Navigation Links
Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit ,,, by Varying the Final Elution Volume

Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit
by Varying the Final Elution Volume

Laura Pollock and Jennifer Halcomez
Eppendorf 5 Prime, Boulder, Colorado Introduction

The Eppendorf Perfect gDNA Blood Mini Kit protocol recommends an elution volume of 200 l for maximum total yield in standard application. In some instances, the concentration of the resulting gDNA may be more important than the total yield. Elution volumes of 50 l, 100 l, and 200 l were tested to determine the increase in concentration, as well as the potential effects on downstream applications. The kit was tested with blood from three different individuals using three different preservatives.

Materials

  • Perfect gDNA Blood Mini Kit
Required but not supplied:
  • Ethanol (95%100%); aerosol barrier pipette tips recommended; Microcentrifuge; Eppendorf Thermomixer, water bath, or heat block at 70C
Method

Isolation of gDNA:
  1. Pipette 20 l reconstituted Proteinase K into a 1.5 ml microcentrifuge tube. Add 200 l whole blood to the tube. Add 350 l Solution G1 to the tube containing Proteinase K and blood. Mix by vortexing for 5 seconds.
  2. Incubate in a Thermomixer at 70C, 900 rpm, for 10 minutes.
  3. Centrifuge the sample for 3 minutes at 12,000 to 16,000 x g (top speed in most microcentrifuges) to pellet cell debris. Pour the supernatant into a fresh microcentrifuge tube.
  4. Add 200 l Solution G2 to the tube containing the supernatant. Vortex the sample for 5 seconds. Place a spin column in a fresh microcentrifuge tube. Transfer the sample to the spin column assembly. Incubate the sample at room temperature for 1 minute.
  5. Centrifuge the sample for 2 minutes at 12,000 to 16,000 x g. Remove the spin column and decant flowthrough. Place the spin column back into the same tube.
  6. Add 600 l Diluted Wash Buffer to the spin column. Centrifuge for 1 minute at 12,000 to 16,000 x g. Remove the spin column and decant flowthrough. Place the spin column back into the same tube.
  7. Add 400 l Diluted Wash Buffer to the spin column. Centrifuge for 3 minutes at 12,000 to 16,000 x g. Carefully remove the spin column without splashing the Wash Buffer onto the bottom of the column. Place the spin column into a fresh microcentrifuge tube.
  8. Add 50l to 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,000 to 16,000 x g to elute gDNA. Store purified gDNA at 4C.
Restriction digests
With a decrease in elution volume, an increase in concentration of contaminants may be expected. Restriction digests were performed to test the purity of the DNA when eluting in smaller volumes. 200 ng of sample was incubated with 2 and 5 units of Sau3AI (New England Bio-labs) and without enzyme at 37C.

PCR
gDNA was isolated from whole blood preserved in EDTA of three individuals. DNA was eluted in 50 l, 100 l, and 200 l for each individual. 50 ng and 200 n g of template were used for each condition in 30 l PCR* reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parentheess:

Taq DNA Polymerase (0.05 Units/l)
10X Taq DNA Polymerase Buffer (1X)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.3 M.
Forward:
5' GCAGCTACACAGCTACCATTCTGC 3'
Reverse:
5' GCAGCCTCACCTTCTTTCATGGAGT 3'

PCR reactions were performed on the Eppendorf Mastercycler** gradient using the following cycling conditions:

94C 5 minute initial denaturation

35 cycles:
94C 1 minute denaturation
69.6C 20 seconds annealing
72C 2 minute extension

72C final extension
15C hold

Results

Each individual/preservative combination was tested in quadruplicate; therefore, each number in Table 1 is an average of 12 different samples. Decreasing the elution volume from 200 l to 100 l increases the concentration of the gDNA by 50%, while a decrease in yield up to 25% is seen. Restriction digestion does not appear to be effected by a decrease in elution volume (Fig. 1). In addition, all samples perform equally well in PCR with no inhibition of amplification seen with the addition of higher sample volumes (Fig. 2). Based on this set of experiments, gDNA isolated in smaller elution volumes performs as well as gDNA isolated in the recommended 200 l.

Elution volume Preservative Average A260280 Average concentration
(g/ml)
Average Total Yield
(g)
50 l EDTA 1.64 72.33 2.99
100 l 1.68 52.08 4.75
200 l 1.70 30.18 5.84
50 l Sodium Heparin 1.51 79.00 2.89
100 l 1.61 50.62 4.72
200 l 1.67 33.25 6.33
50 l Sodium Citrate 1.57 72.40 2.81
100 l 1.63 41.07 3.74
200 l 1.68 26.97 5.13
Table 1: Yield and purity data comparing different elution volumes and preservatives

Fig.1: Restriction Digests of gDNA isolated using the Perfect gDNA Blood Mini Kit with varying elution volumes

Lanes 1 and 23: Lambda Hind III Marker (NEB)
Lanes 210: 50 l elution/EDTA preservative
Triplicate samples
Uncut, 2 Units, 5 Units enzyme, respectively
Lanes 1119: 100 l/EDTA preservative
Triplicate samples
Uncut, 2 Units, 5 Units enzyme, respectively
Lanes 2022: 200 l/EDTA preservative
Uncut, 2 Units, 5 Units enzyme, respectively
Fig. 2: PCR of gDNA isolated using the Perfect gDNA Blood Mini Kit with varying elution volumes

Lane 1: Lambda Hind III Marker (NEB) Lanes 27: 50 l elution volume
50 and 200 ng template, respectively Lanes 813: 100 l elution volume
50 and 200 ng template, respectively Lanes 1419: 200 l elution volume
50 and 200 ng template, respectively Discussion

Reduction of elution volume proves to be an effective method of increasing the concentration of the isolated DNA while maintaining purity. The versatility of the Perfect gDNA Blood Mini Kit allows the researcher to make the choice between higher yields or more concentrated DNA based on the downstream application requirements. As expected, there is a significant increase in concentration with the smaller elution volumes, although some yield is sacrificed. In all cases sufficient gDNA is purified to complete the downst ream applications.

* Practice of the patented polymerase chain reaction (PCR) process requires a license.
** The Eppendorf Thermal Cycler is an Authorized Thermal Cycler and may be used with PCR licenses available from Applied Biosystems. Its use with Authorized Reagents also provides a limited PCR license in accordance with the label rights accompanying such reagents.
Mastercycler gradient (U.S. Pat. 6,210,958)



'"/>

Source:


Page: All 1 2 3 4 5 6 7

Related biology technology :

1. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
2. Translate More Protein with Higher Biological Activity
3. Quantitation of Cabergoline at Extremely Low Plasma Concentrations with a Triple Quadrupole Mass Spectrometer
4. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Restriction Digests of DNA Isolated with the Perfectprep Gel Cleanup Kit
7. Eppendorf Perfectprep Gel Cleanup Kit
8. Eppendorf Perfectprep Gel Cleanup Kit
9. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
10. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
11. EppendorfPerfect gDNA Blood Mini Kit
Post Your Comments:
*Name:
*Comment:
*Email:


(Date:4/27/2016)... Boston (PRWEB) , ... April 27, 2016 , ... ... driven by semantic web technology, today announced that it has been named to The ... life sciences, financial services and other markets, Cambridge Semantics serves the needs of end ...
(Date:4/27/2016)... and RESEARCH TRIANGLE PARK, N.C. ... (NASDAQ: UTHR ) announced today that ... of United Therapeutics will provide an overview and update ... st Annual Health Care Conference. The ... at 10:00 a.m. Eastern Time, and can be accessed ...
(Date:4/27/2016)... ... April 27, 2016 , ... Global Stem Cells ... Advisory Board. Ross is the founder of GSCG affiliate Kimera Labs in Miami. , ... he studied hematopoietic stem cell transplantation for hematologic disorders and the suppression of graft ...
(Date:4/26/2016)... , ... April 26, 2016 , ... ... announced that Ardy Arianpour has joined the company as Chief Business Officer. Arianpour, ... bringing innovative genomic technologies to market, was most recently Chief Commercial Officer of ...
Breaking Biology Technology:
(Date:4/13/2016)... CHICAGO , April 13, 2016  IMPOWER physicians ... are setting a new clinical standard in telehealth ... By leveraging the higi platform, IMPOWER patients can ... weight, pulse and body mass index, and, when they ... quick and convenient visit to a local retail location ...
(Date:3/29/2016)... 29, 2016 LegacyXChange, Inc. (OTC: ... and SelectaDNA/CSI Protect are pleased to announce our successful ... a variety of writing instruments, ensuring athletes signatures against ... collectibles from athletes on LegacyXChange will be assured of ... DNA. Bill Bollander , CEO states, ...
(Date:3/22/2016)... PROVO and SANDY, Utah ... Ontario (NSO), which operates the highest sample volume laboratory ... and Tute Genomics and UNIConnect, leaders in clinical sequencing ... announced the launch of a project to establish the ... panel. NSO has been contracted by ...
Breaking Biology News(10 mins):