Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

RNA interference is a powerful technique for gene knockdown experiments in academic research and an important tool for target identification and target validation in therapeutic research.

A growing number of different cell lines are used for gene knockdown experiments, and in many cases protocols for transfection do not exist. In order to optimize transfection conditions for a new cell line being investigated, luciferase-expressing plasmids are often cotransfected with the siRNA. However, the transfection conditions for plasmids and siRNA are quite different, as the plasmids must enter the nucleus, whereas siRNAs act in the cytoplasm therefore, these optimizations may lead to poor results. In addition, the use of fluorescently labeled siRNAs can give unpredictable results due to hydrophobic effects of fluorophore groups.

We have successfully used housekeeping genes as universal positive control genes for knockdown experiments in two different cell lines. The mRNA levels were analyzed using the LightCycler Instrument and were quantified relative to other housekeeping genes using the LightCycler h-Housekeeping Gene Sets.

Materials and Methods

Cell culture
Cells of the human adherent cell line PC3 were cultured in RPMI 1640 medium containing 10% (v/v) fetal calf serum and 2mM L-glutamine. Cells of the human adherent cell line HCT116 were cultured in McCoys 5A medium containing 10% (v/v) fetal calf serum and 2 mM L-glutamine.

Two days prior to transfection with siRNA oligonucleotides, 5x104 cells were plated in each well of 24- well plates. The siRNA (Dharmac on) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection) .



siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.



Conclusion

The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.


'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
*Name:
*Comment:
*Email:


(Date:2/23/2017)... and SAN FRANCISCO , Feb. 23, ... medicine company, and Beyond Type 1, a not-for-profit advocacy ... diabetes, today announced a grant from Beyond Type 1 ... for type 1 and other insulin-requiring diabetes.  ... developing innovative stem cell-derived cell replacement therapies with a ...
(Date:2/22/2017)... -- Aratana Therapeutics, Inc. (NASDAQ: PETX), a pet therapeutics company focused ... for companion animals, will host a live conference call on ... financial results from the fourth quarter and full year ended ... may access the audio webcast or use the ... ...
(Date:2/22/2017)... Clara, CA (PRWEB) , ... February 22, 2017 , ... ... hosting a free AFM Luncheon for all SPIE attendees and ... Jose, CA, just one block from the San Jose Convention Center. The luncheon ...
(Date:2/22/2017)... CINCINNATI , Feb. 22, 2017 Scientists ... drives inflammation and organ damage in Gaucher and maybe ... fewer risks and lower costs than current therapies. ... Children,s Hospital Medical Center , which also included investigators ... , report their data Feb. 22. The study ...
Breaking Biology Technology:
(Date:2/8/2017)... YORK , Feb. 8, 2017 About ... individual,s voice to match it against a stored ... such as pitch, cadence, and tone are compared ... require minimal hardware installation, as most PCs already ... for different transactions. Voice recognition biometrics are most ...
(Date:2/8/2017)... LONDON , Feb. 7, 2017 Report ... $12.5 billion by 2021 from $8.3 billion in 2016 ... from 2016 to 2021. Report Includes - An ... of global market trends, with data from 2015 and ... through 2021. - Segmentation of the market on the ...
(Date:2/6/2017)... Feb. 6, 2017 According to Acuity ... driving border authorities to continue to embrace biometric ... are 2143 Automated Border Control (ABC) eGates and ... at more than 163 ports of entry across ... 2016 achieving a combined CAGR of 37%. APC ...
Breaking Biology News(10 mins):