Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

on) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection)
'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:7/11/2014)... -- , Not for release, publication or distribution ... jurisdiction where to do so would constitute a violation of ... ("Shire" or the "Company") (LSE: SHP, NASDAQ: SHPG ... has held a meeting with representatives of AbbVie. ... agreement or approval of AbbVie. A further update ...
(Date:7/11/2014)... , July 11, 2014  Researchers have ... three-dimensional images. The new technology, called Virtual Finger, ... small structures like neurons and synapses using the ... unique technology makes 3D imaging studies orders of ... at an unprecedented level across many areas of ...
(Date:7/10/2014)... Understanding the need for better quality ... the gap that currently exists in this area, ChanTest ... portfolio of validated ion channel and GPCR cell lines. ... as ion channels control many critical physiological functions throughout ... the potential to treat a variety of human diseases. ...
(Date:7/10/2014)... 10, 2014 EvoDerma ’s NOOME Anti-Aging ... rejuvenating device now comes with a second treatment cup to ... , The new cup is thinner on the edges for ... target rough, thin and uneven surfaces on the face, neck ... a stimulating treatment on areas such as the cheeks and ...
Breaking Biology Technology:Shire plc - Statement re: Media Speculation 2Virtual Finger Enables Scientists To Navigate And Analyze 3D Images Of Complex Biological Structures 2Virtual Finger Enables Scientists To Navigate And Analyze 3D Images Of Complex Biological Structures 3Leader in Ion Channel Research Announces Newly Validated and Re-Engineered Cells 2Leader in Ion Channel Research Announces Newly Validated and Re-Engineered Cells 3Introducing a New Bonus Treatment Cup for EvoDerma’s NOOME Anti-Aging Motion 2
... venture investors have fewer secrets these days, and they ... early-stage executives during the National SBIR-STTR Conference. , ,In ... the University of Wisconsin-Madison , they counseled technology ... sustainable market advantage, and what each round of funding ...
... - Quintessence Biosciences , a biopharmaceutical company ... its EVade cancer treatments, has been selected for preclinical ... that pending a favorable preclinical safety assessment, it would ... an investigational new drug application in late 2007, ...
... Milwaukee, Wis. - The University of Wisconsin-Milwaukee ... for its incorporation of a content storage and collaboration ... , ,The PantherFile system, powered by Xythos Software ... 100, a group of organizations that invest in innovative ...
Cached Biology Technology:Early-stage executives hear from investors 2Early-stage executives hear from investors 3
(Date:7/10/2014)... July 2, 2014  Unisys Corporation,s (NYSE: UIS ... Nederland N.V., today announced that it has been selected by ... manage a new Basic Provision Biometrics solution for penitentiaries across ... won the contract with a solution based on its open ... term of the contract is up to seven years, with ...
(Date:7/10/2014)... SHELTON, Conn. , July 2, 2014 NXT-ID, Inc., ... market, reports that CEO Mr. Gino Pereira was ... radio show in Tampa Florida . Mr. ... radio host Cedric Harris and how the Wocket™ ... secure alternative.  Cedric Harris tells ...
(Date:7/10/2014)... July 3, 2014 Research and Markets ... the "Global Gesture Recognition & Touch-Less Sensing ... to 2020" report to their offering ... Gesture Recognition & Touch-Less Sensing Market to Grow ... a while, but the companies were unable to ...
Breaking Biology News(10 mins):Unisys Delivers New Basic Provision Biometrics Solution to Dutch Custodial Institutions Service 2Unisys Delivers New Basic Provision Biometrics Solution to Dutch Custodial Institutions Service 3Security and Your Money: Tampa Bay Radio Host Cedric Harris Talks to NXT-ID CEO Mr. Gino Pereira about the Wocket Smart Wallet 2Security and Your Money: Tampa Bay Radio Host Cedric Harris Talks to NXT-ID CEO Mr. Gino Pereira about the Wocket Smart Wallet 3Security and Your Money: Tampa Bay Radio Host Cedric Harris Talks to NXT-ID CEO Mr. Gino Pereira about the Wocket Smart Wallet 4Global Gesture Recognition & Touch-Less Sensing (2D, 3D, Ultrasonic, IR, Capacitive) Market - Forecasts to 2020 2
... Mich.---A new synthetic Petri dish coating could overcome a ... cell research, say University of Michigan researchers. Under ... yielding human therapies because the cells have been grown ... "These nondefined, animal-based components create issues with the ...
... economic stimulus program (ARRA) Health Information Technology for Economic ... of health information technology (HIT) and to ready a ... members of the American Medical Informatics Association (AMIA), a ... has advocated for informatics as a health care specialty. ...
... Troy, N.Y. Patrick Underhill, assistant professor in ... Rensselaer Polytechnic Institute, has won a prestigious Faculty ... Science Foundation (NSF). Underhill will use ... into how transport phenomena affect biological processes. He ...
Cached Biology News:New culture dish could advance human embryonic stem cell research 2AMIA Members Manage HITECH Stimulus Grant Awards 2Rensselaer Polytechnic Institute professor Patrick Underhill receives NSF CAREER award 2
... Automatic grid, subgrid and spot finding overcome tedious spot, ... template assignment , ... options to optimize, ... Characterize more precisely through grouping by cells, grids, ...
... DNA Gel Stain combo offers these benefits: ... products separately Offers a ... Eliminates risks to yourself, the environment ... from 100 bp to >30 kb. UltraPure Agarose is ...
... The Sub-Plates are E.Coli glycerol stocks ... well contains 50 cDNA clones with approximately ... of the a master plate well, the ... 96-well PCR to identify the positive well(s). ...
... liter of urine will give a positive reaction ... ,Certification: The Donors are of US origin ... NEGATIVE for HbsAg, HCV, HIV-1 & 2, Syphilis ... THIS MATERIAL IS SOLD FOR IN-VITRO DIAGNOSTIC USE ...
Biology Products: