Navigation Links
Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit ,,, by Varying the Final Elution Volume

g of template were used for each condition in 30 l PCR* reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parentheess:

Taq DNA Polymerase (0.05 Units/l)
10X Taq DNA Polymerase Buffer (1X)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.
Forward:
5' GCAGCTACACAGCTACCATTCTGC 3'
Reverse:
5' GCAGCCTCACCTTCTTTCATGGAGT 3'

PCR reactions were performed on the Eppendorf Mastercycler** gradient using the following cycling conditions:

94C 5 minute initial denaturation

35 cycles:
94C 1 minute denaturation
69.6C 20 seconds annealing
72C 2 minute extension

72C final extension
15C hold

Results

Each individual/preservative combination was tested in quadruplicate; therefore, each number in Table 1 is an average of 12 different samples. Decreasing the elution volume from 200 l to 100 l increases the concentration of the gDNA by 50%, while a decrease in yield up to 25% is seen. Restriction digestion does not appear to be effected by a decrease in elution volume (Fig. 1). In addition, all samples perform equally well in PCR with no inhibition of amplification seen with the addition of higher sample volumes (Fig. 2). Based on this set of experiments, gDNA isolated in smaller elution volumes performs as well as gDNA isolated in the recommended 200 l.

'"/>

Source:


Page: All 1 2 3 4 5 6 7

Related biology technology :

1. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
2. Translate More Protein with Higher Biological Activity
3. Quantitation of Cabergoline at Extremely Low Plasma Concentrations with a Triple Quadrupole Mass Spectrometer
4. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Restriction Digests of DNA Isolated with the Perfectprep Gel Cleanup Kit
7. Eppendorf Perfectprep Gel Cleanup Kit
8. Eppendorf Perfectprep Gel Cleanup Kit
9. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
10. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
11. EppendorfPerfect gDNA Blood Mini Kit
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit Varying the Final Elution Volume

(Date:12/16/2009)... Calif., Dec. 16 WaferGen Biosystems, Inc. ... state-of-the-art genetic analysis systems, today announced that it ... its innovative service for gene-expression profiling using its ... Panel provides the most comprehensive human microRNA panel ... The company,s SmartChip service offers customers the use ...
(Date:12/16/2009)... Mass., Dec. 16 Decision Resources, one ... for pharmaceutical and healthcare issues, finds that, according ... Stelara and Abbott,s briakinumab (both interleukin inhibitors) will ... 2012 in the drug market for moderate to ... experience greater uptake, capturing nearly three times as ...
(Date:12/16/2009)... December 16 Eppendorf has initiated ... Verigene(R) SP systems for,infringement of European patent ... for the,identification and/or the quantification of a ... all imports of the respective products into ... are required to confiscate any,violating products. , ...
(Date:12/15/2009)... Repligen Corporation (Nasdaq: RGEN ) ... in research funding to support the ongoing development ... Muscular Dystrophy Association (MDA). This grant will ... and GMP manufacture of a drug candidate for ... not only provides important funding for Repligen,s research ...
Breaking Biology Technology:WaferGen to Launch Human MicroRNA Panel for Gene-Expression Profiling of 885 MicroRNA for Its Service Using the SmartChip(TM) Real-Time PCR System 2WaferGen to Launch Human MicroRNA Panel for Gene-Expression Profiling of 885 MicroRNA for Its Service Using the SmartChip(TM) Real-Time PCR System 3WaferGen to Launch Human MicroRNA Panel for Gene-Expression Profiling of 885 MicroRNA for Its Service Using the SmartChip(TM) Real-Time PCR System 4In 2012, Stelara and Briakinumab Will Capture 22 Percent of the Biologics Share in the Moderate to Severe Psoriasis Drug Market 2In 2012, Stelara and Briakinumab Will Capture 22 Percent of the Biologics Share in the Moderate to Severe Psoriasis Drug Market 3Eppendorf Successfully Initiates Import ban Against Nanosphere, Inc. for the Countries of the European Union 2Repligen Receives Second Research Grant from the Muscular Dystrophy Association to Support Friedreich's Ataxia Preclinical Development Program 2Repligen Receives Second Research Grant from the Muscular Dystrophy Association to Support Friedreich's Ataxia Preclinical Development Program 3
... acquisition to augment Quintiles Consulting offerings, ... Quintiles,Transnational Corp. today announced that it has ... held decision-analytics and market research,consulting firm located ... Quintiles,Consulting business., The acquisition of Eidetics ...
... of VWR International, LLC, a leading global laboratory supply,company, will hold a conference ... Who: John M. Ballbach, Chairman, President and CEO ... Chief Financial Officer, ... 9:00 a.m. Eastern Time (ET), How: ...
... patients with ... samples provided by Pfizer., ... availability of its patented second generation molecular,SensiTrop(TM) II assay, ... with the specificity of molecular,sequencing for determining the co-receptor ...
Other Biology Technology:Quintiles Signs Agreement to Acquire Eidetics 2VWR Funding, Inc. to Hold First Quarter 2008 Financial Results Conference Call 2Pathway Diagnostics Announces Commercial Availability of Second Generation SensiTrop(TM) II Molecular HIV Co-receptor Tropism Assay 2
(Date:12/16/2009)... GestureTek Inc. today announced the launch of ... portable, plug and play interactive projection display ... promotions. GestureTek is the inventor and holder ... recognition technology for interactive display, presentation and ... CUBE has TUV, CE, CSA and EMI ...
(Date:12/16/2009)... Dec. 3 BIO-key International, Inc. ... wireless public safety and finger-based biometric identification ... shareholders at a Special Shareholder Meeting held ... Law Enforcement Division to Interact911 Mobile Systems ... cast in favor and 1.2% were opposed. ...
(Date:12/16/2009)... BIO-key International, Inc. (OTC Bulletin Board: BKYI), ... today announced that SC Magazine, one of ... BIO-key International the 2009 Innovator of the ... ,, (Logo: http://www.newscom.com/cgi-bin/prnh/20050509/BIOKEYLOGO ) ,, ... Magazine, "Biometric providers have been trying for ...
Breaking Biology News(10 mins):GestureTek Unveils The CUBE V3 Portable, Plug and Play Interactive Projection Display System for Advertising and Exhibits 2GestureTek Unveils The CUBE V3 Portable, Plug and Play Interactive Projection Display System for Advertising and Exhibits 3BIO-key(R) Shareholders Overwhelmingly Approve Sale of Law Enforcement Division 2BIO-key(R) Shareholders Overwhelmingly Approve Sale of Law Enforcement Division 3BIO-key(R) Selected as 2009 Industry Innovator in Biometrics by SC Magazine 2BIO-key(R) Selected as 2009 Industry Innovator in Biometrics by SC Magazine 3Researchers develop new more sensitive assay for detecting DNA methylation in colon cancer 9586 1Researchers develop new more sensitive assay for detecting DNA methylation in colon cancer 9586 2Researchers develop new more sensitive assay for detecting DNA methylation in colon cancer 9586 3New study expands the list of hazardous chemicals in smokeless tobacco 54592 1New study expands the list of hazardous chemicals in smokeless tobacco 54592 2Summer heat increases risk of amniotic fluid level deficiency Ben Gurion University study reveals 54590 1Summer heat increases risk of amniotic fluid level deficiency Ben Gurion University study reveals 54590 2
... The University of Florida, keeper of the world,s shark attack ... another toothy marine predator: the sawfish. , Distinguished by a ... item and gives it its name, the sawfish has become ... George Burgess, a UF ichthyologist and curator of both the ...
... December Geosphere , The Geological Society of America,s ... from multiple fields, including tectonics, oceanography, sedimentology, and paleontology, ... ago to 6 million years ago; sedimentation in a ... Range, Nevada; and a study of the South Balkan ...
... RIVERSIDE, Calif. For their landmark research leading to ... in flood-prone areas worldwide, Julia Bailey-Serres of ... and David Mackill of the International Rice ... the U.S. Department of Agriculture (USDA) with the 2008 ...
Other Biology News:Endangered sawfish focus of national collection and recovery efforts 2December Geosphere media highlights 2December Geosphere media highlights 3UC Riverside rice geneticist receives high honor from US Department of Agriculture 2UC Riverside rice geneticist receives high honor from US Department of Agriculture 3
...
... a tradition of progressive centrifuge design and ... The Centra-CL3 and Centra-CL3R (refrigerated) general purpose ... Quality Control Over Sample Preparation , ... up to 99 protocols and has speed ...
PP2B-Abeta (C-20)...
... PGE2 is one of several isoprostanes produced from ... potent renal vasoconstrictor in the rat. 8-iso PGE2 ... values of 0.5 and 5 µM, respectively. When ... at a concentration of 4 mg/kg/min, 8-iso PGE2 ...
Biology Products: