( Eppendorf HotMaster Taq DNA polymerase....)HotMasterAn innovative Hot Start/Cold Stop technology for better ,,, PCR* results

Eppendorf HotMaster Taq DNA polymerase.

Primers and template:

Forward Primer: CTCCGGAGAAGCTCTTCCTT
Reverse Primer: CAGCTGCTTGCTGATCTCTG
Template: 0 pg-100 ng human male DNA

HotMaster Taq cycling conditions: Initial Denaturation: 94C for 2 minutes 35 cycles: 94C for 20 seconds
62C for 20 seconds
65C for 30 seconds Hold: 10C

Results and Discussion

Specificity

In order to determine the performance of the HotMaster Taq polymerase versus other Hot Start systems, we chose a set of primers that normally gives multiple nonspecific bands. When these primers were used to amplify a 131 bp fragment of the human TNF target, HotMaster Taq (Fig. 1, lanes 4-6) clearly outperformed the chemically modified Hot Start enzyme (Fig. 1, lanes 7-8) and the antibody-inhibited Hot Start enzyme (Fig. 1, lanes 10-11). Though the chemically modified Hot Start enzyme gave expected bands, the yield of the reaction is significantly lower than that of Eppendorf HotMaster. The low yield is probably caused by the partial loss of enzymatic activity during the long initial denaturation step at high temperature (95C for 10 minutes). The yield for the antibody- blocked Hot Start enzyme is comparable to that of the regular Taq polymerase. However, the nonspecific bands were produced presumably because the antibody had been denatured in the early cycles and was no longer able to provide inhibition of the polymerase at sub-optimal annealing temperatures. As
'"/>

Source:

Page: All 1 2 3 4 5 6 7
Related biology technology :

1. Amplification of genome-representative DNA from limited sources with GenomePlex WGA technology for use in genetic alterations studies