Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

.



siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.



Conclusion

The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.


'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:1/22/2015)... , a precision medicine software company that has developed a ... genomic, imaging and other biomedical data in research and clinical ... CEO of Aspera, an IBM Company, to its board as ... "We are pleased to welcome Michelle to ...
(Date:12/25/2014)... December 25, 2014 The report “Service ... Product Type & Provider Type - Global Advancements, Worldwide ... with an in-depth analysis and forecasting of revenues. ... through 221 pages and in-depth TOC on “Service Quality ...
(Date:12/24/2014)... , Dec. 24, 2014 PlasmaTech Biopharmaceuticals, Inc. (NASDAQ: ... areas, announced the closing of an underwritten public offering of ... to an aggregate 3,500,000 shares of common stock, at an ... The warrants have a per share exercise price of $5.00, ...
(Date:12/24/2014)... Solutions , Inc. (NASDAQ: BLFS ), a leading ... storage and cryopreservation freeze media and ... or the "Company"), today announced that it will hold its ... "Annual Meeting"). Because the expected date for the ...
Breaking Biology Technology:GenoSpace Expands Board with Appointment of Michelle Munson 2Service Quality Management Market worth $2.1 Billion & Telco Customer Experience Management Market worth $2.3 Billion by 2019 – New Report by MarketsandMarkets 2Service Quality Management Market worth $2.1 Billion & Telco Customer Experience Management Market worth $2.3 Billion by 2019 – New Report by MarketsandMarkets 3Service Quality Management Market worth $2.1 Billion & Telco Customer Experience Management Market worth $2.3 Billion by 2019 – New Report by MarketsandMarkets 4PlasmaTech Biopharmaceuticals, Inc. Announces Closing of Public Offering 2PlasmaTech Biopharmaceuticals, Inc. Announces Closing of Public Offering 3BioLife Solutions Sets Date for Annual Meeting of Stockholders 2
... global climate change and population growth call for sweeping changes ... a group of prestigious scientists, including an expert in plant ... team, led by Nina Federoff, science and technology adviser to ... "critical need to get beyond popular biases against the use ...
... , -- Leading ... to Offer Innovative Resource for all Ages and Stages of the ... For the more than 1.5 million Americans living with ... is far less frequent on key topics that impact the quality ...
... ... will learn how Microsoft® products, such as SharePoint and Office 2007, can be configured to ... to provide a cost-effective FDA regulated Quality System. , ... Bedford, MA (PRWEB) February 11, 2010 -- Business Intelligence Solutions ...
Cached Biology Technology:Dramatic changes in agriculture needed as world warms and grows, researchers say 2Davis Phinney Foundation Launches 'Every Victory Counts' Program to Inform and Empower People to Live Well With Parkinson's 2Davis Phinney Foundation Launches 'Every Victory Counts' Program to Inform and Empower People to Live Well With Parkinson's 3Davis Phinney Foundation Launches 'Every Victory Counts' Program to Inform and Empower People to Live Well With Parkinson's 4Davis Phinney Foundation Launches 'Every Victory Counts' Program to Inform and Empower People to Live Well With Parkinson's 5Lunch and Learn Workshop for New Jersey-based FDA-Regulated Companies 2
(Date:12/22/2014)... Holiday Season may be the brightest ever for the ... long anticipated floodgates for consumer biometrics may finally be ... tablets, and wearable mobile devices that incorporate biometrics will ... nearly 4.8 billion biometric devices by 2020.   ...
(Date:12/19/2014)... Calif. , Dec. 18, 2014  23andMe, Inc., the leading ... that pinpoints fine-scale differences in genetic ancestry of individuals from ... Since immigrants first arrived more than four hundred years ago, ... a meeting place for peoples from different continents. This study ...
(Date:12/17/2014)... 2014 The Defense Logistics Agency is insourcing its ... counterfeit microcircuits from entering into its supply chain. ... anti-counterfeit initiative dubbed DNA marking. The capability will validate ... throughout the supply chain. The new quality control measures ...
Breaking Biology News(10 mins):First Season of Holiday Shopping with Mobile Biometric Payments Wraps Up With a Present for Biometrics Industry: A Rosy Forecast for More Than 2 Billion Users of 4.8 Billion Mobile Biometric Devices by 2020 223andMe Study Sketches Genetic Portrait of the United States 223andMe Study Sketches Genetic Portrait of the United States 323andMe Study Sketches Genetic Portrait of the United States 4Defense Logistics Agency Launches DNA Marking Capability to Strengthen Microcircuit Supply Chain 2Defense Logistics Agency Launches DNA Marking Capability to Strengthen Microcircuit Supply Chain 3
... The National Science Foundation has awarded Iowa State ... million grant to establish the NSF Engineering Research ... The award is part of the National ... Program. The third-generation Engineering Research Centers are designed ...
... utilize small, short-lived animals (insects, worms, mice) under ... parasites, superabundant food in the laboratory. Oddly ... such animals in their harsh, stressful natural environments. ... actually age much more slowly in captive luxury ...
... Bats, ability to echolocate may have evolved more than once, ... of London scientists. Species of bat with the ability ... tree of life - some are more related to their ... of whether echolocation in bats has evolved more than once, ...
Cached Biology News:Iowa State wins $18.5M grant to create NSF Center for Biorenewable Chemicals 2Iowa State wins $18.5M grant to create NSF Center for Biorenewable Chemicals 3Iowa State wins $18.5M grant to create NSF Center for Biorenewable Chemicals 4Old before their time? Aging in flies under natural vs. laboratory conditions 2Molecular evolution is echoed in bat ears 2
Plasmid expressing the LacZ reporter gene....
Plasmid expressing Zeocin resistance gene....
... These 2800mL wide mouth PYREX Fernbach-style ... the center of the flask bottom to ... These triple baffled flasks have a Delong-style ... stainless steel closures. For plastic closures see ...
... The kit provides a simple and efficient ... normal c lture using annexin V magnetic ... phospholipid binding protein with high affinity for ... provides a simple and efficient means for ...
Biology Products: