Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

RNA interference is a powerful technique for gene knockdown experiments in academic research and an important tool for target identification and target validation in therapeutic research.

A growing number of different cell lines are used for gene knockdown experiments, and in many cases protocols for transfection do not exist. In order to optimize transfection conditions for a new cell line being investigated, luciferase-expressing plasmids are often cotransfected with the siRNA. However, the transfection conditions for plasmids and siRNA are quite different, as the plasmids must enter the nucleus, whereas siRNAs act in the cytoplasm therefore, these optimizations may lead to poor results. In addition, the use of fluorescently labeled siRNAs can give unpredictable results due to hydrophobic effects of fluorophore groups.

We have successfully used housekeeping genes as universal positive control genes for knockdown experiments in two different cell lines. The mRNA levels were analyzed using the LightCycler Instrument and were quantified relative to other housekeeping genes using the LightCycler h-Housekeeping Gene Sets.

Materials and Methods

Cell culture
Cells of the human adherent cell line PC3 were cultured in RPMI 1640 medium containing 10% (v/v) fetal calf serum and 2mM L-glutamine. Cells of the human adherent cell line HCT116 were cultured in McCoys 5A medium containing 10% (v/v) fetal calf serum and 2 mM L-glutamine.

Two days prior to transfection with siRNA oligonucleotides, 5x104 cells were plated in each well of 24- well plates. The siRNA (Dharmacon) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection).



siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.



Conclusion

The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.


'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:8/18/2014)... unprecedented efficiency and data storage may someday ... electric polarizations to read and write digital ... data-driven technology. But ferroelectrics must first overcome ... curious habit of "forgetting" stored data. ... of Energy,s Brookhaven National Laboratory have discovered ...
(Date:8/18/2014)... 2014 According to a ... "Life Science Reagents Market(Products- PCR Reagent Kits, Cell ... Diagnostic Reagents and Others; End Users- Commercial and ... and Forensic Laboratories)- Global Industry Analysis, Size, Share, ... global life science reagents market was valued at ...
(Date:8/18/2014)... , Aug. 18, 2014 TNI BioTech, Inc. ... pioneering the manufacturing and marketing of innovative therapies for ... Company is providing a second notice of TNI BioTech,s ... making the announcement, Noreen Griffin , founder and ... advance for your participation in the Annual Meeting. On ...
(Date:8/18/2014)... 2014 China is increasingly being ... clinical research industry. Clinicaltrial.gov statistics highlight the popularity ... aging population; a high increase in infectious diseases; ... populated pool of patients and a track record ... points, China also presents challenges for the clinical ...
Breaking Biology Technology:Promising ferroelectric materials suffer from unexpected electric polarizations 2Promising ferroelectric materials suffer from unexpected electric polarizations 3Promising ferroelectric materials suffer from unexpected electric polarizations 4Global Life Science Reagents Market Expected to Reach USD 25.7 Billion in 2019: Transparency Market Research 2Global Life Science Reagents Market Expected to Reach USD 25.7 Billion in 2019: Transparency Market Research 3Global Life Science Reagents Market Expected to Reach USD 25.7 Billion in 2019: Transparency Market Research 4Global Life Science Reagents Market Expected to Reach USD 25.7 Billion in 2019: Transparency Market Research 5TNI BioTech Inc., provides 2nd Notice of Annual Meeting September 4, 2014 2TNI BioTech Inc., provides 2nd Notice of Annual Meeting September 4, 2014 3TNI BioTech Inc., provides 2nd Notice of Annual Meeting September 4, 2014 4China – Land of Opportunities & Challenges for the Clinical Research Industry, New Webinar Hosted by Xtalks 2
... the Clinical and Economic Value of Pharmaceuticals in ... ExL Pharma today announced the start of the ... Marketing for the Pharmaceutical Industry at the Loews ... markets marketers with strategic insights needed to prepare ...
... QC, Feb. 9 /PRNewswire-FirstCall/ - LAB Research Inc. ("LRI", ... global non-clinical contract research organization, today announced the nomination ... Board of Directors in replacement of Mr. Karsten Skydsgaard ... the Board to focus on his other professional obligations. ...
... In a paper,published today, scientists at deCODE ... four continents present a novel insight into the ... search in some,10,000 Icelanders, the deCODE team discovered ... human genome (SNPs) that increase levels of,eosinophils in ...
Cached Biology Technology:ExL Pharma Presents The Pharmaceutical Managed Markets Insight & Marketing for the Pharmaceutical Industry Conference 2ExL Pharma Presents The Pharmaceutical Managed Markets Insight & Marketing for the Pharmaceutical Industry Conference 3LAB Research announces changes to its Board of Directors 2Multinational deCODE Study Identifies New Link Between Inflammation and Heart Attack 2Multinational deCODE Study Identifies New Link Between Inflammation and Heart Attack 3Multinational deCODE Study Identifies New Link Between Inflammation and Heart Attack 4
(Date:8/19/2014)... 19, 2014 To improve students, chances of ... the University of Houston (UH) implemented a comprehensive ... at risk for failure. , Through a ... (THECB), the Department of Biology and Biochemistry embarked ... taking "General Biology" for non-majors and "Introductory Biology" ...
(Date:8/19/2014)... Research and Network-Level Science, , Imagine if we had ... ecosystems was responding to global changes in real time. ... coupled multiple decades of information about ecological responses to ... dozens of different ecosystem types. , In fact, ... (LTER) Network, which will soon celebrate its 35th anniversary. ...
(Date:8/19/2014)... at retail seafood counters in 10 different states ... consumers to unexpectedly high levels of mercury, a ... a fish of the same species, but from ... offense, according to new research by University of ... seafood is essential to allow consumers to choose ...
Breaking Biology News(10 mins):University of Houson program earns kudos for improving grades, retaining students 2University of Houson program earns kudos for improving grades, retaining students 3This week from AGU: Long-term ecological research, predicting cholera outbreaks 2Seafood substitutions can expose consumers to unexpectedly high mercury 2Seafood substitutions can expose consumers to unexpectedly high mercury 3
... international study fails to support the common belief that ... a key factor in rising rates of obesity. ... compared African American women in metropolitan Chicago with women ... 184 pounds and the Nigerian women weighed 127 pounds. ...
... 6, 2009) − Obstructive sleep apnea decreases blood flow ... and eventually harms the brain,s ability to modulate these ... new study published by The American Physiological Society. The ... are more likely to suffer strokes and to die ...
... The study of ancient microbes may not seem consequential, ... has implications for the state of modern human health. ... says results of this research raise questions about the ... National Institutes of Health initiative is looking at helpful ...
Cached Biology News:Physical activity may not be key to obesity epidemic 2Study helps explain connection between sleep apnea, stroke and death 2Study helps explain connection between sleep apnea, stroke and death 3Understanding extinct microbes may influence the state of modern human health 2Understanding extinct microbes may influence the state of modern human health 3
... spotting and preparation for MS analysis. ... can be accurately and continuously spotted onto ... solutions can be added automatically. This allows ... MALDI-TOF-MS measurements. By using it in conjunction ...
A camera based compact unit for high speed scanning of 2D barcoded tubes in a cluster rack. This reader has been designed to read both 96 and 48 tube rack configurations and be compatible with common...
A compact, high-speed single tube reader unit designed for benchtop 2D barcode reading. The unit can be used with all of ABgene's 2D barcoded tubes, including the 2ml CryoCode tube....
... Enzymatic method stops PCR carry-over ... ,Designed to degrade PCR products from ... nucleic acid templates, which improves amplification ... core reagents and GeneAmp instrument systems ...
Biology Products: