Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

on) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection)
'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:12/17/2014)... (PRWEB) December 17, 2014 Gene ... that it has entered into a technology access ... (ADM) to apply DNA2.0’s proprietary protein engineering technology, ... process. , “We are extremely excited that the ... platform. This proprietary bioengineering technology has now ...
(Date:12/17/2014)... SOUTH SAN FRANCISCO, Calif. , Dec. 17, ... positive results of a Phase 2 study evaluating ... for the treatment of patients with severe, chronic ... the current standard of care, including topical steroids ... endpoint was percent change in Visual Analog Scale ...
(Date:12/15/2014)...  GlassesOff Inc. (OTCBB: GLSO) announced today the appointment ... director of the Company,s Board of Directors. ... its CEO until its acquisition by Stanley Black ... Recognized as the inventor of the first Wi-Fi-based Active ... -based RFID solutions focused on improving operational efficiency, safety ...
(Date:12/13/2014)... (PRWEB) December 12, 2014 Clarassance, a ... announced its new name: Therabron Therapeutics , Inc. ... and bronchioles (a type of structure in the lungs ... company’s mission to develop novel protein therapeutics for the ... directors decided to change the name to mark the ...
Breaking Biology Technology:ADM and DNA2.0 Enter Into Protein Engineering Technology Access and Service Agreement 2Velocity Pharmaceutical Development, LLC and Tigercat Pharma, Inc. Announce Phase 2 Results for VPD-737 in Patients With Chronic Pruritus 2Velocity Pharmaceutical Development, LLC and Tigercat Pharma, Inc. Announce Phase 2 Results for VPD-737 in Patients With Chronic Pruritus 3Velocity Pharmaceutical Development, LLC and Tigercat Pharma, Inc. Announce Phase 2 Results for VPD-737 in Patients With Chronic Pruritus 4AeroScout Founder Joins GlassesOff's Board of Directors 2AeroScout Founder Joins GlassesOff's Board of Directors 3Maryland-based Biotech Company's Path Forward in Treating Respiratory Diseases Sparks Name Change 2
... for March 12, 2009 NEW YORK, March 5 ... announced that it received a letter from the Staff ... had failed to regain compliance with Nasdaq Marketplace Rule ... of $2,500,000 in stockholders, equity, or $35,000,000 market value ...
... Technologies, Inc. (NYSE Alternext US: PTN) reported that its ... has been accepted by the NYSE Alternext US LLC ... As reported on December 30, 2008, Palatin received notice ... with certain continued listing requirements under Sections 1003(a)(ii) and ...
... Inc. (Nasdaq: OSTE ), a leader ... regenerative healing, today reported financial results for the ... 2008."The last twelve months were an important transitional ... to execute our corporate strategy to leverage the ...
Cached Biology Technology:Keryx Biopharmaceuticals Inc. Announces Receipt of Nasdaq Delisting Notification 2Keryx Biopharmaceuticals Inc. Announces Receipt of Nasdaq Delisting Notification 3Keryx Biopharmaceuticals Inc. Announces Receipt of Nasdaq Delisting Notification 4Palatin Technologies' Listing Compliance Plan Accepted by NYSE Alternext US 2Osteotech Reports Fourth Quarter and Full Year 2008 Financial Results; Company Plans Three Product Launches and Unveilings in 2009; Will Provide 2009 Guidance During Conference Call on March 5, 2009 at 9:00 a.m. EST 2Osteotech Reports Fourth Quarter and Full Year 2008 Financial Results; Company Plans Three Product Launches and Unveilings in 2009; Will Provide 2009 Guidance During Conference Call on March 5, 2009 at 9:00 a.m. EST 3Osteotech Reports Fourth Quarter and Full Year 2008 Financial Results; Company Plans Three Product Launches and Unveilings in 2009; Will Provide 2009 Guidance During Conference Call on March 5, 2009 at 9:00 a.m. EST 4Osteotech Reports Fourth Quarter and Full Year 2008 Financial Results; Company Plans Three Product Launches and Unveilings in 2009; Will Provide 2009 Guidance During Conference Call on March 5, 2009 at 9:00 a.m. EST 5Osteotech Reports Fourth Quarter and Full Year 2008 Financial Results; Company Plans Three Product Launches and Unveilings in 2009; Will Provide 2009 Guidance During Conference Call on March 5, 2009 at 9:00 a.m. EST 6Osteotech Reports Fourth Quarter and Full Year 2008 Financial Results; Company Plans Three Product Launches and Unveilings in 2009; Will Provide 2009 Guidance During Conference Call on March 5, 2009 at 9:00 a.m. EST 7
(Date:11/21/2014)... , Nov. 20, 2014   Atmel® Corporation ... microcontroller (MCU) and touch technology solutions, today launched the ... with the widest V cc range from ... accuracy and faster I 2 C bus communication speeds, ... EEPROM memory making them ideal for consumer, industrial, computer, ...
(Date:11/18/2014)... Nov. 17, 2014 The Parenteral Drug Association (PDA) ... agencies will speak and at least seven more will participate ... the Omni Shoreham Hotel in Washington D.C. ... to have significant support from the regulatory agencies in ... in our effort to help advance the use ...
(Date:11/12/2014)... 12, 2014 Crossmatch™, a leading provider of ... ® fingerprint readers have been deployed throughout Montparnasse ... Central Mexico . The bakery chain implemented the ... issues caused by employees clocking in for each other. ... readers, Montparnasse relied on paper timecards and a mechanical ...
Breaking Biology News(10 mins):Atmel Launches Industry's First Wide-V(cc) Low-Power Temperature Sensor Family 2Atmel Launches Industry's First Wide-V(cc) Low-Power Temperature Sensor Family 3Atmel Launches Industry's First Wide-V(cc) Low-Power Temperature Sensor Family 4FDA's Janet Woodcock, EMA's Emer Cooke Headline PDA Quality Metrics Conference 2Montparnasse Pasteleria Achieves Time and Attendance Transparency with Crossmatch U.are.U Fingerprint Readers 2
... This press release is available in Spanish . ... to unlocking genetic clues that may lead to packing more ... their value and help U.S. growers compete in international markets. ... C. Shoemaker have narrowed down where genes that determine protein ...
... Troy, N.Y. - The New York Center for Astrobiology will ... life beyond Earth with the help of a new NASA grant. ... the origins of life on Earth and the conditions that lead ... systems. "We are looking for the conditions of life, rather ...
... from Rice University,s BioScience Research Collaborative have won a ... to develop an injectable mix of polymers and adult ... cartilage in injured knees and other joints. "Millions ... that often result from cartilage injuries, particularly those to ...
Cached Biology News:Mapping out pathways to better soybeans 2NASA grant supports center for astrobiology in search for conditions of life in the universe 2NIH awards Rice $1.7M for cartilage-regeneration research 2
... Versatile state of the Art GLP ... to dual 38,000 L fermentation. ... to production. Aseptic operation capable ... Fed-Batch, and Continuous Modes. Hosts ...
... 200 g of lyophilized peptide derived from ... acids 380-402; GLTPSAWEASSLRSSRHSGLSHF. This peptide ... of Cayman's EP1 receptor polyclonal antibody (Catalog ... conjunction with this antibody to block protein-antibody ...
Anti-ZFP200 Family: Zinc Finger Peptide Sequence: CGKSFNHKTNLNKHER...
Complete cell culture media with cytokines...
Biology Products: