Navigation Links
Housekeeping Genes: Universal Positive,,,Controls in siRNA Knockdown Experiments

RNA interference is a powerful technique for gene knockdown experiments in academic research and an important tool for target identification and target validation in therapeutic research.

A growing number of different cell lines are used for gene knockdown experiments, and in many cases protocols for transfection do not exist. In order to optimize transfection conditions for a new cell line being investigated, luciferase-expressing plasmids are often cotransfected with the siRNA. However, the transfection conditions for plasmids and siRNA are quite different, as the plasmids must enter the nucleus, whereas siRNAs act in the cytoplasm therefore, these optimizations may lead to poor results. In addition, the use of fluorescently labeled siRNAs can give unpredictable results due to hydrophobic effects of fluorophore groups.

We have successfully used housekeeping genes as universal positive control genes for knockdown experiments in two different cell lines. The mRNA levels were analyzed using the LightCycler Instrument and were quantified relative to other housekeeping genes using the LightCycler h-Housekeeping Gene Sets.

Materials and Methods

Cell culture
Cells of the human adherent cell line PC3 were cultured in RPMI 1640 medium containing 10% (v/v) fetal calf serum and 2mM L-glutamine. Cells of the human adherent cell line HCT116 were cultured in McCoys 5A medium containing 10% (v/v) fetal calf serum and 2 mM L-glutamine.

Two days prior to transfection with siRNA oligonucleotides, 5x104 cells were plated in each well of 24- well plates. The siRNA (Dharmacon) was mixed with diluted transfection reagent as illustrated in Figures 1 and 3. The complexes were then applied to the cells in a 100 nM siRNA concentration in medium without serum (Opti-MEM), according to the manufacturers instructions. After four hours of transfection, fetal calf serum was added to 10% (v/v) final concentration.



Isolation of mRNA, synthesis of cDNA, and quantitative real-time PCR

The mRNA isolation was performed using the MagNA Pure LC Instrument. For cDNA synthesis, the 1st Strand cDNA Synthesis Kit was used, and quantitative real-time PCR was performed using the LightCycler FastStart DNA Master Hybridization Probes Kit as described in the preceding article (see pages 46).

Results

siRNA specific for the housekeeping gene hypoxanthine phosphoribosyl transferase (HPRT siRNA, sense sequence 5′CUGUCAUUAGUGAAACUGGAA, antisense sequence 5′CCAGUUUCACUAAUGACACAA) was used for a knockdown in PC3 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 1). Even when varying numbers of cells were used for mRNA purification (as can be seen in the differences in the crossing-point [CP] values of the housekeeping gene 5-aminolevulinate synthase) the knockdown can still be calculated by normalization to this gene.



A shift in the CP values of 2.77 was observed for the HPRT siRNA compared with the control luciferase siRNA. The knockdown efficiency was 85% (Figure 2). Cytotoxic side effects of the transfection ranging from 30% to 43% were detected using the Cell Proliferation Reagent WST-1 (compared with the control without transfection).



siRNA specific for the housekeeping gene glucose-6- phosphate dehydrogenase (G6PDH siRNA, sense sequence 5′AACUCCUAUGUGGCUGGCCAGUU, antisense sequence 5′CUGGCCAGCCACAUAGGAGUUUU) was used for a knockdown in HCT116 cells. The mRNA was isolated 72 hours after transfection, transcribed into cDNA and analyzed using the LightCycler Instrument (Figure 3). Different transfection reagents and concentrations were applied in transfection (Figure 4). The transfection reagent R4 (currently in developement at Roche Applied Science) was the most suitable for efficient gene knockdown with low cytotoxicity.



Conclusion

The housekeeping genes G6PDH and HPRT can be used as a positive control for gene knockdown experiments when siRNA transfection conditions have to be optimized. The LightCycler Instrument allows measurement of mRNA levels relative to the mRNA levels of housekeeping genes available in the LightCycler h-Housekeeping Gene Sets.


'"/>

Source:


Page: All 1 2 3

Related biology technology :

1. Low Abundance cDNA Cloned Using Stratagenes Human Universal cDNA Library
2. Human Universal cDNA Library Array I
3. Universal Guide to DNA Standards
4. Custom and library siRNA for efficient gene silencing
5. Custom and library siRNA for efficient gene silencing
6. Cancer siRNA Oligo Set Version 1.0
7. Library siRNA
8. Custom siRNA Oligo Synthesis Service
9. Efficient RNAi-mediated gene silencing in neuronal cells using QIAGEN siRNA and TransMessenger Transfection Reagent*
10. Quantification of siRNA Silencing Efficiency Using the LightCycler System
11. Confirming gene silencing mechanism by pGFP/GFP22 siRNA co-transfection
Post Your Comments:
(Date:3/26/2015)... WARREN, N.J., March 26, 2015  Roka Bioscience, ... company focused on providing advanced testing solutions for ... financial results for the three months and full ... Quarter 2014 Financial Results:Revenue for the quarter ended ... $689,000 for the fourth quarter of 2013 and ...
(Date:3/26/2015)... and CINCINNATI , ... plc (LSE: SHP, NASDAQ: SHPG ) and ... three-year, broad research collaboration for rare diseases. The goal ... novel therapies to treat rare diseases with high ... capabilities with Cincinnati Children,s research expertise. As a ...
(Date:3/26/2015)... Ale Gicqueau, Founder and President of ... Affairs at Align Technology, on “ Conducting Postmarket Registries ... 2015 Global Conference and Exhibition on April 25th through ... During the poster presentation, Ale Gicqueau and Victor Chen ... Postmarket Registry, the requirements and resources to conduct the ...
(Date:3/25/2015)... March 25, 2015 Optimal Research, LLC has ... Excellence (ViE) Award "Best Clinical Site or Trial Network". ... Optimal has been selected as a nominee in this ... a "Highly Recommended" distinction in 2014. The ViE awards ... efforts, accomplishments, and positive contributions of companies and individuals ...
Breaking Biology Technology:Roka Bioscience Reports Fourth Quarter and Full Year 2014 Financial Results 2Roka Bioscience Reports Fourth Quarter and Full Year 2014 Financial Results 3Roka Bioscience Reports Fourth Quarter and Full Year 2014 Financial Results 4Roka Bioscience Reports Fourth Quarter and Full Year 2014 Financial Results 5Roka Bioscience Reports Fourth Quarter and Full Year 2014 Financial Results 6Roka Bioscience Reports Fourth Quarter and Full Year 2014 Financial Results 7Shire and Cincinnati Children's Establish Rare Disease Research Collaboration 2Shire and Cincinnati Children's Establish Rare Disease Research Collaboration 3Shire and Cincinnati Children's Establish Rare Disease Research Collaboration 4Shire and Cincinnati Children's Establish Rare Disease Research Collaboration 5Clinovo Presents at ACRP 2015 in Salt Lake City, Utah on April 25th-28th 2Clinovo Presents at ACRP 2015 in Salt Lake City, Utah on April 25th-28th 3Optimal Research Nominated 2015 Vaccine Industry Excellence (ViE) Award 2
... Information Systems announced last week it has achieved ... represents the highest level of partnership and, according to ... in three specializations in addition to achieving a measurable ... IP Telephony, VPN Security and wireless LAN. , ...
... Like most states, Wisconsin has long offered specialized tax ... has lacked credit programs aimed at leveraging seed capital ... change. Act 255, a tax-credit package that passed the ... an administrative rule process this summer, will provide a ...
... , a unit of Fiserv, Inc. , ... for its clients that have licensed the Nautilus ... multiple-option service is designed to ensure that financial ... interruption, after virtually any hardware, software or operational ...
Cached Biology Technology:Inacom Information Systems achieves Cisco Systems Partner -Gold Certified status 2State investment incentives aimed at luring angels to start-up companies 2
(Date:3/3/2015)... FOREST, Calif. , March 3, 2015 ... the leading provider of advanced cryogenic logistics ... markets including immunotherapies, stem cells, cell lines, ... and reproductive medicine, today announced the expansion ... Cancer Research Centers, ("Fred Hutch") Clinical ...
(Date:3/2/2015)...  Businesses have a new option for premier ... Enterprises has announced the launch of a brand ... businesses to protect their customers, personal data, as ... Beconux is a biometric transaction processing system recently ... an ATM machine, the new system fuses multiple ...
(Date:2/25/2015)... Feb. 25, 2015  ABC Financial Services (ABC), ... the Health and Fitness Industry, today announced enhancements ... MYiCLUBonline.  The latest upgrade includes advances to the ... cardless check-in via Identity One fingerprint biometrics. The ... through interactive displays at the International Health, Racquet ...
Breaking Biology News(10 mins):Cryoport, Inc. Expands Support of Fred Hutchinson Cancer Research Center's Clinical Research Division 2Cryoport, Inc. Expands Support of Fred Hutchinson Cancer Research Center's Clinical Research Division 3Personal Data Protection Company Launches New Product 2ABC Financial Unveils New Software Enhancements 2ABC Financial Unveils New Software Enhancements 3
... release is available in German . , FRANKFURT. ... birds may serve as a magnetometer to measure the vector ... only as a magnetic compass, which shows the direction of ... neurobiologists Dr.Gerta Fleissner and her husband Prof. Dr. Gnther Fleissner ...
... Scientists seeking answers to the complex problem of premature birth ... labor, study how genetics and the environment interact to cause ... factors that make some women more likely to give birth ... of Dimes. The March of Dimes has committed ...
... expert survivors of the insect world, appear to lack major ... immune system. "It,s surprising," says Emory biologist Nicole Gerardo, ... Biology . "Aphids have some components of an immune system, ... critical to insect immunity." Pea aphids are major agricultural ...
Cached Biology News:A magnetometer in the upper beak of birds? 2A magnetometer in the upper beak of birds? 3March of Dimes provides $2.6 million in new funding for preterm birth research 2Pesky aphid thrives despite weak immune system 2
... Presenilin 2 Alzheimer's disease (AD) patients ... carry mutations in the presenilin proteins (PSEN1; ... These disease-linked mutations result in increased production ... component of amyloid deposits found in AD ...
One-step, microplate or cuvet, colorimetric, linear detection range 6 mg/dL to 100mg/dL. Procedure: 15 min....
[5,6,8,9,12,14,15(n)-3H]Prostaglandin D2, 925 kBq, 25 uCi. Methanol:water:acetonitrile (3:2:1) solution.> 3.0 TBq/mmol, > 80 Ci/mmol.3.7 MBq/ml, 100 uCi/ml. Category: Radiochemicals &Radiation Safety...
... Design with Purpose -- ... MS provide the highest level ... performance in an affordable, easy-to-use ... autosampler and workstation guarantees success ...
Biology Products: