Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

on) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection)
'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:9/15/2014)... Sept. 15, 2014 EnGeneIC, Ltd. ... the treatment of cancer through the targeted delivery ... that, together with the Asbestos Disease Research Institute ... New South Wales (NSW) Premier,s Award for Excellence ... are the hospitals that will be involved in ...
(Date:9/15/2014)... State University have developed a technique for controlling the ... voltages, opening the door to a new generation of ... hinges on the fact that the oxide "skin" of ... acts as a surfactant, lowering the surface tension ... researchers used a liquid metal alloy of gallium and ...
(Date:9/15/2014)... of carbon nanotubes is neat, but Rice University scientists are ... in new fibers created at Rice line up like a ... Angel Mart and his colleagues. , The tricky bit, according ... the journal ACS Nano , is keeping the densely ... , Left to their own devices, carbon nanotubes form clumps ...
(Date:9/15/2014)... MORRISVILLE, NC (PRWEB) September 15, 2014 ... newly developed deep imaging OCT system for the optical ... , The EnvisuTM S4410 SDOCT for Contact ... measurements for standard and high complexity contact lens, IOL ... allows imaging of a complete contact lens immersed in ...
Breaking Biology Technology:EnGeneIC Named a Recipient of the Cancer Institute NSW Premier's Award for Excellence in Translational Cancer Research 2EnGeneIC Named a Recipient of the Cancer Institute NSW Premier's Award for Excellence in Translational Cancer Research 3Researchers control surface tension to manipulate liquid metals 2Rice rolls 'neat' nanotube fibers 2Rice rolls 'neat' nanotube fibers 3Bioptigen Introduces Deep Imaging OCT System for Contact Lens Metrology 2
... 7 /PRNewswire-FirstCall/ - Dragon Pharmaceutical Inc. ("Dragon" or the ... receipt of preliminary proxies, the Company believes that it has ... ("Merger") by and among Dragon, Chief Respect Limited, Datong Investment ... Yanlin Han . The Merger must be approved by holders ...
... , , ... a 25 percent replacement for petroleum oil more than doubles rubber,s stretchability and reduces its environmental ... Ford,s ... automotive parts such as deflector shields and baffles, radiator deflector shields, cupholder inserts and floor mats ...
... DATATRAK International, Inc. (OTCQX: DATA), a technology and services ... industry, today announced that it privately placed 357,857 common shares ... with certain members of its Board of Directors and management ... are restricted securities and are subject to the restrictions on ...
Cached Biology Technology:Dragon Pharma announces receipt of preliminary proxies to approve merger 2Dragon Pharma announces receipt of preliminary proxies to approve merger 3Ford Pioneers Patent-Pending Use of Eco-Friendly Soy Oil in Rubber Automotive Parts 2Ford Pioneers Patent-Pending Use of Eco-Friendly Soy Oil in Rubber Automotive Parts 3Ford Pioneers Patent-Pending Use of Eco-Friendly Soy Oil in Rubber Automotive Parts 4DATATRAK Completes Sale of 357,857 Common Shares to Directors and Management 2DATATRAK Completes Sale of 357,857 Common Shares to Directors and Management 3
(Date:9/15/2014)... Earth for the first 500 million years after it ... day, complete with oceans, continents and active crustal plates. ... called the Hadean, has gained substantial new support from ... more than 4 billion years ago with those formed ... possible geological analog for early Earth. , The study ...
(Date:9/15/2014)... cognitive function may play roles in one,s musical aptitude, ... timbre, tone durations, and formal structure in music. , ... that extremes in musical aptitude (extreme capacity/no capacity) are ... having moderate aptitude. , "This is a typical feature ... and it is influenced to varying degrees by environmental ...
(Date:9/15/2014)... from GEOMAR Helmholtz Centre for Ocean Research Kiel ... demonstrated for the first time, that the single ... Emiliania huxleyi , can adapt simultaneously to ... study, the researchers found no evidence for the ... aspects of climate change would interfere with each ...
Breaking Biology News(10 mins):Early Earth less hellish than previously thought 2Early Earth less hellish than previously thought 3Small algae with great potential 2Small algae with great potential 3
... 2013) As public health authorities across the globe grapple ... of Medicine microbiologists and colleagues have identified the unique resistance ... resistant to carbapenems. Carbapenems are a class of antibiotics ... bacteria, including E. coli and Klebsiella pneumonia ...
... of poultry could be improved by a discovery about how ... chicken,s genetic make-up can affect the signals sent from its ... has had enough to eat. Poultry farmers often have ... to feelings of fullness and can overeat, affecting their ability ...
... , March 26, 2013 Today, Hyland ... Intelligence Corporation (CIC; OTCQB: CICI), a leading ... help organizations automate processes, such as electronic mortgage ... enterprise content management (ECM) solution, OnBase, with ...
Cached Biology News:New study identifies unique mechanisms of antibiotic resistance 2Appetite genes are key to better diets for poultry, study shows 2Hyland Software Partners with Communication Intelligence Corporation (CIC), a Leading Supplier of Electronic Signature Solutions 2Hyland Software Partners with Communication Intelligence Corporation (CIC), a Leading Supplier of Electronic Signature Solutions 3