Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

on) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection)
'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:6/17/2013)... -- The Greater Raleigh Chamber of ... Management, Inc. to its Board of Advisors. "We,re ... Board of Advisors," said Harvey Schmitt , president and ... prestigious positions to hold in the business community. We look ... will contribute." The Board of Advisors is made ...
(Date:6/17/2013)... In this no-cost 1-hour interactive webinar, "Introduction to Scrum-Agile: ... an overview of the fundamental principles and mechanics of ... adopting Scrum Principles and Values in an organization. , ... Practices and an Agile Coach, will focus on the ... help in achieving them: , As a Customer: , ...
(Date:6/15/2013)... The topics that will be covered in ... scrum roles, scrum meetings, scrum artifacts, and scrum simulation ... PDUs) for attending them. , These trainings are suitable ... It is also ideal for those who will be ... software industry or those who want to explore Agile ...
(Date:6/14/2013)... 14, 2013  Royalty Pharma notes today,s announcement by Elan ... to explore a sale of the Company. Royalty Pharma believes ... no certainty that a deal will ever be reached. Royalty Pharma ... AGAINST all four resolutions up for consideration at Elan,s ... Pharma,s formal offer for Elan. In response to the ...
Breaking Biology Technology:Raleigh Chamber Names Bob Riedford to Board of Advisors 2Complimentary Interactive Webinar, "Introduction to Scrum-Agile: 'What's in it for me?'” on Wed, Jun 26, 2013 12:00 PM – 1:00 PM US Pacific Time 2Affordable Scrum Trainings in Chicago on July 12th 2013 by Conscires Agile Practices 2Affordable Scrum Trainings in Chicago on July 12th 2013 by Conscires Agile Practices 3Royalty Pharma Notes Elan Sales Process Offers Shareholders No Certainty 2Royalty Pharma Notes Elan Sales Process Offers Shareholders No Certainty 3Royalty Pharma Notes Elan Sales Process Offers Shareholders No Certainty 4Royalty Pharma Notes Elan Sales Process Offers Shareholders No Certainty 5Royalty Pharma Notes Elan Sales Process Offers Shareholders No Certainty 6Royalty Pharma Notes Elan Sales Process Offers Shareholders No Certainty 7Royalty Pharma Notes Elan Sales Process Offers Shareholders No Certainty 8Royalty Pharma Notes Elan Sales Process Offers Shareholders No Certainty 9Royalty Pharma Notes Elan Sales Process Offers Shareholders No Certainty 10Royalty Pharma Notes Elan Sales Process Offers Shareholders No Certainty 11
... have been battling search engines and online advertisers over ... online advertising. Two recent and conflicting rulings show that ... the new keyword technology can be a complicated matter. ... court ruling on advertising triggered by the keyword (and ...
... poor sport utility vehicle (SUV) fuel efficiency? , ... Wisconsin-Madison has spent the last three years building one ... America. The principles behind the vehicle, appropriately named the ... SUVs. , ,The effort is part of a contest, ...
... - Before Gov. Jim Doyle began ... stem cell research, a key Republican legislator had already turned ... , ,The projects, which now are the subject of a ... Doyle Administration by State Sen. Ted Kanavas , R-Brookfield, ...
Cached Biology Technology:Keyword advertisers win some, lose some 2Keyword advertisers win some, lose some 3Keyword advertisers win some, lose some 4Keyword advertisers win some, lose some 5UW-Madison hybrid-vehicle team places second nationally 2GOP lawmaker faults Doyle for IT problems 2GOP lawmaker faults Doyle for IT problems 3
(Date:6/17/2013)... foundations with more modern elements. Using this same approachbut ... Dietrich School of Arts and Sciences have designed a ... storage, and gas transport more efficient and at a ... issue of the Journal of the American Chemical ... builds upon Pitt Associate Professor of Chemistry Nathaniel Rosi,s ...
(Date:6/17/2013)... KAN. -- A Kansas State University research associate has ... mosquitoes and ways to prevent the spread of malaria. ... the National Institutes of Health,s National Research Service Award ... He is the seventh Kansas State University researcher to ... campus to currently hold such an award. , Bryant, ...
(Date:6/17/2013)... mining shale gas, is widespread across Pennsylvania, covering up ... in the Annals of the New York Academy ... including pollution from toxic chemicals, the building of well ... gas has engendered a great deal of controversy, largely ... on biological diversity and resources have scarcely been addressed ...
Breaking Biology News(10 mins):'Chemical architects' build materials with potential applications in drug delivery and gas storage 2NIH fellowship helps researcher fight malaria, understand mosquito immunity 2
... UC San Diego have found. Wasps warm up too ... shown. In both cases warmer flight muscles likely ... exploit a valuable resource before competitors arrive, the researchers ... scientific journals. Because foragers of neither species eat ...
... thought or action sends a million electrical signals pulsing through ... these electrical impulses is the ion channel. A new ... smaller than one-billionth of a meter in ion channels. This ... cell membrane open and close in response to changes in ...
... of genetic information within the cell, has emerged from ... hottest research areas of molecular biology, with implications for ... the field is complex, requiring access to the latest ... bioinformatics, as well as cross-pollination between multiple scientific disciplines. ...
Cached Biology News:Wasps and bumble bees heat up, fly faster with protein-rich food 2Wasps and bumble bees heat up, fly faster with protein-rich food 3Researchers catch ion channels in their opening act 2Researchers catch ion channels in their opening act 3RNA emerges from DNA's shadow 2RNA emerges from DNA's shadow 3
... R&D Systems Cell and Tissue Staining Kits ... a broad range of histological and cytological ... primary IgG antibodies manufactured by either R&D ... is based on the formation of the ...
... Cellular uptake of long double stranded RNA ... interference in a diverse group of organisms ... RNA interference leads to the inhibition of ... of the target messenger RNA (mRNA). Attempts ...
... Powerful exact mass measurements in an ... electrospray time-of-flight mass spectrometer (ESI-oa-TOF) concentrates ... in a format, which fits on ... mass resolution exceeding 10,000 FWHM and ...
... Definitive Performance The TSQ ... quantitation excellence in bioanalytical and environmental analysis. ... source ESI and APCI probes, a titanium ... for increased robustness and sensitivity. Its ...
Biology Products: