Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

.



siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.



Conclusion

The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.


'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:7/23/2014)... Ill. , July 23, 2014 /PRNewswire/ ... (SNA™) constructs as gene regulatory and immunotherapeutic ... has joined AuraSense Therapeutics, executive leadership ... 11. Prior to joining AuraSense ... and Chief Financial Officer of Cellular Dynamics ...
(Date:7/23/2014)... 23 de julio de 2014 ADB ... Compañía) ha anunciado hoy una asociación con Austen ... (ABIA o el Instituto), para el propósito de ... de terapia de señal bioeléctrica (el E-QURE BST ... Instituto, que tiene una importante experiencia en cicatrización ...
(Date:7/23/2014)... 2014 /PRNewswire/ - BioAmber Inc. (NYSE: ... chemicals, today announced that the underwriters of its common ... purchase an additional 420,000 shares of common stock ... share, less underwriting discounts and commissions, in connection ... 2,800,000 shares of common stock, bringing the expected ...
(Date:7/23/2014)... PARK, Calif. , July 23, 2014  Sofinnova ... investment firm, today announced the closing of Sofinnova Venture ... million and in excess of the initial fund target ... helping entrepreneurs build successful biotechnology companies. Consistent with recent ... with promising later stage clinical programs, along with select ...
Breaking Biology Technology:AuraSense Therapeutics Appoints Biotechnology Veteran David S. Snyder as Chief Financial Officer 2ADB International Group Inc. anuncia una asociación con Austen BioInnovation Institute 2ADB International Group Inc. anuncia una asociación con Austen BioInnovation Institute 3ADB International Group Inc. anuncia una asociación con Austen BioInnovation Institute 4ADB International Group Inc. anuncia una asociación con Austen BioInnovation Institute 5ADB International Group Inc. anuncia una asociación con Austen BioInnovation Institute 6BioAmber announces exercise in full of underwriters' option in connection with previously priced follow-on offering 2BioAmber announces exercise in full of underwriters' option in connection with previously priced follow-on offering 3Sofinnova Raises $500 Million Biotech Venture Fund 2
... $68.6 Million, Increase of 32% Over Second Quarter 2007, - EPS of ... - Earnings Before Non-Cash Charges of $1.36 per Basic Share, Increase of ... 56% Over Second ... UTHR ) today announced its results of,operations for the quarter ended ...
... California, Berkeley, have devised a way to squeeze light ... doors to new technology in the fields of optical ... succeeded previously in passing light through gaps 200 nanometers ... a human hair. A group of UC Berkeley researchers ...
... Inc.,(Nasdaq: ITMN ) today announced that Daniel G. ... the BMO Capital Markets 2008 Focus,on Healthcare Conference in ... EDT., To access a live audio webcast of ... to the investor relations page of InterMune,s,corporate website at ...
Cached Biology Technology:United Therapeutics Reports Second Quarter 2008 Financial Results 2United Therapeutics Reports Second Quarter 2008 Financial Results 3United Therapeutics Reports Second Quarter 2008 Financial Results 4United Therapeutics Reports Second Quarter 2008 Financial Results 5United Therapeutics Reports Second Quarter 2008 Financial Results 6New technique to compress light could open doors for optical communications 2New technique to compress light could open doors for optical communications 3
(Date:7/23/2014)... In Aesop,s fable about the crow and the pitcher, a ... he tries to drink from it, he finds the water ... over the pitcher, the bird drops pebbles into it ... enough for him to drink his fill. , Highlighting the ... often be more effective than brute force. It also characterizes ...
(Date:7/23/2014)... satellite over a 15-year period off the U.S. West ... in specific locations each year, according to a study ... PLOS ONE by Ladd Irvine from Oregon State ... mitigate human threats to the whale population. , The ... since the establishment of protections in the mid-1960s. Scientists ...
(Date:7/23/2014)... Spinach gave Popeye super strength, but it also ... group of scientists: the ability to convert sunlight into ... are part of an international group using spinach to ... which plants convert the sun,s energy into carbohydrates used ... are part of the most efficient system ever built, ...
Breaking Biology News(10 mins):Smarter than a first-grader? 2Smarter than a first-grader? 3Smarter than a first-grader? 4Blue whales' dangerous feeding grounds 2Spinach could lead to alternative energy more powerful than Popeye 2
... study of men and post-menopausal women primarily over 60 ... with greater bone mineral density (BMD). Researchers at the ... (USDA HNRCA) at Tufts University found associations were strongest ... lower in men drinking more than two servings of ...
... -- Ben-Gurion University of the Negev (BGU) researchers have ... reversible panes that will save energy all year round ... Window, features the only glazing system that permits effective ... temperature near a window and reduces unwanted solar gains ...
... of the American Dietetic Association features research studies ... of the life cycle, from children and adolescents to ... Consumption among U.S. Children , Children and adolescents ... to researchers at Ohio State University. The researchers ...
Cached Biology News:Moderate alcohol intake associated with bone protection 2Moderate alcohol intake associated with bone protection 3Ben-Gurion University of the Negev researchers develop new reversible, green window technology 2News from the March 2009 Journal of the American Dietetic Association 2
Lentigen's manufacturing platform is sufficiently versatile for use in the manufacture of any HIV-based Lentiviral vector. Lentigen will manufacture your LV of choice to the highest possible titer a...
Bethyl Laboratories packages antibodies, conjugates and calibrators to provide quantitative ELISA kits. Each kit contains the following components, sufficient for 1000 single well assays....
Bethyl Laboratories packages antibodies, conjugates and calibrators to provide quantitative ELISA kits. Each kit contains the following components, sufficient for 1000 single well assays....
Bethyl Laboratories packages antibodies, conjugates and calibrators to provide quantitative ELISA kits. Each kit contains the following components, sufficient for 1000 single well assays....
Biology Products: