Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

.



siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.



Conclusion

The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.


'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:1/14/2014)... Doylestown, PA (PRWEB) January 14, 2014 Date: ... p.m. , Location: Warrington Country Club, 1360 Almshouse Road, Warrington, ... only national nonprofit organization solely dedicated to finding a cure ... those affected worldwide, will host its annual Crystal Ball on ...
(Date:1/14/2014)... Calif. , Jan. 14, 2014 As pet owners drew ... doubt many of them wrote: "Take better care of my furry ... even designer clothes and top-brand carrying cases to take the little ... parents might also feel compelled to buy some pricey toys at ...
(Date:1/14/2014)... iLab Solutions, the leader in core facility management ... Product Strategy. In this role, Michelle will work with current ... in the development of iLab products. Her main goal will ... to the scientific community by offering the most advanced, user-friendly, ...
(Date:1/14/2014)... 14, 2014   Kinaxis ®, provider of RapidResponse ®, ... and operations planning ( S&OP ) service, is proud to ... which will be held at the Hilton San Diego Bayfront, ... customer Elisabeth Kaszas , Director of Supply Chain at ...
Breaking Biology Technology:Hepatitis B Foundation to Host Annual Crystal Ball Gala 2New Year's Resolution: Give Pets the Gift of Top-Notch Health Care 2iLab Solutions Announces Michelle Detwiler as the New Director of Product Strategy 2Event Alert: Kinaxis Customer to Present at the Biomanufacturing Summit "Supply Chain: Improving Network Effectiveness" 2
... Md. , July 6 Novavax, Inc. (Nasdaq: ... Glenn , M.D., as the company,s Chief Scientific Officer who ... Chief Executive Officer of Novavax.  Previously, Dr. Glenn was Chief ... associate in international health at Johns Hopkins University,s School ...
... ,, BEIJING , ... Inc.,(Nasdaq: YONG ), ("Yongye" or the "Company") ... plant and animal nutrient products in, China , ... the annual,production capacity of its existing plant nutrient ...
... its discovery, graphenean unusual and versatile substance composed of ... excitement in the scientific community. Now, Nongjian(NJ) Tao, a ... has hit on a new way of making graphene, ... high-speed electronic devices. Along with collaborators from ...
Cached Biology Technology:Novavax Announces Appointment of Dr. Gregory Glenn as Chief Scientific Officer 2Novavax Announces Appointment of Dr. Gregory Glenn as Chief Scientific Officer 3Novavax Announces Appointment of Dr. Gregory Glenn as Chief Scientific Officer 4Yongye International Expands Its Existing Production Capacity by 50% and Provides Updates on Customer List Acquisition 2Yongye International Expands Its Existing Production Capacity by 50% and Provides Updates on Customer List Acquisition 3Yongye International Expands Its Existing Production Capacity by 50% and Provides Updates on Customer List Acquisition 4Graphene 2.0: A new approach to making a unique material 2Graphene 2.0: A new approach to making a unique material 3
(Date:4/17/2014)... Double-stapled peptide inhibits RSV infection , Respiratory ... lower respiratory tract infections, generating life-threating illness in ... preventive therapies are limited. RSV enters host cells ... a six-helix fusogenic bundle. Small interfering peptides that ... however, these peptides are highly susceptible to degradation. ...
(Date:4/17/2014)... that fish consumption advisories for expecting mothers are ... like persistent organic pollutants (POPs). , The ... University of Toronto Scarborough PhD student Matt Binnington ... levels of environmental contamination, a mother,s compliance with ... body influenced exposure in her children. , Their ...
(Date:4/17/2014)... Our eyes not ... with a continuous stream of information about our own movements. ... a car the world glides by us and leaves ... our brain calculates self-motion from this "optic flow". This way, ... during our own movements. Together with biologists from the University ...
Breaking Biology News(10 mins):JCI online ahead of print table of contents for April 17, 2014 2JCI online ahead of print table of contents for April 17, 2014 3JCI online ahead of print table of contents for April 17, 2014 4JCI online ahead of print table of contents for April 17, 2014 5JCI online ahead of print table of contents for April 17, 2014 6Fish consumption advisories fail to cover all types of contaminants 2How vision makes sure that little fish do not get carried away 2How vision makes sure that little fish do not get carried away 3How vision makes sure that little fish do not get carried away 4
... ANN ARBOR, MI -- During pregnancy, many women ... uveitis. Now, scientists have described a biological mechanism responsible ... explain the remission. The expression of an enzyme ... in pregnant women compared to non-pregnant women, according to ...
... have discovered the oldest mammalian tooth marks yet on ... They report their findings in a paper published online ... Nicholas Longrich of Yale University and Michael J. ... across several of the bones while studying the collections ...
... (June 16, 2010) A research team from McGill ... in mouse models when implanted monocytes - a type ... immune system - helped preserve cardiac function following a ... in the current issue of Cell Transplantation ...
Cached Biology News:Why do certain diseases go into remission during pregnancy? 2Dinosaur-chewing mammals leave behind oldest known tooth marks 2Specific blood-derived cells promote survival in heart attack model 2
...
... BacVector Insect Cell Medium is optimized ... Ea4 Insect Cells. In this protein-free medium, ... 1 * 107 cells/ml with viabilities above ... plaque assays, where color from X-gluc staining ...
...
...
Biology Products: