed $135 Million Public Offering of New Convertible Senior Notes Due 2015 3PDL BioPharma, Inc. Announces Proposed $135 Million Public Offering of New Convertible Senior Notes Due 2015 4PDL BioPharma, Inc. Announces Proposed $135 Million Public Offering of New Convertible Senior Notes Due 2015 5FDA Requests Input on Development of User Fee Program for Biosimilar and Interchangeable Biological Products 2SEC Declares Accuray Form S-4 Registration Statement Effective in Proposed Acquisition of TomoTherapy 2SEC Declares Accuray Form S-4 Registration Statement Effective in Proposed Acquisition of TomoTherapy 3SEC Declares Accuray Form S-4 Registration Statement Effective in Proposed Acquisition of TomoTherapy 4
(Date:9/22/2014)... fishes that manufacture their own "antifreeze" proteins to ... an unfortunate side effect, researchers report: The protein-bound ... melting even when temperatures warm. , The ... the National Academy of Sciences . , "We ... of the evolution of antifreeze proteins in Antarctic ...
(Date:9/22/2014)... 2014)The Brain & Behavior Research Foundation ... Young Investigator Grants valued at more than ... most promising young scientists. Recipients of the ... will seek to identify causes, improve treatments ... that affect one in four people, including ...
(Date:9/22/2014)... more useful in homes, if they could locate people, ... with cameras and lasers, which have difficulty reliably recognizing ... clutter. A complementary way robots can "sense" what is ... frequency radio-frequency identification (UHF RFID) tags. Inexpensive self-adhesive tags ... to search a room for the correct tag,s signal, ...
Breaking Biology News(10 mins):Study: Antifreeze proteins in Antarctic fishes prevent freezingand melting 2Study: Antifreeze proteins in Antarctic fishes prevent freezingand melting 3Brain & Behavior Research Foundation awards 200 NARSAD Young Investigator grants 2New RFID technology helps robots find household objects 2New RFID technology helps robots find household objects 3
... Karen Burg and her colleagues in the Institute for ... means of studying the complex behavior of cancer cells ... way doctors treat the disease. With support from ... the researchers are building scaffolds that mimic the three-dimensional ...
... diseases is a hot area of scientific research, primarily ... the context of atherosclerotic disease. Scientists have engineered a ... about the conditions under which nanoparticles accumulate in the ... of myocardial infarction and stroke. In the research, ...
... blood platelets and bone marrow cells to deliver potentially ... genetic disorder Hurler syndrome an often fatal condition ... Scientists from Cincinnati Children,s Hospital Medical Center and the ... their unique strategy for treating the disease the week ...
Cached Biology News:In vitro innovation: Testing nanomedicine with blood cells on a microchip 2In vitro innovation: Testing nanomedicine with blood cells on a microchip 3Mouse study shows gene therapy may be possible cure for Hurler syndrome 2
... complete kit contains enough separation ... a total of 5 x ... includes the StemSep red magnet ... and buffers for the specific ...
... fast and specific detection of chromosomal sequences ... hybridisation time ( Works ... Multiplex capability Available with different tags ... available with different labels. Related Content: ...
... dehydrogenase catalyzes a reversible reaction between ... with NAD as a coenzyme. GPDH ... progenitor cells into adipocytes and, thus, ... been used as an index for ...
...
Biology Products: