Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

on) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection)
'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:10/20/2014)... , Oct. 20, 2014 Mapp Biopharmaceutical,s ... ZMapp™ antibody therapeutic to fight the Ebola outbreak ... and time-consuming the production of pharmaceuticals can be, ... publisher said that while some may be taken ... compound, those with industry knowledge are well aware ...
(Date:10/20/2014)... 2014  GenVec, Inc. (NASDAQ: GNVC ) today ... from its board of directors effective on October 24, 2014.  ... served as its chairman from June 2006 to November 2013.  ... Corporate Governance and Audit Committees of the board.  ... of dedicated service to GenVec, and its stockholders," said ...
(Date:10/19/2014)... Latin American hardware encryption display market report defines and ... forecast of revenue. This market was valued at $165.0 ... million by 2018, at a CAGR of 70.3% from ... the Latin American hardware encryption market report to get ... provides a glimpse of the segmentation of the market, ...
(Date:10/19/2014)... 19, 2014 The Asia-Pacific Speech Analytics ... in Asia-Pacific with analysis and forecast of revenue. This ... 2014 to $208 million by 2019, at a Compound ... 2019. , Browse through the TOC of the Asia-Pacific ... the in-depth analysis provided. It also provides a glimpse ...
Breaking Biology Technology:Kalorama: ZMapp Highlights Need For Faster Biopharmaceutical Production 2Kalorama: ZMapp Highlights Need For Faster Biopharmaceutical Production 3Zola P. Horovitz To Retire From GenVec Board 2The Latin American hardware encryption display market is expected to reach $2,366.8 million by 2018 - New Report by MicroMarket Monitor 2The Latin American hardware encryption display market is expected to reach $2,366.8 million by 2018 - New Report by MicroMarket Monitor 3The Asia-Pacific Speech Analytics market is estimated to reach $208 million by 2019 - New Report by MicroMarket Monitor 2The Asia-Pacific Speech Analytics market is estimated to reach $208 million by 2019 - New Report by MicroMarket Monitor 3The Asia-Pacific Speech Analytics market is estimated to reach $208 million by 2019 - New Report by MicroMarket Monitor 4
... , SAN FRANCISCO , Feb. 1 ... as a placement agent in GenVec, Inc.,s (Nasdaq: GNVC ) ... common stock, and warrants to purchase 4.2 million shares of common ...   http://www.newscom.com/cgi-bin/prnh/20090911/MCFLOGO ) , "We have been working with the Merriman ...
... ... Health Canada Inspection and Compliance with European Directive for Manufacture and Testing of Drug ... ... Services, a privately owned Canadian pharmaceutical services provider to leading pharmaceutical companies, today announced ...
... , FORT LAUDERDALE, Fla. , Feb. 1 ... EuroIntervention (EuroIntervention, 2010; 5:698-702) demonstrated good safety ... late stent thrombosis at one year in patients with ... intervention (PCI) and implantation of the company,s Genous Bio-engineered ...
Cached Biology Technology:Merriman Curhan Ford Acted as Placement Agent in GenVec's $28 Million Registered Offering 2Merriman Curhan Ford Acted as Placement Agent in GenVec's $28 Million Registered Offering 3Merriman Curhan Ford Acted as Placement Agent in GenVec's $28 Million Registered Offering 4Merriman Curhan Ford Acted as Placement Agent in GenVec's $28 Million Registered Offering 5Merriman Curhan Ford Acted as Placement Agent in GenVec's $28 Million Registered Offering 6Merriman Curhan Ford Acted as Placement Agent in GenVec's $28 Million Registered Offering 7Dalton Pharma Services Announces Successful Completion of Health Canada Inspection 2Dalton Pharma Services Announces Successful Completion of Health Canada Inspection 3OrbusNeich's Genous(TM) Bio-engineered R stent(TM) Demonstrates Good Safety and Clinical Outcomes in Patients with Primary PCI for STEMI 2OrbusNeich's Genous(TM) Bio-engineered R stent(TM) Demonstrates Good Safety and Clinical Outcomes in Patients with Primary PCI for STEMI 3
(Date:10/16/2014)... efficiently, they are anything but sustainable: environmental damage ... is becoming increasingly evident. Despite their disadvantages, however, ... regarded as the sole possibility of achieving higher ... Bernhard Schmid, an ecology professor at the University ... agriculture and forestry. After all, a new study ...
(Date:10/15/2014)... Oct. 15, 2014 Sandata Technologies, LLC, ... and community-based care, today announced it released a ... Santrax® Electronic Visit Verification™ Solution (EVV™)  for Quality ... home health company founded in 1996 and has ... The study details the challenges ...
(Date:10/15/2014)... an unexpected extent. The outbreak does not follow the ... a new disease dynamic in regions, where it has ... National Academy of Sciences Leopoldina, acatech – the German ... the German Academies of Sciences and Humanities have presented ... the statement the academies call for the following consequences ...
Breaking Biology News(10 mins):Plant communities produce greater yield than monocultures 2Plant communities produce greater yield than monocultures 3Sandata Announces Case Study with Quality Care Services, Inc. 2Academies call for consequences from the Ebola virus epidemic 2Academies call for consequences from the Ebola virus epidemic 3Academies call for consequences from the Ebola virus epidemic 4Academies call for consequences from the Ebola virus epidemic 5
... woodpecker is alive and well in Arkansas, USA may ... published today in the open access journal BMC Biology ... Woodpecker Campephilus principalis could be another native woodpecker species. ... footage from April 2004 of the supposed Ivory-billed Woodpecker ...
... found naturally in the gut is the basis of a ... under the Wellcome Trust's Seeding Drug Discovery initiative. The drug ... experts, Professor Steve Bloom at Imperial College London's Hammersmith Hospital ... by obesity in England alone, so there is a clear ...
... Pharmacology at the University of California, San Diego (UCSD) ... over the past few years, which has led him ... and genes, we have started to put together unexpected ... twins provides scientists with data on traits that are ...
Cached Biology News:A case of mistaken identity for the ivory-billed woodpecker? 2Natural gut hormone offers hope for new obesity drug 2Twin studies reveal genetic components leading to cardiac and kidney disease 2Twin studies reveal genetic components leading to cardiac and kidney disease 3
... Combination inline heater plus multi-channel focal drug ... wash-out with a high-flow bath line while ... through the Perfusion Pencil.® Steady 37°C at ... bath line and tip. Advanced ...
...
... human angiogenin expressed in ... form: Lyophilized from a 0.2 ... buffered saline. Titertest method: ... Titertest values: capture ELISA 1-2 ...
Mouse Amphiregulin MAb (Clone 206220)...
Biology Products: