Navigation Links
Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit ,,, by Varying the Final Elution Volume

g of template were used for each condition in 30 l PCR* reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parentheess:

Taq DNA Polymerase (0.05 Units/l)
10X Taq DNA Polymerase Buffer (1X)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.
Forward:
5' GCAGCTACACAGCTACCATTCTGC 3'
Reverse:
5' GCAGCCTCACCTTCTTTCATGGAGT 3'

PCR reactions were performed on the Eppendorf Mastercycler** gradient using the following cycling conditions:

94C 5 minute initial denaturation

35 cycles:
94C 1 minute denaturation
69.6C 20 seconds annealing
72C 2 minute extension

72C final extension
15C hold

Results

Each individual/preservative combination was tested in quadruplicate; therefore, each number in Table 1 is an average of 12 different samples. Decreasing the elution volume from 200 l to 100 l increases the concentration of the gDNA by 50%, while a decrease in yield up to 25% is seen. Restriction digestion does not appear to be effected by a decrease in elution volume (Fig. 1). In addition, all samples perform equally well in PCR with no inhibition of amplification seen with the addition of higher sample volumes (Fig. 2). Based on this set of experiments, gDNA isolated in smaller elution volumes performs as well as gDNA isolated in the recommended 200 l.

'"/>

Source:


Page: All 1 2 3 4 5 6 7

Related biology technology :

1. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
2. Translate More Protein with Higher Biological Activity
3. Quantitation of Cabergoline at Extremely Low Plasma Concentrations with a Triple Quadrupole Mass Spectrometer
4. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Restriction Digests of DNA Isolated with the Perfectprep Gel Cleanup Kit
7. Eppendorf Perfectprep Gel Cleanup Kit
8. Eppendorf Perfectprep Gel Cleanup Kit
9. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
10. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
11. EppendorfPerfect gDNA Blood Mini Kit
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit Varying the Final Elution Volume

(Date:9/5/2008)...test pilots push planes to explore their limits, r...and Technology (NIST) are probing the newest micro...curacy at the nanoscale. Better nanoscale measurem...ing production in the semiconductor and nanomanufa...logy uses helium ions to generate the signal used ...
(Date:9/5/2008)...e Food & Drug Administration (FDA) issued in July ...port acknowledged that nanoscale materials potenti... by the agency and that those materials present ch...elevant to product safety and effectiveness may ch...icipating the potential for rapid commercializatio...
(Date:9/5/2008)...us, gold is only valuable if we possess it in larg...le isn,t the case for those interested in exploiti...ariety of chemical reactions, including the oxidat...s carbon dioxide at room temperatures. That proces...e effectiveness of catalytic converters that clean...
(Date:9/5/2008)...ept. 5 /- Gen-Probe Incorpo...mpany will present at the Morgan,Stanley Global He...r 9,2008 at approximately 2:45 p.m. Eastern Time....and may be accessed through a link on the investor...n-probe.com . The webcast,will be available for 30...
Breaking Biology Technology:NIST studies how new helium ion microscope measures up 2Nanotechnology and the FDA: size matters 2NIST and partners identify tiny gold clusters as top-notch catalysts 2Gen-Probe to Webcast Presentation at the Morgan Stanley Global Healthcare Unplugged Conference 2
...e amino acid sequence , , Denise L. Wyborski...orge * Peter Vaillancourt ,Stratagene Cloning Sy...ty protein expression and,purification system by...i,cloning and expression vector is designed for ...urification of expressed proteins. A ligation-inde...
...-removal step , Karen Dolter Jeff Braman ,...p kit efficiently,isolates high-quality total RN...40 mg of tissue and includes an on-column DNA-remo...processed simultaneously because of the,easy-to-...ithin microspin cups,which eliminates the need ...
...ase to genotype,mice , Evgeny Loukianov T... Research Center, University of Cincinnati, Cincin...dure to genotype mice using,long-distance PCR, w...s, and,large DNA fragments are amplified using T...e method of choice for screening transgenic mice 1...
...ated sequencing and genetic analysis , Steph...ek ,LI-COR Biotechnology Division , LI-COR and...le precast,gels for automated DNA sequencing and... for the LI-COR system are provided polymerized an... the CastAway gels with LI-CORs IR 2 ,Automated ...
Other Biology Technology:Expression and Purification of Recombinant Proteins That Have Native Amino,Acid Sequence 2Expression and Purification of Recombinant Proteins That Have Native Amino,Acid Sequence 3Expression and Purification of Recombinant Proteins That Have Native Amino,Acid Sequence 4Expression and Purification of Recombinant Proteins That Have Native Amino,Acid Sequence 5Expression and Purification of Recombinant Proteins That Have Native Amino,Acid Sequence 6Expression and Purification of Recombinant Proteins That Have Native Amino,Acid Sequence 7Expression and Purification of Recombinant Proteins That Have Native Amino,Acid Sequence 8Simple Isolation of RNA from Tissue and Cultured Cells 2Simple Isolation of RNA from Tissue and Cultured Cells 3Simple Isolation of RNA from Tissue and Cultured Cells 4Simple Isolation of RNA from Tissue and Cultured Cells 5Simple Isolation of RNA from Tissue and Cultured Cells 6Simple Isolation of RNA from Tissue and Cultured Cells 7Simple Isolation of RNA from Tissue and Cultured Cells 8Easily Amplify Genomic DNA with Long-Distance PCR 2Easily Amplify Genomic DNA with Long-Distance PCR 3Easily Amplify Genomic DNA with Long-Distance PCR 4Easily Amplify Genomic DNA with Long-Distance PCR 5Easily Amplify Genomic DNA with Long-Distance PCR 6Easily Amplify Genomic DNA with Long-Distance PCR 7CastAway Precast Gels for Rapid Automated DNA Sequence Analysis 2CastAway Precast Gels for Rapid Automated DNA Sequence Analysis 3CastAway Precast Gels for Rapid Automated DNA Sequence Analysis 4CastAway Precast Gels for Rapid Automated DNA Sequence Analysis 5
(Date:9/4/2008)...T CREEK, Calif. Subtle genetic changes that confer... the dexterity characteristic of the human hand, w...uce in a model system, have nevertheless generated... findings published online in the September 5 edit... U.S. Department of Energy,s Lawrence Berkeley Nat...
(Date:9/4/2008)... raise our water glasses and toast to America,s he... highest priorities is ensuring America has drinki...contaminants. Today, EPA announced the award of $3..., one non-profit, and one research institute to im... water contaminants; including the harmful substan...
(Date:9/4/2008)...lle, Ala. -- A team including researchers at the H...ther with colleagues from a number of other organi...of genomic variation in the brain cancer glioblast...enome Atlas (TCGA) research network, a collaborati...and the National Human Genome Research Institute o...
(Date:9/4/2008)...A KEY, Fla. The development of powerful supercomp...blink of an eye mark a technological milestone cap... medicine, engineering, and business worldwide. Re...School of Marine and Atmospheric Science, collabor...esearch), COLA (Center for Ocean-Land-Atmospheric ...
Breaking Biology News(10 mins):Thumbs up -- a tiny ancestral remnant lends developmental edge to humans 2Thumbs up -- a tiny ancestral remnant lends developmental edge to humans 3To your health: EPA announces safe drinking water research 2Collaboration between researchers yields more comprehensive portrait of brain cancer 2Petascale climate modeling heats up at University of Miami 2Petascale climate modeling heats up at University of Miami 3QED International Associates Announces Changes to the HealthShares 28TM 29 Autoimmune Inflammation and Neuroscience Indexes Correction 2469 1QED International Associates Announces Changes to the HealthShares 28TM 29 Autoimmune Inflammation and Neuroscience Indexes Correction 2469 2Antidepressants Help HIV Infected Patients Stick to Treatment 9109 1Antidepressants Help HIV Infected Patients Stick to Treatment 9109 2Contact lenses purchased over Internet may place individuals at risk for harmful eyecare practices 9107 1Contact lenses purchased over Internet may place individuals at risk for harmful eyecare practices 9107 2Contact lenses purchased over Internet may place individuals at risk for harmful eyecare practices 9107 3Cephalon to Present at the 26th Annual JP Morgan Healthcare Conference 9105 1Cephalon to Present at the 26th Annual JP Morgan Healthcare Conference 9105 2
...hers open the way for improved study of hepatitis ...hat allows replication of patient-isolated virus i...dapted virus strains in transformed cell lines. T...rus replication in transfected and serum-infected ...February issue of The American Journal of Patholog...
...hnology, the size of a mobile phone, which could s...d by scientists from The University of Nottingham.... potential danger. It is small and easy to use so ...eir baby’s heart beat without having to go into ho...nology allows them to do this. , It took 15 years ...
...of Canadian researchers, lead by Dr. Susan George ...nd Mental health (CAMH), discovered a distinct dop...f two different types of dopamine receptors, this ...tanding and treating schizophrenia. , Published in...es USA (Rashid et al., 2007), this important disco...
...tudy, led by Felix Aigner, M.D., has identified a ...y responsible for regulating the body,s inflammato...ajor complications involved with many transplantat...during and immediately following surgery, known as...lammatory cells infiltrate the donated heart, whic...
Other Biology News:New culture method for hepatitis C virus uses primary hepatocytes and patient serum 2A revolution in the monitoring of unborn babies 2A revolution in the monitoring of unborn babies 3New dopamine brain target discovered 2
Porcine IFN-gamma ELISpot Development Module
RECOMBINANT EQUINE TNF ALPHA Product Type: Recombinant Protein
TEMPLIPHI HT SEQ AMPL KIT, 1 EA. Category: Sequencing Template Amplification.
...nt Apoptosis Assay Kit #4 detects apoptosis on th...of cell membranes. This kit contains ready-to-use ...cleic acid stains. YO-PRO-1 stain selectively pass... and labels them with moderate green fluorescence....
Biology Products: