Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:12/17/2014)... (PRWEB) December 17, 2014 Gene ... that it has entered into a technology access ... (ADM) to apply DNA2.0’s proprietary protein engineering technology, ... process. , “We are extremely excited that the ... platform. This proprietary bioengineering technology has now ...
(Date:12/17/2014)... SOUTH SAN FRANCISCO, Calif. , Dec. 17, ... positive results of a Phase 2 study evaluating ... for the treatment of patients with severe, chronic ... the current standard of care, including topical steroids ... endpoint was percent change in Visual Analog Scale ...
(Date:12/15/2014)...  GlassesOff Inc. (OTCBB: GLSO) announced today the appointment ... director of the Company,s Board of Directors. ... its CEO until its acquisition by Stanley Black ... Recognized as the inventor of the first Wi-Fi-based Active ... -based RFID solutions focused on improving operational efficiency, safety ...
(Date:12/13/2014)... (PRWEB) December 12, 2014 Clarassance, a ... announced its new name: Therabron Therapeutics , Inc. ... and bronchioles (a type of structure in the lungs ... company’s mission to develop novel protein therapeutics for the ... directors decided to change the name to mark the ...
Breaking Biology Technology:ADM and DNA2.0 Enter Into Protein Engineering Technology Access and Service Agreement 2Velocity Pharmaceutical Development, LLC and Tigercat Pharma, Inc. Announce Phase 2 Results for VPD-737 in Patients With Chronic Pruritus 2Velocity Pharmaceutical Development, LLC and Tigercat Pharma, Inc. Announce Phase 2 Results for VPD-737 in Patients With Chronic Pruritus 3Velocity Pharmaceutical Development, LLC and Tigercat Pharma, Inc. Announce Phase 2 Results for VPD-737 in Patients With Chronic Pruritus 4AeroScout Founder Joins GlassesOff's Board of Directors 2AeroScout Founder Joins GlassesOff's Board of Directors 3Maryland-based Biotech Company's Path Forward in Treating Respiratory Diseases Sparks Name Change 2
... Health-focused social networks,blogs, wikis and community sites ... can be their biggest opportunities. A marketing,executive ... increasing,importance of reputation monitoring and management in ... Generated Content and Enhancing its Impact,on Your ...
... EASTON, Mass., Dec. 11 Pressure BioSciences, Inc. (Nasdaq: ... Omni International ("Omni") today announced that they have entered ... Under the terms of the Agreement, the companies will: ... competitive information; (2) co-promote certain products at industry trade ...
... adults may be familiar with the,tetanus and diphtheria booster ... a booster shot that protects adolescents and adults from,whooping ... Listen to this report from ... Registered journalists can access video, audio, text, ...
Cached Biology Technology:Exclusive Conference on Managing Your Online Brand: Shaping the Noise from the Blogosphere 2Pressure BioSciences, Inc. and Omni International Announce Marketing, Distribution, and Technology Development Agreement 2Pressure BioSciences, Inc. and Omni International Announce Marketing, Distribution, and Technology Development Agreement 3Pressure BioSciences, Inc. and Omni International Announce Marketing, Distribution, and Technology Development Agreement 4Pressure BioSciences, Inc. and Omni International Announce Marketing, Distribution, and Technology Development Agreement 5
(Date:12/17/2014)... 2014  Automation is fundamentally transforming the travel ... at international borders. Over the past decade, ePassports, ... veteran travelers to self process through border control ... at an increasing number of airports, seaports, and ... According to Maxine Most , Principal at ...
(Date:12/11/2014)... WINSTON SALEM, N.C. , Dec. 10, 2014  That ... known for quite a while. Hypertension – the medical term ... disease in the early 1800s, and the inflatable cuff that,s ... That doesn,t, however, mean there,s nothing new about hypertension, ... punctured some long-held beliefs about the condition and the best ...
(Date:12/10/2014)... N.C. , Dec. 9, 2014  Wake Forest Baptist ... education building for its School of Medicine. Funding for ... larger capital campaign that will be publicly launched next ... be located in the former 60 series R.J. Reynolds ... Innovation Quarter. Construction will begin immediately with plans to ...
Breaking Biology News(10 mins):Automated Border Control (ABC) Transforms the Global Travel Experience With More Than 2500 ABC eGates and APC Kiosks Deployed In Airports, Seaports, and Land Borders Worldwide 2Research points to need for new approaches to treatment of high blood pressure 2Research points to need for new approaches to treatment of high blood pressure 3Research points to need for new approaches to treatment of high blood pressure 4Wake Forest Baptist to Build New Medical Education Facility In Wake Forest Innovation Quarter 2Wake Forest Baptist to Build New Medical Education Facility In Wake Forest Innovation Quarter 3Wake Forest Baptist to Build New Medical Education Facility In Wake Forest Innovation Quarter 4
... children with cerebral palsy is crucial to improve ... in sitting balance between children with cerebral palsy ... balance between children with diplegic and hemiplegic cerebral ... Laboratory of Human Motor Control, Faculty of Health ...
... batteries to flat-screen televisions, rely on materials known as rare ... are reporting development of a new method to recycle them ... in the journal ACS Applied Materials & Interfaces , ... industry. Zhang Lin and colleagues point out that ...
... the change of the seasons. After a winter pause, plants ... a new correlation to light: The colder the winter, the ... can be expected as the climate changes, the spring development ... giving an advantage to shrubs and invasive trees that ...
Cached Biology News:Recycling valuable materials used in TVs, car batteries, cell phones 2Warm winters let trees sleep longer 2
... Microarrays designed for DNA aptamer screening and ... and powerful Paraflo microfluidic on-chip synthesis platform. ... our comprehensive DNA/RNA Aptamer Microarray Service. ... Aptamer Microarray contains greater than 1500 known ...
... Microarrays designed for DNA aptamer screening and ... and powerful Paraflo microfluidic on-chip synthesis platform. ... synthesized on-chip and LC Sciences can provide ... are available as part of our comprehensive ...
... glutathione-S-transferase (GST) is commonly used as a ... coli (1). The GSTTag sequence has been ... some cases the solubility of its fusion ... folded form, GSTTag fusion proteins can be ...
... for the use of small interfering RNA ... the RNA interference (RNAi) pathway have generated ... biology fields. siRNA for experimental use can ... enzymatically, and then transfected into the target ...
Biology Products: