Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

RNA interference is a powerful technique for gene knockdown experiments in academic research and an important tool for target identification and target validation in therapeutic research.

A growing number of different cell lines are used for gene knockdown experiments, and in many cases protocols for transfection do not exist. In order to optimize transfection conditions for a new cell line being investigated, luciferase-expressing plasmids are often cotransfected with the siRNA. However, the transfection conditions for plasmids and siRNA are quite different, as the plasmids must enter the nucleus, whereas siRNAs act in the cytoplasm therefore, these optimizations may lead to poor results. In addition, the use of fluorescently labeled siRNAs can give unpredictable results due to hydrophobic effects of fluorophore groups.

We have successfully used housekeeping genes as universal positive control genes for knockdown experiments in two different cell lines. The mRNA levels were analyzed using the LightCycler Instrument and were quantified relative to other housekeeping genes using the LightCycler h-Housekeeping Gene Sets.

Materials and Methods

Cell culture
Cells of the human adherent cell line PC3 were cultured in RPMI 1640 medium containing 10% (v/v) fetal calf serum and 2mM L-glutamine. Cells of the human adherent cell line HCT116 were cultured in McCoys 5A medium containing 10% (v/v) fetal calf serum and 2 mM L-glutamine.

Two days prior to transfection with siRNA oligonucleotides, 5x104 cells were plated in each well of 24- well plates. The siRNA (Dharmac on) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection) .



siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.



Conclusion

The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.


'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
*Name:
*Comment:
*Email:


(Date:10/10/2017)... ... October 10, 2017 , ... ... pharmaceutical company advancing targeted antibody-drug conjugate (ADC) therapeutics, today confirmed licensing rights ... (Hybrid Polymerized Liposomal Nanoparticle), a technology developed in collaboration with Children’s Hospital ...
(Date:10/10/2017)... 10, 2017 International research firm Parks Associates announced ... at the TMA 2017 Annual Meeting , October 11 in ... residential home security market and how smart safety and security products impact ... Parks Associates: Smart Home ... "The residential security market has ...
(Date:10/10/2017)... PITTSBURGH, PA (PRWEB) , ... October 10, 2017 ... ... this year’s recipients of 13 prestigious awards honoring scientists who ... be presented in a scheduled symposium during Pittcon 2018, the world’s leading conference ...
(Date:10/9/2017)... ... October 09, 2017 , ... At its national board ... Stubbs, a professor in Harvard University’s Departments of Physics and Astronomy, has been selected ... member of the winning team for the 2015 Breakthrough Prize in Fundamental physics for ...
Breaking Biology Technology:
(Date:4/13/2017)... SANTA MONICA, Calif. , April 13, 2017 /PRNewswire/ ... New York will feature emerging and ... Innovation Summits. Both Innovation Summits will run alongside the ... variety of speaker sessions, panels and demonstrations focused on ... east coast,s largest advanced design and manufacturing event will ...
(Date:4/11/2017)... No two people are believed to ... York University Tandon School of Engineering and Michigan ... partial similarities between prints are common enough that ... and other electronic devices can be more vulnerable ... in the fact that fingerprint-based authentication systems feature ...
(Date:4/5/2017)... , April 5, 2017 Today HYPR ... that the server component of the HYPR platform is ... providing the end-to-end security architecture that empowers biometric authentication ... HYPR has already secured over 15 million users across ... manufacturers of connected home product suites and physical access ...
Breaking Biology News(10 mins):