Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments


siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.


The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.



Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:7/31/2015)... ... July 31, 2015 , ... ... and quantification of partially hydrolyzed gluten in foods, has been accepted by AOAC ... method “Partially Hydrolyzed Gluten in Fermented Cereal-Based Products by R5 Competitive ELISA,” based ...
(Date:7/30/2015)... (PRWEB) , ... July 30, 2015 , ... ... has appointed Francois Vieillard as Sales & Marketing Director. , With more ... Vieillard will be responsible for reinforcing Tronics’ business development activities worldwide. He brings ...
(Date:7/30/2015)... Kan. , July 30, 2015   ... a pet therapeutics company focused on the licensing, ... companion animals, today announced that its strategic partner ... a dose confirmation study of AT-016, an adipose-derived ... for the treatment of osteoarthritis pain in dogs. ...
(Date:7/30/2015)... ST. LOUIS, July 30, 2015 ... period in 2014) , Reported sales were $697 ... of 2014.  Sales grew organically by 8%, and changes ... Recent acquisitions increased sales by 1%. , By ... 8% in Applied and 11% in SAFC Commercial. ...
Breaking Biology Technology:RIDASCREEN® Competitve Gliadin Receives AOAC Official First Action Status 2Tronics appoints Francois Vieillard as Sales and Marketing Director 2Aratana Therapeutics Announces Positive Pilot Field Study for AT-016 2Aratana Therapeutics Announces Positive Pilot Field Study for AT-016 3Aratana Therapeutics Announces Positive Pilot Field Study for AT-016 4Aratana Therapeutics Announces Positive Pilot Field Study for AT-016 5Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 2Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 3Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 4Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 5Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 6Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 7Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 8Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 9Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 10Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 11Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 12Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 13Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 14Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 15Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 16Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 17Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 18Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 19Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 20
... TorreyPines Therapeutics, Inc.,(Nasdaq: TPTX ) today announced that ... the U.S. Food and Drug Administration (FDA) on,September 29, ... data, the FDA agreed,that TorreyPines may initiate a Phase ... confirmed that the required thorough QT/QTc study,for tezampanel can ...
... 1 SpectraScience, Inc. (OTC,Bulletin Board: SCIE), a ... has shipped its non-invasive WavSTAT(R) Optical Biopsy,System to ... clinical,value of the Optical Biopsy System as an ... or cancer in the esophagus.,This marks the final ...
... Oct. 1 SyntheMed, Inc. (OTC,Bulletin Board: SYMD), ... of anti-adhesion products and other surgical,implants, announced today ... a,private placement in which it received $4.0 million ... issuance to investors of ten million units,at $0.40 ...
Cached Biology Technology:TorreyPines Therapeutics Reports Successful End-of-Phase II Meeting With FDA for Tezampanel 2TorreyPines Therapeutics Reports Successful End-of-Phase II Meeting With FDA for Tezampanel 3TorreyPines Therapeutics Reports Successful End-of-Phase II Meeting With FDA for Tezampanel 4University of Southern California Receives Cancer Diagnosis System for Detecting Esophageal Dysplasia 2University of Southern California Receives Cancer Diagnosis System for Detecting Esophageal Dysplasia 3University of Southern California Receives Cancer Diagnosis System for Detecting Esophageal Dysplasia 4SyntheMed Completes $4.0 Million Equity Placement 2
(Date:7/31/2015)... 2015 La 10e Conférence internationale sur ... par le BGI du 22 au 25 octobre ... Chine. La conférence célèbre son 10e ... l,ICG est devenue l,une des réunions annuelles mondiales ... et c,est aussi la plus dynamique, la plus ...
(Date:7/30/2015)... July 30, 2015 Cellecta, Inc., a ... function analysis and biomarker discovery, announced the release ... Library targeting all human protein coding genes. CRISPR ... out" a gene,s function. Cellecta,s new Human Whole ... screening tool so that researchers can investigate in ...
(Date:7/21/2015)... Today, ZTE announced its Android smartphone Axon, featuring FPC,s touch ... 2015 that relate to sales of FPC1025 for this smartphone model ... for 2015. Jörgen Lantto, CEO of FPC, comments: " ... China and we are proud that ZTE ... Axon , its first smartphone ...
Breaking Biology News(10 mins):La 10e International Conference on Genomics (ICG-10) doit s'ouvrir en octobre 2La 10e International Conference on Genomics (ICG-10) doit s'ouvrir en octobre 3CELLECTA, INC. Announces Launch of Human Whole Genome CRISPR Knockout Library 2FPC's Touch Fingerprint Sensor FPC1025 in ZTE's Smartphone Axon 2
... Up-to-date marine data enables students to carry out ... how scientific knowledge is created and developed, according to ... from the University of Gothenburg followed upper-secondary students from ... study was part of the research project I2I, Inquiry ...
... Rochelle, May 14, 2012 Disruptive Science and Technology ... Mary Ann Liebert, Inc., publishers, has officially released ... PhD, Highmark Distinguished Career Professor, Carnegie Mellon University, ... thorough syntheses and analyses focused on front-line concepts ...
... ST. LOUIS, MO, May 14, 2012Arranging DNA fragments into a ... compared to assembling a puzzle except you don,t have the ... to be. Sometimes clues from other publicly-available DNA sequences of ... but its usefulness depends on how closely related any two ...
Cached Biology News:Real science in virtual school labs 2New journal on disruptive science and technology launched by Mary Ann Liebert Inc. publishers 2Researchers look to relatives for clues in quest to develop sources of bioenergy 2Researchers look to relatives for clues in quest to develop sources of bioenergy 3
... 301 Power Supply, 1. 300 V, ... or constant current modes.Single-unit increments in ... reproducibility.Suitable for submarine, mini vertical, and ... as semidry and mini tank blotting ...
... Supply, 1. 1000 V, 400 mA, ... and constant power modes.Single-unit increments in ... reproducibility.Stores and recalls three protocols.Outstanding choice ... Multiphor II or GenePhor systems. ...
Mouse TrkC Affinity Purified Polyclonal Ab...
Immunogen: Full length M32 fusion protein. Storage: -20 C, Avoid Freeze/Thaw Cycles...
Biology Products: