Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

RNA interference is a powerful technique for gene knockdown experiments in academic research and an important tool for target identification and target validation in therapeutic research.

A growing number of different cell lines are used for gene knockdown experiments, and in many cases protocols for transfection do not exist. In order to optimize transfection conditions for a new cell line being investigated, luciferase-expressing plasmids are often cotransfected with the siRNA. However, the transfection conditions for plasmids and siRNA are quite different, as the plasmids must enter the nucleus, whereas siRNAs act in the cytoplasm therefore, these optimizations may lead to poor results. In addition, the use of fluorescently labeled siRNAs can give unpredictable results due to hydrophobic effects of fluorophore groups.

We have successfully used housekeeping genes as universal positive control genes for knockdown experiments in two different cell lines. The mRNA levels were analyzed using the LightCycler Instrument and were quantified relative to other housekeeping genes using the LightCycler h-Housekeeping Gene Sets.

Materials and Methods

Cell culture
Cells of the human adherent cell line PC3 were cultured in RPMI 1640 medium containing 10% (v/v) fetal calf serum and 2mM L-glutamine. Cells of the human adherent cell line HCT116 were cultured in McCoys 5A medium containing 10% (v/v) fetal calf serum and 2 mM L-glutamine.

Two days prior to transfection with siRNA oligonucleotides, 5x104 cells were plated in each well of 24- well plates. The siRNA (Dharmacon) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection).



siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.



Conclusion

The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.


'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:7/30/2015)... 2015 HIGHLIGHTS:Q2 2015 Results (all ... , Reported sales were $697 million compared to $701 ... organically by 8%, and changes in foreign currency exchange ... by 1%. , By business unit, organic sales ... 11% in SAFC Commercial. , Reported diluted EPS ...
(Date:7/30/2015)... , ... July 30, 2015 , ... ... advanced fluid applications and designed for continuous operation up to 1500 bar. The ... ensuring safety, efficiency, and preventing toxic contamination. , The Pony™ NS2006L homogenizer is ...
(Date:7/29/2015)... , July 30, 2015 According to ... - Growth, Trends & Forecasts (2015-2020), , published by Mordor ... 30.25 billion by the end of 2020, with ... for more than 40% of the global market size. The ... a CAGR of 13.7% during the period of (2015-2020). ...
(Date:7/29/2015)... MONTREAL , July 29, 2015 /PRNewswire/ - BioAmber Inc. ... Laurin , the Company,s Chief Financial Officer has resigned.  ... former Chief Financial Officer who retired in December 2014, ... search for a permanent successor.     Andy ... Mr. Laurin and ensure a smooth transition.  Andy was ...
Breaking Biology Technology:Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 2Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 3Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 4Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 5Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 6Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 7Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 8Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 9Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 10Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 11Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 12Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 13Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 14Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 15Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 16Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 17Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 18Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 19Sigma-Aldrich (NASDAQ - SIAL) Reports Q2 2015 Sales Of $697 Million And Adjusted Diluted EPS Of $1.01 20GEA Announces the Pony™ NS2006L… a Self-contained, High Pressure Lab Homogenizer for Product Development Ensuring Maximum Efficiency and Safety 2Asia Pacific to Dominate the Global Stem Cell Market - Vericel Corporation, Ocata Therpeutics, Athersys Inc., Cryo-Cell International, Geron Corporation, StemCells, Inc. Among the Major Players 2Asia Pacific to Dominate the Global Stem Cell Market - Vericel Corporation, Ocata Therpeutics, Athersys Inc., Cryo-Cell International, Geron Corporation, StemCells, Inc. Among the Major Players 3BioAmber Announces Change in Chief Financial Officer 2BioAmber Announces Change in Chief Financial Officer 3
... PHILADELPHIA, May 28 Premier Research Group plc ... of Anthony Faragasso, MD as Executive Director and ... position, Dr. Faragasso will lead,the global Medical Management ... and safety services, Dr. Faragasso brings to ...
... ... Manufacturing Experience -, SAN DIEGO, May 28 ... Gordon H.,Busenbark to the company,s board of directors. Mr. Busenbark ... privately,held development-stage specialty pharmaceuticals company focused on,diseases of the central ...
... launch of a new collaborative website initially focusing on ... WikiProfessional technology underlying the site has been developed based ... open access journal Genome Biology, WikiProteins provides a method ... The article is written by Barend Mons of the ...
Cached Biology Technology:Premier Research Names Anthony Faragasso, MD as Executive Director and Global Head of Medical Management and Safety 2Nventa Appoints Gordon H. Busenbark to Board of Directors 2Large-scale community protein annotation -- WikiProteins 2
(Date:7/2/2015)... Research and Markets( ... "Natural Language Processing Market by Type (Rule-Based, ... & Image Recognition) - Worldwide Forecast to 2020" ... key vendors occupying the market are 3M, Apple, ... NetBase Solutions, SAS Institute Inc., Verint Systems among ...
(Date:6/30/2015)... To bolster its efforts and commitment to fighting ... the addition of two new team members. ... David Raviv will act as head of strategic ... to providing the most secure solutions for the enterprise market. ... 7 Technologies, a provider of security and management products, which ...
(Date:6/26/2015)... ATL Technology, LLC, a top provider of electromechanical contract manufacturing ... headquartered in Springville, Utah , has announced ... corporation with locations in Santa Clara, CA ... ). This acquisition will incorporate MedConx,s manufacturing facility ... existing facility in Costa Rica , resulting ...
Breaking Biology News(10 mins):Natural Language Processing Market by Type (Rule-Based, Statistical, and Hybrid), Technologies (Recognition, IVR, OCR, Pattern & Image Recognition) - Worldwide Forecast to 2020 2HYPR Corp. Expands Biometric Authentication Team with Enterprise All Stars 2HYPR Corp. Expands Biometric Authentication Team with Enterprise All Stars 3ATL Technology Announces Acquisition of MedConx, Inc. and Expanded Global Footprint 2
... North Carolina State University researcher has shown that water-gel-based ... solar cells to produce electricity. The findings prove the ... nature. They also have the potential to be less ... silicon-based solar cells. The bendable devices are composed ...
... , This release is available in Spanish ... a popular native Hawaiian fruit, has been released by U.S. ... cooperators. ,Ōhelo ( Vaccinium reticulatum Smith ) is ... found at high elevations on the islands of Maui and ...
... an effective vaccine for malaria is a step closer following ... to infect human cells. The discovery, by researchers at The ... new vaccine target through which infection with the deadly disease ... people contract malaria, and more than one million, mostly children, ...
Cached Biology News:Mimicking nature, water-based 'artificial leaf' produces electricity 2Scientists release first cultivated ohelo berry for Hawaii 2Malaria's newest pathway into human cells identified 2
Human M-CSF...
Mouse Activin RIB/ALK-4 MAb (Clone 207304)...
... tray 19 x 29 cm, 1. ... processing.Automated staining of Coomassie Blue or silver-stain ... Prepares blots for high sensitivity ECL detection ... solution, volume, and processing time.Proven design for ...
Cytidine 5'-Triphosphate, Sodium (CTP), 1 g. Category: Nucleotides & Enzymes & Biochemicals, Nucleotides, Additional Nucleotide Products....
Biology Products: