Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

RNA interference is a powerful technique for gene knockdown experiments in academic research and an important tool for target identification and target validation in therapeutic research.

A growing number of different cell lines are used for gene knockdown experiments, and in many cases protocols for transfection do not exist. In order to optimize transfection conditions for a new cell line being investigated, luciferase-expressing plasmids are often cotransfected with the siRNA. However, the transfection conditions for plasmids and siRNA are quite different, as the plasmids must enter the nucleus, whereas siRNAs act in the cytoplasm therefore, these optimizations may lead to poor results. In addition, the use of fluorescently labeled siRNAs can give unpredictable results due to hydrophobic effects of fluorophore groups.

We have successfully used housekeeping genes as universal positive control genes for knockdown experiments in two different cell lines. The mRNA levels were analyzed using the LightCycler Instrument and were quantified relative to other housekeeping genes using the LightCycler h-Housekeeping Gene Sets.

Materials and Methods

Cell culture
Cells of the human adherent cell line PC3 were cultured in RPMI 1640 medium containing 10% (v/v) fetal calf serum and 2mM L-glutamine. Cells of the human adherent cell line HCT116 were cultured in McCoys 5A medium containing 10% (v/v) fetal calf serum and 2 mM L-glutamine.

Two days prior to transfection with siRNA oligonucleotides, 5x104 cells were plated in each well of 24- well plates. The siRNA (Dharmac on) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection) .



siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.



Conclusion

The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.


'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
*Name:
*Comment:
*Email:


(Date:7/18/2017)... ... July 18, 2017 , ... Nanomedical ... biotherapeutics development, announces the launch of a new NTA biosensor chip for use ... to study the kinetics of polyhistidine-tagged (His-tagged) molecules quickly and reliably. , ...
(Date:7/18/2017)... ... 2017 , ... G-CON today announced that it has received ... Patent Applications 14/858,857 and 13/669,785 both entitled Modular, Self-Contained, Mobile Clean Room. The ... protection of G-CON’s R&D investments and validate the G-CON platform as a novel ...
(Date:7/18/2017)... ... July 18, 2017 , ... ... Software ( https://dataformsoftware.com ) announces the migration of its flagship cloud-based product Planet ... is a team-centric, enterprise work management system that merges strategic and financial planning ...
(Date:7/17/2017)... Pa. (PRWEB) , ... July ... ... provider of technology-enabled clinical trial solutions, today announced safety software company AB ... within the eHealth Solutions business segment to advance technology innovation across life ...
Breaking Biology Technology:
(Date:4/17/2017)... Florida , April 17, 2017 NXT-ID, ... technology company, announces the filing of its 2016 Annual Report on ... and Exchange Commission. ... on Form 10-K is available in the Investor Relations section of ... as on the SEC,s website at http://www.sec.gov . ...
(Date:4/11/2017)... 11, 2017 Research and Markets has announced ... report to their offering. ... global eye tracking market to grow at a CAGR of 30.37% ... Tracking Market 2017-2021, has been prepared based on an in-depth market ... landscape and its growth prospects over the coming years. The report ...
(Date:4/5/2017)... , April 5, 2017  The Allen Institute ... Allen Cell Explorer: a one-of-a-kind portal and dynamic digital ... 3D imaging data, the first application of deep learning ... human stem cell lines and a growing suite of ... platform for these and future publicly available resources created ...
Breaking Biology News(10 mins):