Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit ( DNA was isolated from the buffy coat of...)

Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:

Page: All 1 2 3 4 5 6 7 8
Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)

Post Your Comments:

(Date:12/15/2009)... Reportlinker.com announces that a new market research ... The Future of Orphan Diseases ... Analysis and Reimbursement ,, ... Summary ,, The author has released ... Diseases Therapeutics - Market Forecasts to 2015, ...

(Date:12/15/2009)... Minn., Dec. 15 The Mosaic Company (NYSE: ... fiscal year 2010 earnings results and financial tables on ... on the New York Stock Exchange. Results will ... ,, The Company will host a conference call with ... the results. The call will begin at 11:00 ...

(Date:12/15/2009)... PHILADELPHIA and LONDON, Dec. 15 ... Thomson Pharma ® has become the first ... trial protocol and outcome information. This highly anticipated ... Pharma customers this month. ,, ... trial intelligence from registries, publications, press releases, conferences, ...

(Date:12/14/2009)... -- Vermillion, Inc. (Pink Sheets: VRML), a ... Wallen, Ph.D. Chief Scientific Officer, Senior Vice ... will be joining its board of directors ... ,, "Bill brings more than 20 years ... biotechnology," said Gail Page, Vermillion Executive Chairperson. ...

[0] Reportlinker Adds The Future of Orphan Diseases Therapeutics - Market Forecasts to 2015, Pipeline Analysis and Reimbursement [0] Mosaic Announces Second Quarter Fiscal Year 2010 Earnings Release and Conference Call [0] Thomson Reuters is First to Offer Fully Integrated Pipeline and Clinical Trials [0] Vermillion Announces Appointment of William C. Wallen, Ph.D. to Board of Directors

... BEDMINSTER, N.J., Feb. 29 NPS,Pharmaceuticals, Inc. (Nasdaq: ... executive vice president, chief operating officer, and chief,executive ... Brothers,Eleventh Annual Global Healthcare Conference in Miami on ... presentation will be available as a live,webcast with ...

... Kendle (Nasdaq: KNDL ), a,leading, ... Vice President and Chief Marketing Officer Simon,Higginbotham ... James,Institutional Investors Conference. The conference will be ... Orlando, March 2-5, 2008. Kendle,s,presentation is scheduled ...

... Tests Based on Company,s microRNA ... Technology on Schedule for 2008, REHOVOT, Israel and ... ROSG ), a leading,molecular diagnostics company, today reported a narrower operating ... corresponding,period of 2006, and said it remains solidly on target for ...

NPS Pharmaceuticals to Present at the Lehman Brothers Eleventh Annual Global Healthcare Conference Kendle to Present at the 29th Annual Raymond James Institutional Investors Conference Rosetta Genomics Reports Fourth-Quarter and Full-Year 2007 Financial Results

(Date:12/16/2009)... Tom Bowman, an expert in communicating scientific issues ... has developed a series of graphics that translate key ... (IPCC) report for public audiences. These new graphics provide ... to make informed decisions about climate change risks and ... means to clearly and accurately communicate findings in the ...

(Date:12/16/2009)... Dec. 2 DigitalPersona, Inc., a ... today announced an agreement with IBM to ... biometric fingerprint technology on IBM SurePOS 500 ... allows point-of-sale applications to more easily and ... can be linked to the individuals who ...

(Date:12/16/2009)... 2009 National Instruments (Nasdaq: ... and control, and DENSO Robotics, a leader ... technology, today announced their collaboration to integrate ... robotic arms. The collaboration increases productivity and ... manufacturing applications. In today,s trend toward high-mix, ...

Breaking Biology News(10 mins):Bowman creates graphic translation of climate change data 2 DigitalPersona Fingerprint Sensor Technology Ships on IBM SurePOS 500 Retail Systems 2 National Instruments and DENSO Robotics Collaborate to Address New Applications in Industrial Robotics 2 National Instruments and DENSO Robotics Collaborate to Address New Applications in Industrial Robotics 3 National Instruments and DENSO Robotics Collaborate to Address New Applications in Industrial Robotics 4 National Instruments and DENSO Robotics Collaborate to Address New Applications in Industrial Robotics 5 Arena Pharmaceuticals Announces the Presentation of Lorcaserin Phase 3 BLOOM Data at the American Diabetes Associations 69th Scientific Sessions 4509 1 Arena Pharmaceuticals Announces the Presentation of Lorcaserin Phase 3 BLOOM Data at the American Diabetes Associations 69th Scientific Sessions 4509 2 Arena Pharmaceuticals Announces the Presentation of Lorcaserin Phase 3 BLOOM Data at the American Diabetes Associations 69th Scientific Sessions 4509 3 Streamwood Hospital Opens New Childrens Center to Meet Vital Community Need 47557 1 Streamwood Hospital Opens New Childrens Center to Meet Vital Community Need 47557 2 Go Red For Women 28R 29 Launches 12 Week Program to Improve Heart Health and Save Lives 47553 1 Go Red For Women 28R 29 Launches 12 Week Program to Improve Heart Health and Save Lives 47553 2 Go Red For Women 28R 29 Launches 12 Week Program to Improve Heart Health and Save Lives 47553 3

[0] Bowman creates graphic translation of climate change data [0] DigitalPersona Fingerprint Sensor Technology Ships on IBM SurePOS 500 Retail Systems [0] National Instruments and DENSO Robotics Collaborate to Address New Applications in Industrial Robotics

... cancer survivors might one day avoid the prospect of ... that would involve using stem cells derived from their ... studying the potential these cells may have for regenerating ... researchers hope to prove that an injection of fat-derived ...

... response to higher global temperatures may be somewhat overstated ... to adjust to changing conditions, according to researchers from ... published April 28 by Science, a team led by ... percent more carbon will be stored in plants and ...

... A jumping gene first identified in a cabbage-eating moth may ... gene therapy, researchers say. , , They compared the ... insert themselves into a cell's DNA and produce a desired ... radiation therapy. , They found the piggyBac transposon was five ...

Other Biology News:Fat stem cells being studied as option for breast reconstruction 2 Plants' role in global warming re-examined 2 Jumping gene could provide non-viral alternative for gene therapy 2 Jumping gene could provide non-viral alternative for gene therapy 3

Fat stem cells being studied as option for breast reconstruction Plants' role in global warming re-examined Jumping gene could provide non-viral alternative for gene therapy

Request Info...

... ,ICC and IHC Protocol Development ,Antibody ... Screenings in Animal or Human Cells ... Cells and Tissues ,Peroxidase, Alkaline Phosphatase, ... or Electron Microscopy ,Protein Localization in ...

Biology Products:

Morphine ELISA Kit, Single from Bio-Quant Inc.PCP ELISA Kit, Single from Bio-Quant Inc.Cotinine ELISA Kit, Single from Bio-Quant Inc.Immunodetection of Specific Proteins from QualTek Molecular Laboratories

( DNA was isolated from the buffy coat of...)Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit