Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

on) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection)
'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:7/24/2008)...l., July 24 /- Sagent Pharmaceuticals...company, today announced that it,has launched ceft...spectrum, beta-lactam antibiotic. Sagent will offe... pharmacy bulk package vials. According to,IMS dat...ed States were,approximately $45.7 million., "Sag...
(Date:7/24/2008)..., July 24 /- Human Genome,S...t David P. Southwell has,been appointed to the HGS...r of the Company,s Audit Committee. Until recently...based pharmaceutical company, where he served,as E...r, and also had,responsibility for Corporate Plann...
(Date:7/23/2008)...Nanotechnology will significantly change virtually...t ,has the opportunity to shape these changes and...maximized and its risks identified and controlled....Terry) Davies lays out a clear roadmap for the nex...mediate and longer term steps necessary to deal wi...
(Date:7/23/2008)... Pennsylvania Ahead of California, Massachusetts, ...-- Pennsylvania,s,efforts to develop and diversify...e number one state in the nation in the newest Bus.... Rendell said today., "We have laid the groundwo...vernor Rendell said of the overall biotechnology s...
Breaking Biology Technology:Sagent Pharmaceuticals Launches Ceftazidime for Injection, USP 2Human Genome Sciences Appoints David P. Southwell to its Board of Directors 2Human Genome Sciences Appoints David P. Southwell to its Board of Directors 3Human Genome Sciences Appoints David P. Southwell to its Board of Directors 4Nanotech: A regulatory blueprint for the next administration 2Pennsylvania Governor Rendell Says State Number 1 in New Biotechnology Study 2Pennsylvania Governor Rendell Says State Number 1 in New Biotechnology Study 3
...ugh the Internet is an integral place of business,...ill distrust even the most credible Web sites. , ...ood Web site when they see one. Their intuition is...xample, surfers are more likely to trust a site wh...ngine query than when it appears as a pay-per-clic...
...versity of Wisconsin-Madison says it has bought a ...e-Dimensional Printer has a better "enlarge" featu...dimensional models of small structures such as cel...sing white polymer powder and colored inks, the pr... at a time. Z-Corp is headquartered in Burlington,...
...u,ve followed this column, you know I have a pench...ovation. I can,t imagine why CBS won,t return my c...t" has such a ring to it. , ,What,s caught my inve... about Acela, the fast train service along the Eas...cks have developed in the disc brakes and all the ...
...ind your files? Desktop search applications bring ...h engines to your hard drive, but the market is ge...-Madison E-Business Consortium evaluated a dozen...satility, efficiency, security and enterprise read...Copernic came out the overall winner, ceding grou...
Other Biology Technology:Many still distrust Web sites is yours credible enough? 2Many still distrust Web sites is yours credible enough? 3When innovation gets off track 2When innovation gets off track 3
(Date:7/24/2008)...e Proteins (NSP), a new family of genes discovered... Research and Molecular Medicine in Temple Univers...involved in apoptosis or programmed cell death. ,...ang, then a doctoral student at the University and...iversity and the Cardeza Foundation, and Antonio G...
(Date:7/24/2008)...phoon in Taiwan buries as much carbon in the ocean...ins in that country all year long combined. , T...y published in a recent issue of the journal Geol...he chemistry of stream water and sediments that we...pening at full force -- will help scientists devel...
(Date:7/23/2008)...One of the reasons people on low-carbohydrate diet... of fructose, a type of sugar that can be made int...T Southwestern Medical Center. , Dr. Elizabeth...and lead author of a study appearing in a current ...,s findings suggest that the right type of carbohy...
(Date:7/23/2008)...ing together internationally renowned scientists f...a, Japan, Australia and India to address ancient ... "We are bringing together the world,s best scien...rganizer J. William Schopf, founder and director o...hysics, Center for the Study of Evolution and the ...
Breaking Biology News(10 mins):Novel structure proteins could play a role in apoptosis 2Study: Typhoons bury tons of carbon in the oceans 2Study: Typhoons bury tons of carbon in the oceans 3Study: Typhoons bury tons of carbon in the oceans 4Limiting fructose may boost weight loss, UT Southwestern researcher reports 2Limiting fructose may boost weight loss, UT Southwestern researcher reports 3UCLA 'world summit' to explore ancient life on Earth, and beyond 2Bioclocks work by controlling chromosome coiling 1306 1Bioclocks work by controlling chromosome coiling 1306 2Bioclocks work by controlling chromosome coiling 1306 3Susan G Komen for the Cure Provides Scholarships for Students Who Lost a Parent to Breast Cancer 6791 1Susan G Komen for the Cure Provides Scholarships for Students Who Lost a Parent to Breast Cancer 6791 2Inverness Medical Innovations Announces Closing of Public Offering 6787 1Inverness Medical Innovations Announces Closing of Public Offering 6787 2Brain Area Recognizes Familiar Sounds 6786 1
...t use of hospital-based services that were imposed...uring the 2003 SARS (Severe Acute Respiratory Synd...ly modest reductions in overall admissions. In thi...rmined that restrictions on the non-urgent use of ...ater Toronto Area resulted in a 12% decrease in ad...
...ear the Siberian tigers who stalk them" When wol...aid of them? , No, according to a study by Wildlif...who says that several large prey species, includin... regularly encounter. If you take away wolves, yo...wledge as biologists and public agencies increase ...
...overed that in the battle of the sexes, African el...al signals to court but also engage in a sort of d...o compare electrical and behavioral displays in br... type of mormyrid electric fish, which emit weak e...ails to sense their surroundings and communicate t...
...d a new biological function for a soccer ball-shap...o block allergic response, setting the stage for t...ergic disease is the sixth leading cause of chroni...treatments have been developed to control allergy,...e emerging field of medicine known as nanoimmunolo...
Other Biology News:Prey not hard-wired to fear predators 2Researchers develop buckyballs to fight allergy 2
...of Caspase/DIABLO Liquid. In 100 mM KCl, 20 mM H...residues 56 - 239 of human Smac/DIABLO with a carb...essed in and purified from E. coli . Smac/DIABLO ...osis and promotes caspase activation through the n...
Sheep polyclonal to Decorin ( Abpromise for all tested applications). Antigen: Synthetic peptide: IGPEVPDDRDFEPS conjugated to KLH, corresponding to amino acids 6-19 of Human Decorin (fragment 3
GLP expression profiling service on the Affymetrix platform. Starting material can be blood, tissue or RNA. 5 day turnaround. Standard and custom post analyses of microarray data available.
...croscopy-based imaging system that accurately coun... calculates cell viability, in a single test. By ...associated with the subjective interpretation of m...nt ViaSure Kit, up to six tests at a time can be p...
Biology Products: