( r 72C for 5 seconds ...)HotMasterAn innovative Hot Start/Cold Stop technology for better ,,, PCR* results

r> 72C for 5 seconds Hold: 4C Antibody-blocked Taq cycling conditions: Initial Denaturation: 95C for 2 minutes 35 cycles: 94C for 1 second
55C for 1 second
72C for 5 seconds Hold: 4C
Experiment 2: Processivity

A 5.0 kb Phage Lambda target was amplified using Eppendorf HotMaster Taq DNA polymerase and Competitor A Hot Start DNA polymerase.

Primers and template:

Forward Primer: GGCAAGCATAAGCACACAGA
Reverse Primer: CAGCATAAGCGGCTACATGA
Template: 10 ng Lambda DNA

HotMaster Taq cycling conditions: Initial Denaturation: 94C for 2 minutes 35 cycles: 94C for 45 seconds
61C for 30 seconds
65C for 5 minutes Final extension: 65C for 5 minutes Hold: 10C Competitor A cycling conditions: Initial Denaturation: 95C for 10 minutes 35 cycles: 94C for 45 seconds
61C for 30 seconds
72C for 5 minutes Final extension: 72C for 5 minutes Hold: 10C
Experiment 3: Sensitivity

A 201 bp target in the human SRY gene (a single copy gene on the Y chromosome) was amplified using
'"/>

Source:

Page: All 1 2 3 4 5 6 7
Related biology technology :

1. Amplification of genome-representative DNA from limited sources with GenomePlex WGA technology for use in genetic alterations studies