Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

on) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection)
'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:9/2/2014)... NC and Rocky Mount, NC (PRWEB) September 02, 2014 ... announced today the establishment of its 11th clinical research ... PMG Research has assumed ownership and operation of the ... Rocky Mount, NC, further expanding PMG’s presence in eastern ... an additional 130,000 patients. For the patients in Rocky ...
(Date:9/2/2014)... 02, 2014 The inventors of tinAway, ... chronic tinnitus are seeking support for development costs through ... platform ( http://igg.me/at/tinaway ), was launched on September 1, ... ‘mHealth’ app and is based on ten years of ... of biomedical and software engineers, Dr. Ian Dixon and ...
(Date:9/1/2014)... September 01, 2014 The Collaborative ... Diagnostics report provides comprehensive understanding and unprecedented access ... into by the worlds leading life science companies. ... analysis of how and why companies enter collaborative ... prospective partner’s negotiated deals terms provides critical insight ...
(Date:8/31/2014)... 2014 Market Research Report ... and in-depth research report on the Polyacrylamide ... including Polyacrylamide definition, classification, application, and industry ... This research covers the international market analysis, ... industry analysis covering macroeconomic environment & economic ...
Breaking Biology Technology:PMG Research Announces the Formation of its Eleventh Site 2PMG Research Announces the Formation of its Eleventh Site 3tinAway Pty. Ltd. launch a crowdfunding campaign to fund a clinical trial of tinAway, a new potential cure for chronic tinnitus 2tinAway Pty. Ltd. launch a crowdfunding campaign to fund a clinical trial of tinAway, a new potential cure for chronic tinnitus 3tinAway Pty. Ltd. launch a crowdfunding campaign to fund a clinical trial of tinAway, a new potential cure for chronic tinnitus 4tinAway Pty. Ltd. launch a crowdfunding campaign to fund a clinical trial of tinAway, a new potential cure for chronic tinnitus 5Collaborative R&D Terms & Agreements in Pharma, Biotech and Diagnostics Industry Analysis, Size, Share, Growth, Trends And Forecast Research Report by Researchmoz.us 2Collaborative R&D Terms & Agreements in Pharma, Biotech and Diagnostics Industry Analysis, Size, Share, Growth, Trends And Forecast Research Report by Researchmoz.us 3Collaborative R&D Terms & Agreements in Pharma, Biotech and Diagnostics Industry Analysis, Size, Share, Growth, Trends And Forecast Research Report by Researchmoz.us 4International Polyacrylamide Industry & Copper Iodide Market Data Analysis Now Available at DeepResearchReports.com 2International Polyacrylamide Industry & Copper Iodide Market Data Analysis Now Available at DeepResearchReports.com 3
... Generation Laboratory InstrumentsMENLO PARK, Calif. and NORWOOD, Mass., ... Inc. today jointly announced that Advanced Instruments Inc. ... Cantimer. The two companies further announced their ... new generation of laboratory instruments for osmolality measurement, ...
... of one of the fastest growing eye diseases on their patients, ... with a virtual experience of having neovascular (wet) age-related macular degeneration ... ... 2009 -- To help eye specialists better understand the impact of ...
... Tops List, Europe Trails in Expanded IIIP Innovation Confidence Index , ... ... innovative products was largely unaffected by the drop in consumer confidence last ... was expanded to cover every region of the world and released publicly ...
Cached Biology Technology:Advanced Instruments Makes Strategic Investment in Cantimer, Inc. 2Looking at AMD Through Patients' Eyes: Viscira Virtual Exhibit Educates Physicians by Personalizing Serious Eye Disease 2Looking at AMD Through Patients' Eyes: Viscira Virtual Exhibit Educates Physicians by Personalizing Serious Eye Disease 3Global Confidence in Innovation Holds Despite Economy 2Global Confidence in Innovation Holds Despite Economy 3Global Confidence in Innovation Holds Despite Economy 4
(Date:9/2/2014)... Konservat-Lagersttte of lithographic limestone is well known as ... from that area (for example, Archaeopteryx). Now, for ... in the French equivalent of these outcrops - ... oldest known water treader. , Despite the abundance ... fossils have been obtained from the Late Kimmeridgian ...
(Date:9/2/2014)... Cancer Center researchers may have discovered a new way ... vulnerable by deficient DNA repair. , The findings were ... , The study, led by James E. Hansen, ... of Medicine, found that cancer cells with deficient DNA ... genetic damage) were significantly more vulnerable to attack by ...
(Date:9/2/2014)... University] It,s hard to comprehend how bad the ... become without knowing what it was before people came ... was 10 times lower than scientists had thought, which ... , Extinctions are about 1,000 times more frequent now ... along. The explanation from lead author Jurriaan de Vos, ...
Breaking Biology News(10 mins):Exceptionally well preserved insect fossils from the Rhône Valley 2Sabotage as therapy: Aiming lupus antibodies at vulnerable cancer cells 2Extinctions during human era worse than thought 2Extinctions during human era worse than thought 3
... are invading the Great Lakes and changing the ecology of ... the March issue of the Journal of Great Lakes Research ... species, their ability to wrest territory from native fish plays ... , In the study, McMaster's Sigal Balshine, an assistant professor ...
... University's Pratt School of Engineering have created a new ... the probe creates a picture of the whole heart ... to image a single heart cross section. , The ... the condition of the heart, but also for use ...
... the brain and, more specifically, how nerve cells form billions of ... a scientific mystery. , A team headed by Drs. Robin Hiesinger ... have unraveled a piece of that puzzle by finding a gene ... their work appears today in the journal Neuron. , "We were ...
Cached Biology News:Duke engineers develop new 3-D cardiac imaging probe 2
... Zero Blunt TOPO PCR ... is designed for cloning ... blunt-end PCR products. The ... TOPO Cloning and greater ...
... The Zero Blunt TOPO ... Sequencing is designed for ... of blunt-end PCR products. ... 5-minute TOPO Cloning and ...
... Ultrospec 6300 pro UV/Visible Spectrophotometer: ... Pharmacopoeia in terms of instrument specification and ... able to be used for rapid, discrete ... scanning capability., *Press to read high performance ...
...
Biology Products: