Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

RNA interference is a powerful technique for gene knockdown experiments in academic research and an important tool for target identification and target validation in therapeutic research.

A growing number of different cell lines are used for gene knockdown experiments, and in many cases protocols for transfection do not exist. In order to optimize transfection conditions for a new cell line being investigated, luciferase-expressing plasmids are often cotransfected with the siRNA. However, the transfection conditions for plasmids and siRNA are quite different, as the plasmids must enter the nucleus, whereas siRNAs act in the cytoplasm therefore, these optimizations may lead to poor results. In addition, the use of fluorescently labeled siRNAs can give unpredictable results due to hydrophobic effects of fluorophore groups.

We have successfully used housekeeping genes as universal positive control genes for knockdown experiments in two different cell lines. The mRNA levels were analyzed using the LightCycler Instrument and were quantified relative to other housekeeping genes using the LightCycler h-Housekeeping Gene Sets.

Materials and Methods

Cell culture
Cells of the human adherent cell line PC3 were cultured in RPMI 1640 medium containing 10% (v/v) fetal calf serum and 2mM L-glutamine. Cells of the human adherent cell line HCT116 were cultured in McCoys 5A medium containing 10% (v/v) fetal calf serum and 2 mM L-glutamine.

Two days prior to transfection with siRNA oligonucleotides, 5x104 cells were plated in each well of 24- well plates. The siRNA (Dharmacon) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection).



siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.



Conclusion

The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.


'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:12/24/2014)... 2014 Earlier this year in a ... director of the Adult Stem Cell Technology Center, LLC ... and under appreciated unique property of adult tissue stem ... Cells: Misunderstood in the Past, Important for the Future,” ... He gave the address at the 4th World ...
(Date:12/24/2014)... 23, 2014 The report ... as its definition, classification, application and industry ... manufacturing process, and product cost structure. Production ... The analysis also covers upstream raw materials, ... development trend and proposals. In the end, ...
(Date:12/24/2014)... , Dec. 23, 2014 China ... the "Company"), a leading fully integrated plasma-based biopharmaceutical ... announced that its majority-owned subsidiary, Shandong Taibang Biological ... ("GMP") certification from the China Food and Drug ... production facility. As previously disclosed in the Company,s ...
(Date:12/24/2014)... 2014  Rock Creek Pharmaceuticals, Inc., (NASDAQ: ... Clinical Trial Application (CTA) with the United ... seeking regulatory approval to initiate clinical trials for the ... Contingent on the Company receiving CTA regulatory approval, ... to assess the safety, tolerability and dose escalation of ...
Breaking Biology Technology:Adult Stem Cell Technology Center, LLC’s Director Sherley's Address on What’s Holding Back Regenerative Medicine Featured on Omics Group Website 2Adult Stem Cell Technology Center, LLC’s Director Sherley's Address on What’s Holding Back Regenerative Medicine Featured on Omics Group Website 3Adult Stem Cell Technology Center, LLC’s Director Sherley's Address on What’s Holding Back Regenerative Medicine Featured on Omics Group Website 4Worldwide Methyl Mercaptan Market 2015-2020 Forecasts on Development & Trends Now Available at ReportsnReports.com 2China Biologic Receives GMP Certification for New Coagulation Factor Facility 2China Biologic Receives GMP Certification for New Coagulation Factor Facility 3Rock Creek Pharmaceuticals Files Clinical Trial Application in the UK for Clinical Trials of Anatabine Citrate Formulations 2Rock Creek Pharmaceuticals Files Clinical Trial Application in the UK for Clinical Trials of Anatabine Citrate Formulations 3
... stem-cell research is strong, there are pitfalls and competitors to ... position, according to UW-Madison stem cell researcher Prof. Gabriela ... with its stem-cell work, spoke this week at a luncheon ... Wisconsin Technology Council, about the current state of stem-cell technology ...
... Wis. Microsoft gave about $400,000 ... non-profit organization working with at-risk youth and their families. ... came to reception last Friday at the non-profit's Synergy ... software donation will be used to upgrade Lad Lakes ...
... Wis. — A report from the Association of ... Wisconsin Alumni Research Foundation third in the country in ... behind only the University of California System, counted as a ... ,"There are 300 different universities that have technology transfer offices, ...
Cached Biology Technology:Competition for stem cell research is fierce 2Competition for stem cell research is fierce 3UW-Madison third in nation in tech-transfer value 2
(Date:12/17/2014)... 2014 The Defense Logistics Agency is ... detect and prevent counterfeit microcircuits from entering into ... started performing an in-house microcircuit anti-counterfeit initiative dubbed ... of purchased microcircuits while increasing their reliability throughout ... will be conducted at DLA,s Electronics Product Test ...
(Date:12/17/2014)... 16, 2014  Automation is fundamentally transforming the ... than at international borders. Over the past decade, ... allowed veteran travelers to self process through border ... Kiosks at an increasing number of airports, seaports, ... According to Maxine Most , Principal ...
(Date:12/11/2014)... Dec. 10, 2014  That blood pressure plays a role ... Hypertension – the medical term for high blood pressure – ... and the inflatable cuff that,s used in measuring blood pressure ... there,s nothing new about hypertension, its triggers and its effects. ... the condition and the best ways to treat it. ...
Breaking Biology News(10 mins):Defense Logistics Agency Launches DNA Marking Capability to Strengthen Microcircuit Supply Chain 2Defense Logistics Agency Launches DNA Marking Capability to Strengthen Microcircuit Supply Chain 3Automated Border Control (ABC) Transforms the Global Travel Experience With More Than 2500 ABC eGates and APC Kiosks Deployed In Airports, Seaports, and Land Borders Worldwide 2Research points to need for new approaches to treatment of high blood pressure 2Research points to need for new approaches to treatment of high blood pressure 3Research points to need for new approaches to treatment of high blood pressure 4
... The Eli and Edythe L. Broad Institute of Harvard ... a $32.5M grant from the Boston-based Klarman Family Foundation to ... cells are wired. This grant will allow the ... are made in health and disease, paving the way for ...
... information officers can now register online to the 2012 ... meeting brings together over 10,000 scientists from all over ... planetary, and space sciences. EGU,s General Assembly is ... about recent developments in topics as diverse as shale ...
... A new study comparing the carbon-holding power of ... temperate regions are more valuable as carbon sinks than ... compared several wetlands at two Ohio wetland sites: one ... water regularly flowing through it. The study showed that ...
Cached Biology News:Broad Institute awarded $32.5 million grant to launch new 'Cell Observatory' 2Broad Institute awarded $32.5 million grant to launch new 'Cell Observatory' 3European Geosciences Union General Assembly, April 22-27, 2012, Vienna, Austria 2Scientist: Temperate freshwater wetlands are 'forgotten' carbon sinks 2Scientist: Temperate freshwater wetlands are 'forgotten' carbon sinks 3Scientist: Temperate freshwater wetlands are 'forgotten' carbon sinks 4