Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

on) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection)
'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:8/1/2014)... York , August 1, 2014 ... Transparency Market Research "Biophotonics Market - Global Industry Analysis, ... the market was valued at USD 25.16 billion in ... by 2020, growing at a CAGR of 10.4% from ... Market Report at  http://www.transparencymarketresearch.com/biophotonics-market.html Increasing demand ...
(Date:8/1/2014)... August 01, 2014 BCC Research ( ... DRUG DELIVERY: TECHNOLOGIES AND GLOBAL MARKETS , that the ... expected to grow to nearly $38.8 billion by 2018, ... 27.2%. The aptamer delivery category, the fastest moving segment ... CAGR. , The field of RNAi therapeutics has shown ...
(Date:8/1/2014)... Testing the mechanical properties of ... understanding embryonic development. How and why embryonic ... functionally distinct tissues is important because abnormalities can ... McDevitt, Melissa Kinney, and Rabbia Saeed worked from ... cues to control many aspects of embryo development. ...
(Date:7/31/2014)... Today BioSpace , the leading life sciences employment and news website, ... sciences community in Illinois , Indiana ... Michigan , Minnesota , Missouri ... and Wisconsin . BioMidwest is a leader ... on BioSpace originating in this region in 2013. The life sciences sector ...
Breaking Biology Technology:Global Biophotonics Market is Expected to Reach USD 50.20 Billion in 2020: Transparency Market Research 2Global Biophotonics Market is Expected to Reach USD 50.20 Billion in 2020: Transparency Market Research 3Global Biophotonics Market is Expected to Reach USD 50.20 Billion in 2020: Transparency Market Research 4Global Market for RNAi Drug Delivery Technologies to Reach $38.8 Billion in 2018; Aptamer Delivery Segment Surging at 58.2% CAGR 2Global Market for RNAi Drug Delivery Technologies to Reach $38.8 Billion in 2018; Aptamer Delivery Segment Surging at 58.2% CAGR 3Study Links Biomechanics and Gene Expression in Stem Cells 2Midwest Biotech Leaders Featured On BioSpace Map 2
... ... ... ... ...
... ... ... ... ...
... , ... ... ... ...
Cached Biology Technology:Stem Cell Innovations to Provide Research and Assay Services to Agennix. 2Stem Cell Innovations to Provide Research and Assay Services to Agennix. 3Stem Cell Innovations to Provide Research and Assay Services to Agennix. 4Stem Cell Innovations to Provide Research and Assay Services to Agennix. 5InterMune Announces Submission of MAA for Pirfenidone for the Treatment of Patients With IPF 2InterMune Announces Submission of MAA for Pirfenidone for the Treatment of Patients With IPF 3InterMune Announces Submission of MAA for Pirfenidone for the Treatment of Patients With IPF 4InterMune Announces Submission of MAA for Pirfenidone for the Treatment of Patients With IPF 5InterMune Announces Submission of MAA for Pirfenidone for the Treatment of Patients With IPF 6InterMune Announces Submission of MAA for Pirfenidone for the Treatment of Patients With IPF 7Sigma-Aldrich(R) Focuses on Biology With Launch of New Life Science Brand Platform 2Sigma-Aldrich(R) Focuses on Biology With Launch of New Life Science Brand Platform 3Sigma-Aldrich(R) Focuses on Biology With Launch of New Life Science Brand Platform 4Sigma-Aldrich(R) Focuses on Biology With Launch of New Life Science Brand Platform 5Sigma-Aldrich(R) Focuses on Biology With Launch of New Life Science Brand Platform 6Sigma-Aldrich(R) Focuses on Biology With Launch of New Life Science Brand Platform 7Sigma-Aldrich(R) Focuses on Biology With Launch of New Life Science Brand Platform 8Sigma-Aldrich(R) Focuses on Biology With Launch of New Life Science Brand Platform 9Sigma-Aldrich(R) Focuses on Biology With Launch of New Life Science Brand Platform 10Sigma-Aldrich(R) Focuses on Biology With Launch of New Life Science Brand Platform 11
(Date:7/31/2014)... twin pairs have identified a gene mutation that may allow ... of sleep per night. The genetic variant also appears ... , Results show that a participant with p.Tyr362His a ... sleep duration of only five hours, which was more than ... about six hours and five minutes per night. The ...
(Date:7/31/2014)... team of scientists from Spain, France, and the ... that is the oldest definitive member of the ... amber. The discovery and description were made possible ... synchrotron imaging technique, which allows the detailed study ... new species is described in the journal ...
(Date:7/31/2014)... Prolonged exposure to loud noise alters how the ... distinguishing speech sounds, according to neuroscientists at The ... paper published this week in Ear and ... how noise-induced hearing loss affects the brain,s recognition ... reaches all corners of the population, affecting an ...
Breaking Biology News(10 mins):Study of twins discovers gene mutation linked to short sleep duration 2UT Dallas study reveals effect of loud noises on brain 2
... virologists headed by Professor Hans-Georg Kräusslich at Heidelberg ... of Applied Tumor Virology of the Deutsches Krebsforschungszentrum ... first to label Human Immunodeficiency Viruses (HIV) for ... the virus. , The labeling permits scientists to ...
... headed by Professor Hans-Georg Kräusslich at Heidelberg University ... Applied Tumor Virology of the Deutsches Krebsforschungszentrum (German ... to label Human Immunodeficiency Viruses (HIV) for visual ... virus. , The labeling permits scientists to observe ...
... to learn from bad bugs, according to Gilbert Waldbauer, whose ... was published March 1 (Prometheus Books). , "We know a ... their research," said Waldbauer, professor emeritus of entomology at the ... of insects, a mere 2 percent are considered pests. Just ...
Cached Biology News:New Species of Coral Discovered Off Southern California 2Virologists make major step towards understanding the process of HIV infection 2Bugs, even 'bad' ones, can be educationally beneficial, new book says 2Bugs, even 'bad' ones, can be educationally beneficial, new book says 3
Mouse polyclonal antibody to QPRT - quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase (carboxylating))...
... without ammonium sulfate are compatible with thermostable ... Taq and AmpliThem™™ DNA polymerases. You can ... in one experiment by adding your own ... PreMixes supplied with the kit. This capability ...
Application: for RNase- decontamination , Registered Trademark of Ambion. ,Special grade: for molecular biology Density: 1.00 g/mL (20 C) Suitab tst: RNase decontamination in accordance...
... agent for removing RNase from ... pipettors. It is also ... from microcentrifuge tubes without inhibiting ... (R) is a ...
Biology Products: