Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:8/20/2014)... Clintrax Global, Inc., a worldwide provider ... Raleigh, NC , recently announced the addition ... of Administration. As Vice President ... including their alignment with company objectives and policies.  ... an HR executive, specializing in needs assessments, customer ...
(Date:8/20/2014)... 2014 Neurotrope, Inc. (OTCQB: NTRP) today ... to provide an update on Company activities. Access ... numbers:(888) 505-4369 (U.S. and Canada) or (719) 325-2315 ... , under "Investor Relations"The teleconference replay will be ... 2, 2014 at (888) 203-1112 (U.S. and ...
(Date:8/20/2014)... 20, 2014 The 6th Annual ... held on October 29-30 in San Francisco, CA. This ... and government researchers and clinicians focused on addressing and ... , In the twelve years since the sequencing of ... been introduced with pharmacogenetic information in the label and ...
(Date:8/20/2014)... August 20, 2014 WriteResult®, a leading ... that it has expanded its myPROpad™ ePRO tablet with ... one of the most widely used and well-respected ... health status. The EQ-5D is used during clinical trials ... measure that can be used to demonstrate Health-Related Quality ...
Breaking Biology Technology:Clintrax Global, Inc. Announces Addition to Executive Team 2Neurotrope To Host Conference Call 26th Annual Personalized and Precision Medicine Conference Bringing Together Thought Leaders to Discuss Clinical Implementation, Dx Reimbursement, Big Data, and Sequencing 2EQ-5D™ Assessment Now Available for iPad 2
... small-molecule ... -, - Lead compound AEG40826 works synergistically with HGS TRAIL receptor ... drugs -, - IAP inhibitors also show promise alone and in ... cancer agents across broad range of cancers -, ROCKVILLE, Md. and MONTREAL, ...
... Genome,Sciences, Inc. (Nasdaq: HGSI ) announced today ... Phase 2 clinical trial of HGS-ETR1 (mapatumumab) in,combination ... therapy in patients with advanced non-small cell lung ... newly diagnosed with non-small cell,lung cancer have locally ...
... continue to have access to ZEVALIN(R) and other novel ... ... New Medicare legislation,passed by the House and Senate extends the ... and Medicaid,Services (CMS) had implemented new hospital outpatient reimbursement rates,for ...
Cached Biology Technology:Human Genome Sciences and Aegera Therapeutics Announce Licensing and Collaboration Agreement on Novel Anti-Cancer Drugs 2Human Genome Sciences and Aegera Therapeutics Announce Licensing and Collaboration Agreement on Novel Anti-Cancer Drugs 3Human Genome Sciences and Aegera Therapeutics Announce Licensing and Collaboration Agreement on Novel Anti-Cancer Drugs 4Human Genome Sciences and Aegera Therapeutics Announce Licensing and Collaboration Agreement on Novel Anti-Cancer Drugs 5Human Genome Sciences and Aegera Therapeutics Announce Licensing and Collaboration Agreement on Novel Anti-Cancer Drugs 6Human Genome Sciences Initiates Second Randomized Phase 2 Trial of HGS-ETR1 in Combination With Chemotherapy 2Human Genome Sciences Initiates Second Randomized Phase 2 Trial of HGS-ETR1 in Combination With Chemotherapy 3Human Genome Sciences Initiates Second Randomized Phase 2 Trial of HGS-ETR1 in Combination With Chemotherapy 4Human Genome Sciences Initiates Second Randomized Phase 2 Trial of HGS-ETR1 in Combination With Chemotherapy 5Human Genome Sciences Initiates Second Randomized Phase 2 Trial of HGS-ETR1 in Combination With Chemotherapy 6House and Senate Pass Medicare Legislation to Freeze 2008 Reimbursement for Therapeutic Radiopharmaceuticals at 2007 Levels 2House and Senate Pass Medicare Legislation to Freeze 2008 Reimbursement for Therapeutic Radiopharmaceuticals at 2007 Levels 3
(Date:8/20/2014)... George E. Fox, a John and Rebecca Moores Professor ... was named a fellow in the International Society for the ... is one of four members two from the U.S., ... fellows in 2014. Fellows are elected every three years, and ... members from more than 20 countries, the ISSOL includes researchers ...
(Date:8/20/2014)... (HCI) at the University of Utah have identified and ... the unregulated enzyme driving the blood cancer chronic myeloid ... 6,000 new cases of CML will be diagnosed in ... inhibitors (TKIs), target BCR-ABL and are effective at controlling ... it in a way that allows patients to get ...
(Date:8/20/2014)... , Aug. 20, 2014 /CNW/ -  Issue ... and can quickly become life threatening for some children.    ... as 1.2 million Canadians have food allergies and this number ... cent of children are estimated to have food allergies.  ... mild skin irritations and hives to breathing difficulties and loss ...
Breaking Biology News(10 mins):UH professor named fellow by International Astrobiology Society 2Blueprint for next generation of chronic myeloid leukemia treatment 2Information Update - Allergens and food safety at school - What's in your child's lunch? 2Information Update - Allergens and food safety at school - What's in your child's lunch? 3
... has produced an innovative new study of the environmental impact ... the journal Ecological Applications . The team includes ... Santa Barbara,s Department of Geography. They analyzed environmental data gleaned ... 3,100 households in the cities of Minneapolis and St. Paul, ...
... monitoring environmental conditions at a remote Wisconsin lake, researchers ... in economic and medical systems can also predict environmental ... are all preceded by a measurable increase in variancebe ... or, in the case of the Wisconsin lake, chlorophyll. ...
... RUSTON, La. Dr. Yuri Lvov, professor of chemistry ... at Louisiana Tech University, recently led a symposium at ... discussing his application of a more eco-friendly and cost-effective ... properties of plastics, paints and other synthetic composites. ...
Cached Biology News:UCSB urban ecosystem research featured in leading ecology journal 2UCSB urban ecosystem research featured in leading ecology journal 3Fluctuations before the fall: Predicting and preventing environmental collapse 2Louisiana Tech researcher presents on eco-friendly nanotechnology at national conference 2
Request Info...
...
Mouse GM CSF Construction Kit provides antigen affinity purified polyclonal capture and tracer antibodies, and antigen standard for development of approximately ten microplate assays....
... Upright Freezer Inventory Storage Racks ... configurations available to fit all makes ... refrigerators. Made of high quality ... 3" high fiberboard, stainless steel or ...
Biology Products: