| HOME >> BIOLOGY >> TECHNOLOGY |
Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit
by Varying the Final Elution Volume
Laura Pollock and Jennifer Halcomez Eppendorf 5 Prime, Boulder, Colorado Introduction
The Eppendorf Perfect gDNA Blood Mini Kit protocol recommends an elution volume of 200 l for maximum total yield in standard application. In some instances, the concentration of the resulting gDNA may be more important than the total yield. Elution volumes of 50 l, 100 l, and 200 l were tested to determine the increase in concentration, as well as the potential effects on downstream applications. The kit was tested with blood from three different individuals using three different preservatives.
Materials
- Perfect gDNA Blood Mini Kit
- Ethanol (95%100%); aerosol barrier pipette tips recommended; Microcentrifuge; Eppendorf Thermomixer, water bath, or heat block at 70C
Isolation of gDNA:
- Pipette 20 l reconstituted Proteinase K into a 1.5 ml microcentrifuge tube. Add 200 l whole blood to the tube. Add 350 l Solution G1 to the tube containing Proteinase K and blood. Mix by vortexing for 5 seconds.
- Incubate in a Thermomixer at 70C, 900 rpm, for 10 minutes.
- Centrifuge the sample for 3 minutes at 12,000 to 16,000 x g (top speed
in most microcentrifuges) to pellet cell debris. Pour the supernatant
into a fresh microcentrifuge tube.
- Add 200 l Solution G2 to the tube containing the supernatant.
Vortex the sample for 5 seconds. Place a spin column in a fresh microcentrifuge
tube. Transfer the sample to the spin column assembly. Incubate the
sample at room temperature for 1 minute.
- Centrifuge the sample for 2 minutes at 12,000 to 16,000 x g. Remove the spin column and decant flowthrough. Place the spin column back into the same tube.
- Add 600 l Diluted Wash Buffer to the spin column. Centrifuge for 1 minute at 12,000 to 16,000 x g. Remove the spin column and decant flowthrough. Place the spin column back into the same tube.
- Add 400 l Diluted Wash Buffer to the spin column. Centrifuge for 3 minutes at 12,000 to 16,000 x g. Carefully remove the spin column without splashing the Wash Buffer onto the bottom of the column. Place the spin column into a fresh microcentrifuge tube.
- Add 50l to 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,000 to 16,000 x g to elute gDNA. Store purified gDNA at 4C.
With a decrease in elution volume, an increase in concentration of contaminants may be expected. Restriction digests were performed to test the purity of the DNA when eluting in smaller volumes. 200 ng of sample was incubated with 2 and 5 units of Sau3AI (New England Bio-labs) and without enzyme at 37C.
PCR
gDNA was isolated from whole blood preserved in EDTA of three individuals.
DNA was eluted in 50 l, 100 l, and 200 l for each
individual. 50 ng and 200 ng of template were used for each condition
in 30 l PCR* reactions. The following Eppendorf PCR reagents were
used in the concentrations or amounts specified in parentheess:
Taq DNA Polymerase (0.05 Units/l)
10X Taq DNA Polymerase Buffer (1X)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)
Primers (Integrated DNA Technologies) specific to the human beta-globin
gene were used for all reactions at a final concentration of 0.3 M.
Forward:
5' GCAGCTACACAGCTACCATTCTGC 3'
Reverse:
5' GCAGCCTCACCTTCTTTCATGGAGT 3'
PCR reactions were performed on the Eppendorf Mastercycler** gradient using the following cycling conditions:
94C 5 minute initial denaturation
35 cycles:
94C 1 minute denaturation
69.6C 20 seconds annealing
72C 2 minute extension
72C final extension
15C hold
Results
Each individual/preservative combination was tested in quadruplicate; therefore, each number in Table 1 is an average of 12 different samples. Decreasing the elution volume from 200 l to 100 l increases the concentration of the gDNA by 50%, while a decrease in yield up to 25% is seen. Restriction digestion does not appear to be effected by a decrease in elution volume (Fig. 1). In addition, all samples perform equally well in PCR with no inhibition of amplification seen with the addition of higher sample volumes (Fig. 2). Based on this set of experiments, gDNA isolated in smaller elution volumes performs as well as gDNA isolated in the recommended 200 l.
| Elution volume | Preservative | Average A260280 | Average concentration (g/ml) |
Average Total Yield (g) |
| 50 l | EDTA | 1.64 | 72.33 | 2.99 |
| 100 l | 1.68 | 52.08 | 4.75 | |
| 200 l | 1.70 | 30.18 | 5.84 | |
| 50 l | Sodium Heparin | 1.51 | 79.00 | 2.89 |
| 100 l | 1.61 | 50.62 | 4.72 | |
| 200 l | 1.67 | 33.25 | 6.33 | |
| 50 l | Sodium Citrate | 1.57 | 72.40 | 2.81 |
| 100 l | 1.63 | 41.07 | 3.74 | |
| 200 l | 1.68 | 26.97 | 5.13 |
| Lanes 1 and 23: | Lambda Hind III Marker (NEB) |
| Lanes 210: | 50 l elution/EDTA preservative Triplicate samples Uncut, 2 Units, 5 Units enzyme, respectively |
| Lanes 1119: | 100 l/EDTA preservative Triplicate samples Uncut, 2 Units, 5 Units enzyme, respectively |
| Lanes 2022: | 200 l/EDTA preservative Uncut, 2 Units, 5 Units enzyme, respectively |
Lane 1: Lambda Hind III Marker (NEB) Lanes 27: 50 l elution volume
50 and 200 ng template, respectively Lanes 813: 100 l elution volume
50 and 200 ng template, respectively Lanes 1419: 200 l elution volume
50 and 200 ng template, respectively Discussion
Reduction of elution volume proves to be an effective method of increasing the concentration of the isolated DNA while maintaining purity. The versatility of the Perfect gDNA Blood Mini Kit allows the researcher to make the choice between higher yields or more concentrated DNA based on the downstream application requirements. As expected, there is a significant increase in concentration with the smaller elution volumes, although some yield is sacrificed. In all cases sufficient gDNA is purified to complete the downstream applications.
* Practice of the patented polymerase chain reaction (PCR) process requires
a license.
** The Eppendorf Thermal Cycler is an Authorized Thermal Cycler and may
be used with PCR licenses available from Applied Biosystems. Its use with
Authorized Reagents also provides a limited PCR license in accordance
with the label rights accompanying such reagents.
Mastercycler gradient (U.S. Pat. 6,210,958)
'"/>
Source:
Related biology technology :
1. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
2. Translate More Protein with Higher Biological Activity
3. Quantitation of Cabergoline at Extremely Low Plasma Concentrations with a Triple Quadrupole Mass Spectrometer
4. Optimizing pfuturbo DNA Polymerase Amplification Reactions with Perfect Match PCR Enhancer
5. Comparison of Growth Techniques and Media for the Purpose of Plasmid Isolation from E. coli Using the Eppendorf Perfectprep Plasmid Mini Kit
6. Restriction Digests of DNA Isolated with the Perfectprep Gel Cleanup Kit
7. Eppendorf Perfectprep Gel Cleanup Kit
8. Eppendorf Perfectprep Gel Cleanup Kit
9. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
10. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
11. EppendorfPerfect gDNA Blood Mini Kit
| Copyright © 2003-2012 Bio-Medicine. All rights reserved. ABOUT | CONTACT US | DISCLAIMER | PRIVACY POLICY | TERMS AND CONDITIONS |  |