HotMasterAn innovative Hot Start/Cold Stop technology for better ,,, PCR* results
ents). ... Materials and methods ...All PCR reactions were performed in triplicate on the Eppendorf Master...1x PCR buffer 2.5 mM Mg ++ 0.2 ...Note that we have determined empirically that the optimal temperature ...
ents).
Materials and methods
All PCR reactions were performed in triplicate on the Eppendorf Mastercycler
gradient using human genomic DNA or Phage Lambda DNA (New England BioLabs,
USA) as indicated. The reaction components are:
1x PCR buffer
2.5 mM Mg++
0.2 M of each primer
0.2 mM dNTP's
1.25 units respective Taq polymerase
MBGW to 50 l total reaction volume
(Templates are indicated in each experiment)
Note that we have determined empirically that the optimal temperature
for the elongation step using HotMaster is 65C.
Experiment 1: Specificity
A 131 bp target in the human TNF gene was amplified using Eppendorf HotMaster
Taq DNA polymerase, a conventional chemically modified Hot Start DNA polymerase,
an antibody- mediated Hot Start DNA polymerase and standard Taq DNA polymerase.
The following reaction conditions were used:
Primers and Template:
Primers 131 bp TNF system
Forward Primer: GGTTTCGAAGTGGTGGTCTTG
Reverse Primer: CCTGCCCCAATCCCTTTATT
Template: 50 ng human gDNA
HotMaster Taq and Standard Taq cycling conditions:
Initial Denaturation:
None
35 cycles:
94C for 1 second
55C for 1 second
72C for 5 seconds
Hold:
10C
Chemically blocked Taq cycling conditions:
Initial Denaturation:
95C for 10 minutes
35 cycles:
94C for 1 second
55C for 1 second
'"/>Source:
Page: All 1 2 3 4 5 6 7 Related biology technology :1.
Amplification of genome-representative DNA from limited sources with GenomePlex WGA technology for use in genetic alterations studies
(Date:10/15/2008)... SUNNYVALE, Calif., Oct. 15 /PRNewswire-FirstCal....S. Food & Drug Administration (FDA) categorized,C...fection (SSTI) test as,"Moderate Complexity" under...LIA). The new test is designed for on-demand detec...s (MRSA) and Staphylococcus,aureus (SA), (typicall...
(Date:10/15/2008)... DUSSELDORF, Germany, October 15 /PRNewswire-Fir...2% to EUR268.0m, - Adjusted Group Results More Th...4m to EUR16.5m, - Sales Process Started for Techn...nfirms the Outlook for 2008, Gerresheimer AG agai...rating results in the third quarter of 2008. Overa...
(Date:10/14/2008)... Recently, zinc oxide (ZnO) nanowires have drawn m...re and unique optical and piezoelectric properties... conceived, including the next generation of field...s and resonators. ZnO nanowires are also envisione...semiconducting and piezoelectric properties. , R...
(Date:10/14/2008)... - Conference Call to Discuss Results to Be H...re-FirstCall/ -- ViroPharma Incorporated,s,(Nasdaq... are expected to be,released on Wednesday, October...rkets., The company will host a conference call a... the same day. During the conference call, ViroPha...
Breaking Biology Technology:Cepheid Molecular Diagnostic Test for MRSA and S. aureus Categorized 'Moderate Complexity' by FDA 2Cepheid Molecular Diagnostic Test for MRSA and S. aureus Categorized 'Moderate Complexity' by FDA 3Cepheid Molecular Diagnostic Test for MRSA and S. aureus Categorized 'Moderate Complexity' by FDA 4Gerresheimer Substantially Increases Quarterly Operating Profit 2Gerresheimer Substantially Increases Quarterly Operating Profit 3Gerresheimer Substantially Increases Quarterly Operating Profit 4Gerresheimer Substantially Increases Quarterly Operating Profit 5Strong elasticity size effects in ZnO nanowires 2Strong elasticity size effects in ZnO nanowires 3ViroPharma to Release 2008 Third Quarter Financial Results on October 29, 2008 2...e" services can be profitable after all. Last week...that this month it would hit the elusive goal of e... a few years of hooking up business contacts for f...ces, ranging in cost from $60 to $2,000 per year. ... expectations of even the most optimistic at Linke...
... a biotechnology leader was greatly enhanced today...enza Viral Research will be established by UW-Madi...tor of University Research Park, where the researc...tute, which is designed to accelerate the pace of ... virus, and help prepare for a possible pandemic c...
...een battle now raging in the workplace. It pits in...ne side are managers who covet the traditional emp... - in return for a total commitment to playing the...ong hours in the office, grueling travel, and an o...the business requires. Only Type A,s need apply. ,...
... Inacom Information Systems was awarded Cisco Sys...ing company,s annual partner summit in San Diego, ...eless Makeover marketing campaign, which the compa...one, Dane Manufacturing, to be given an implementa... last November, and Inacom will hold a seminar in ...
Other Biology Technology:Free can be profitable 2Flu institute a booster shot for Wisconsin biotech stature 2Flu institute a booster shot for Wisconsin biotech stature 3Who will win the battle to redefine the workplace? 2Who will win the battle to redefine the workplace? 3Who will win the battle to redefine the workplace? 4Who will win the battle to redefine the workplace? 5(Date:10/15/2008)...d and how species remain separate are crucial ques...osses between different animal species are often i...r example, cannot reproduce. A sheep-goat hybrid, ...is usually stillborn. Such hybrids can also be dys...ake are a mixture of sounds from both parent speci...
(Date:10/14/2008)... for finding life on other planets and in extreme ...ate,s new astrobiology initiative under a five-yea...gnatures of Life from Earth and Beyond." , Chris...s, will lead an interdisciplinary team to develop ...biological signatures in relevant ecosystems in an...
(Date:10/14/2008)...is available in Spanish . , An interdisciplina... the Institute for Research in Biomedicine (IRB Ba...tal d,Investigaci Qumica" (ICIQ, Tarragona), have ...in protein p53 stable even when it presents certai... Giralt, head of the Chemistry and Molecular Pharm...
(Date:10/14/2008)...4, 2008Three years after Hurricane Katrina devasta...s of the destruction of the city,s floodwall syste...tomologist (Vol. 54, No. 3) suggests that Formosa...uthor Gregg Henderson, a professor at the Louisian...ubterranean termites (Coptotermes formosanus Shira...
Breaking Biology News(10 mins):Turtle doves commit adultery 2Turtle doves commit adultery 3Penn State receives new NASA astrobiology grant 2Penn State receives new NASA astrobiology grant 3Design of a compound that stabilizes the main natural suppressor of tumors 2Did termites help Katrina destroy New Orleans floodwalls? 2Jefferson radiation oncologists use real time system to plant seeds against cancer 1792 1Jefferson radiation oncologists use real time system to plant seeds against cancer 1792 2Diet and medications may assist prevention of prostate cancer 1789 1Diet and medications may assist prevention of prostate cancer 1789 2Super Bowl Champion Pro Bowler and Pittsburgh Steeler Alan Faneca to Host Sixth Annual Bid for Hope Auction 1787 1Super Bowl Champion Pro Bowler and Pittsburgh Steeler Alan Faneca to Host Sixth Annual Bid for Hope Auction 1787 2NEWSWEEK 3A Cover 3A Giving Globally 3A How to Heal the World 1785 1NEWSWEEK 3A Cover 3A Giving Globally 3A How to Heal the World 1785 2NEWSWEEK 3A Cover 3A Giving Globally 3A How to Heal the World 1785 3Mimic Sf9 Insect Cells from Invitrogen
Propidium iodide; solution (Available only in the U.S.) from Roche Applied Science
...ighSens reagents and supplies, for 10 chips, provi...m high-sensitivity RNA analysis (picogram levels) ...resis system. Supplied are 1,250 microliters RNA g...ers RNA ladder, 900 microliters RNA HighSens loadi...
Anti-NCAPD3 Monoclonal AntibodyOther Sub-Family: not assigned-Other Applications: Immunoprecipitation, Western Blot
Biology Products: