Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

RNA interference is a powerful technique for gene knockdown experiments in academic research and an important tool for target identification and target validation in therapeutic research.

A growing number of different cell lines are used for gene knockdown experiments, and in many cases protocols for transfection do not exist. In order to optimize transfection conditions for a new cell line being investigated, luciferase-expressing plasmids are often cotransfected with the siRNA. However, the transfection conditions for plasmids and siRNA are quite different, as the plasmids must enter the nucleus, whereas siRNAs act in the cytoplasm therefore, these optimizations may lead to poor results. In addition, the use of fluorescently labeled siRNAs can give unpredictable results due to hydrophobic effects of fluorophore groups.

We have successfully used housekeeping genes as universal positive control genes for knockdown experiments in two different cell lines. The mRNA levels were analyzed using the LightCycler Instrument and were quantified relative to other housekeeping genes using the LightCycler h-Housekeeping Gene Sets.

Materials and Methods

Cell culture
Cells of the human adherent cell line PC3 were cultured in RPMI 1640 medium containing 10% (v/v) fetal calf serum and 2mM L-glutamine. Cells of the human adherent cell line HCT116 were cultured in McCoys 5A medium containing 10% (v/v) fetal calf serum and 2 mM L-glutamine.

Two days prior to transfection with siRNA oligonucleotides, 5x104 cells were plated in each well of 24- well plates. The siRNA (Dharmacon) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection).



siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.



Conclusion

The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.


'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:10/20/2014)... 20, 2014 Convey Computer , ... team from Iowa State University won first place in ... a Convey HC-2ex, the team’s solution achieved the highest ... than the second place finisher. , Experts from all ... the month long challenge, using a variety of design ...
(Date:10/20/2014)... GAITHERSBURG, Md. , Oct. 20, 2014  GenVec, Inc. ... Zola P. Horovitz , Ph.D., from its board of ... GenVec board in August 2003, and served as its chairman ... also served on the Nominating and Corporate Governance and Audit ... Zola for more than a decade of dedicated service to ...
(Date:10/20/2014)... Local veterinary surgeon, Dr. Tim McCarthy ... of donor stem cells for dogs with osteoarthritis. Dr. ... has performed clinical stem cell therapy for 7 years. ... if a single injection of donor stem cells into ... pain and inflammation in the treated joints. , ...
(Date:10/19/2014)... October 19, 2014 The Asia-Pacific ... market in Asia-Pacific with analysis and forecast of ... Asia Pacific Bromine Market report, to get an ... provides a glimpse of the segmentation in the ... tables and figures. , http://www.micromarketmonitor.com/market/asia-pacific-bromine-6741503144.html ...
Breaking Biology Technology:Team from Iowa State Wins 2014 MemoCODE Design Contest Using Convey HC-2ex 2Team from Iowa State Wins 2014 MemoCODE Design Contest Using Convey HC-2ex 3Zola P. Horovitz To Retire From GenVec Board 2Cascade Veterinary Referral Center Seeks Candidates for an Investigational Study of Stem Cells for Dogs with Arthritis 2The Asia-Pacific Bromine Market is estimated to grow to $4,080.1 million by 2018 - New Report by MicroMarket Monitor 2The Asia-Pacific Bromine Market is estimated to grow to $4,080.1 million by 2018 - New Report by MicroMarket Monitor 3
... , , , ... AMLN ) today announced that its Board of Directors has ... , , Mr. Costa was formerly President and ... other executive positions, including Head of the Americas and President and ...
... , ... Latin American-based Investigator Sites Now Available on goBalto.com , ... San Francisco, CA (PRWEB) August 24, 2009 -- ... industry, announced today that Clinical Trials Support is making its proprietary list ...
... , , , ... CTIC) (the "Company") today announced the closing of its previously announced ... Stock and warrants to purchase shares of its common stock in ... has elected to convert all of its shares of Series 2 ...
Cached Biology Technology:Amylin Pharmaceuticals Board of Directors Elects Paulo F. Costa Chairman of the Board 2goBalto Drug Development Partnering WebSite to Include Clinical Trials Support's List of Investigator Sites 2goBalto Drug Development Partnering WebSite to Include Clinical Trials Support's List of Investigator Sites 3Cell Therapeutics, Inc. Announces Closing of Registered Offering of $30 Million of Preferred Stock and Warrants 2
(Date:10/17/2014)... University of Copenhagen have shown for the first time ... Cystic fibrosis patients, giving them the opportunity to get ... infections. , The study also discovered the bacterial growth ... was halted or slowed down by the immune cells. ... oxygen and helped "suffocate" the bacteria, forcing the bacteria ...
(Date:10/16/2014)... conventional thinking on how the bowel lining develops and, ... bowel cancer starts. , The researchers produced evidence that ... ,crypts, that are a feature of the bowel lining, ... cancer development, a controversial finding as scientists are still ... imaging technologies, Dr Chin Wee Tan and Professor Tony ...
(Date:10/15/2014)... 15, 2014 Sandata Technologies, LLC, an ... community-based care, today announced it released a case ... Electronic Visit Verification™ Solution (EVV™)  for Quality Care ... health company founded in 1996 and has five ... The study details the challenges facing ...
Breaking Biology News(10 mins):Scientists opens black box on bacterial growth in cystic fibrosis lung infection 2Cryptic clues drive new theory of bowel cancer development 2Sandata Announces Case Study with Quality Care Services, Inc. 2
... vegetables in salads are chock-full of important vitamins and ... right type and amount of salad dressing, a Purdue ... fed subjects salads topped off with saturated, monounsaturated and ... of fat-soluble carotenoids ╨ compounds such as lutein, lycopene, ...
... and red wine may enhance exercise training and performance, ... Alberta. Principal investigator Jason Dyck and his team ... natural compound resveratrol improved physical performance, heart function and ... excited when we saw that resveratrol showed results similar ...
... health promotion and lack of success with changing patient ... physical activity counseling in the primary care setting, according ... Public Health, part of The University of Texas Health ... barriers must be addressed in order to incorporate counseling ...
Cached Biology News:Study: No-fat, low-fat dressings don't get most nutrients out of salads 2UTHealth study addresses barriers to physical activity counseling 2UTHealth study addresses barriers to physical activity counseling 3
... kit is for fine-tuning the bombardment conditions ... is recommended when you are first using ... includes 0.25 g each of 0.6 micrometer, ... microcarriers, 100 each of 9 rupture disks, ...
... Tecans fully automated solution for cell ... automation for cell-line maintenance, expansion, harvesting ... system built upon standard, industry proven ... handling configuration capable of both rapid ...
... is based on PI's experience in high-resolution ... a decade. PI Hexapods were originally used ... adjustments over wide ranges in small step ... freedom with 3 m minimum incremental motion ...
... sequencing is the experimental process of determining ... The automated DNA Sequencing is based on ... polymerase, which allows cycle sequencing reactions. The ... in a capillary instrument controlled by a ...
Biology Products: