Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Mouse Tail Genomic DNA Isolation Protocol(1)
8. Genomic DNA Isolation Protocol(1,2,3)
9. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:1/15/2014)... January 15, 2014 This webinar ... on nonclinical and clinical safety assessment in biosimilars. ... guide a path for biosimilar drug development, however ... of biosimilarity with regards to quality, safety and ... of biosimilar drug development and registration, development strategies ...
(Date:1/15/2014)... NC (PRWEB) January 15, 2014 ... an enhancement to its Online Web Portal for Life ... now have the ability to specify the subject matter ... nearly 50 life science sub-domains. This will help reduce ... and scientific fields, and decrease the likelihood of error. ...
(Date:1/14/2014)... Doylestown, PA (PRWEB) January 14, 2014 ... – 11 p.m. , Location: Warrington Country Club, 1360 ... Hepatitis B Foundation, the only national nonprofit organization solely ... improving the quality of life for those affected worldwide, ... 11 at Warrington Country Club in Warrington, Pa. ...
(Date:1/14/2014)... York, NY (PRWEB) January 14, 2014 ... initiated coverage of Alliqua, Inc. (OTCQB: ALQA). Alliqua ... and marketing proprietary products to serve the wound ... , In late 2012, Alliqua was restructured ... launched the company’s new strategy to become a ...
Breaking Biology Technology:Xtalks Life Sciences Webinar Examines Safety Assessment of Biosimilars 2DTS Improves Efficiency for Life Science Document Translations 2Hepatitis B Foundation to Host Annual Crystal Ball Gala 2EquitiesIQ Initiates Coverage of Alliqua, Inc. 2EquitiesIQ Initiates Coverage of Alliqua, Inc. 3
... 2008,November 4th through 9th,in Philadelphia, Pennsylvania, MISGAV, ... is pleased to announce encouraging preliminary data for ... I/II clinical trial of Medgenics, EPODURE Biopump,for providing ... kidney,disease, is underway. The current trial is designed ...
... Sunesis,Pharmaceuticals, Inc. (Nasdaq: SNSS ), a biopharmaceutical company ... for,the treatment of solid and hematologic cancers, today announced ... conferences:, Rodman & Renshaw 10th Annual Healthcare Conference, ... Wednesday, November 12, 2008, 2:00 p.m. EST, ...
... JERSEY CITY, New Jersey, November 3, Rosetta Genomics ... development of microRNA-based diagnostics, announced today it will,present ... the Lab and Clinic in Cancer Medicine" Molecular ... take place,between November 3-6, at the ICC Jerusalem ...
Cached Biology Technology:Medgenics Announces Encouraging Preliminary Data For Phase I/II Clinical Trial of EPODURE In Renal Anemia 2Medgenics Announces Encouraging Preliminary Data For Phase I/II Clinical Trial of EPODURE In Renal Anemia 3Medgenics Announces Encouraging Preliminary Data For Phase I/II Clinical Trial of EPODURE In Renal Anemia 4Medgenics Announces Encouraging Preliminary Data For Phase I/II Clinical Trial of EPODURE In Renal Anemia 5Sunesis to Present at Upcoming Conferences 2Rosetta Genomics to Present at the American Association of Cancer Research (AACR) Centennial Conference 2Rosetta Genomics to Present at the American Association of Cancer Research (AACR) Centennial Conference 3
(Date:4/15/2014)... study the deadliest infectious diseases recognized the contributions of ... the University of Texas Medical Branch, with a Lifetime ... Filoviruses. The filoviruses include Ebola and Marburg viruses that ... infected. The current outbreak of Ebola virus raging in ... far. , "This award represents the culmination of ...
(Date:4/15/2014)... University dental researchers have found a less invasive ... the mouth to study how the mouth,s natural ... isolating some specialized immune cells (white blood cells ... diseases in the mouthor reject foreign tissues, such ... more about treating and preventing such health issues ...
(Date:4/15/2014)... 2014) The American Association of Anatomists (AAA) is ... awards will be presented during the Closing Awards Ceremony ... Tuesday, April 29th at 7:30 p.m. during AAA,s 2014 ... The 2014 award winners are: , Henry ... the Icahn School of Medicine at Mount Sinai, Past-President ...
Breaking Biology News(10 mins):International research group recognizes UTMB experts 2International research group recognizes UTMB experts 3New method isolates immune cells for researchers to study how they ward off oral diseases 2American Association of Anatomists 2014 award winners 2
... the meaning of a rare mineral that can be used to ... and others better understand what we,re probably in for over the ... the heat and, ultimately, to change life as we know ... place in the next hundred years or so, and that many ...
... colloquium to examine what lies ahead in evolutionary studies ... and students will discuss new tools to predict future ... of ecology, paleontology, phylogenetics, and biodiversity informatics dealing with ... series, the event will take place at the Arnold ...
... (ST. LOUIS): The Missouri Botanical Garden Press (MBG ... species of vascular plants for the Southern Cone region, ... Plantas Vasculares del Cono Sur (Catalogue of the Plants ... the plants of Argentina, southern Brazil, Chile, Paraguay and ...
Cached Biology News:Foretelling a major meltdown 2Foretelling a major meltdown 3Missouri Botanical Garden publishes first catalogue of plants of the Southern Cone 2
hnRNP U (H-94)...
Rabbit polyclonal antibody to Neuromedin U Receptor 1 (GPR66)...
... GELase™ Agarose Gel-Digesting Preparation contains a ... for simple, quantitative recovery of intact DNA ... agarose gels following electrophoresis in TAE, TBE, ... be digested directly in the TAE, TBE, ...
... in-house demand is causing shortages in your ... This can cause unwanted distractions, problems and ... royalties for your hard work and endeavour! ... build it up,and market it internationally. We ...
Biology Products: