Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)

Post Your Comments:
(Date:11/24/2009)...RNewswire-FirstCall/--DowAgroSciencesCanadaannounc...onofThompsonsLimitedofBlenheim,Ontario.Theaddition...entseedsbusinessasthecompanyanticipatestheintroduc...erbicideTolerantTraitTechnologyincornin2012.Thetra...hisacquisitionbringstogethertwostrongprogressiveco...
(Date:11/24/2009)...l/--Sigma-AldrichCorporation(Nasdaq: SIAL )willbep...r1stat1:45PMGMTinLondon,7:45AMUS/CST.Interestedpar...vailableat http://inve s tor.sig m a a ldri...sfile. ,, AboutSigma-Aldrich: Sigma-Aldrichi...emicalandbiochemicalproductsandkitsareusedinscient...
(Date:11/24/2009)...wire-FirstCall/--deCODE,genetics,Inc.(Nasdaq: DCGN...tionsbytheU.S.BankruptcyCourtfortheDistrictofDelaw...untarypetitionfor,reliefunderChapter11oftheUnitedS... TheordersissuedbytheBankruptcyCourtallowthecompan...proceedings.Inparticular,the,companyreceivedinteri...
(Date:11/24/2009)...irstCall/--NeurogesX,Inc.(Nasdaq: NGSX ),abiopharm...ingnovelpainmanagementtherapies,announcedtodaythat...sscheduledtopresentatthe21stAnnualPiperJaffrayHeal...orkPalaceHotelinNewYork,NewYork. ,, Mr.DiTonnoa...ilabletorespondtoquestionsduringthepresentationsan...
Breaking Biology Technology:Dow AgroSciences Canada Announces Agreement to Acquire Hyland Seeds 2Dow AgroSciences Canada Announces Agreement to Acquire Hyland Seeds 3deCODE genetics, Inc. Announces Approval of First Day Motions by Bankruptcy Court 2deCODE genetics, Inc. Announces Approval of First Day Motions by Bankruptcy Court 3NeurogesX to Present at Piper Jaffray Health Care Conference 2NeurogesX to Present at Piper Jaffray Health Care Conference 3
...lable in German . , The polymer researchers at...expected about 30 scientists to attend the kick-of...ct Ratio for Carbon-based Nanocomposites). New kin...o develop lightweight materials that would increas...ectrical or magnetic properties, for example. , ...
...ly 22 The Board of,Directors of BD (Becton, Dicki...rterly dividend of 28.5 cents per common share. Th...o holders of record on September 9, 2008.,The indi...bout BD, BD is a leading global medical technolog...ical devices, instrument systems and reagents.,The...
...w evidence of 90 billion tons of microbial organis...eep biosphere, in a research article published onl...sponds to about one-tenth of the amount of carbon ...rs: Kai-Uwe Hinrichs and Julius Lipp of the Center...ersity of Bremen, Germany; and Fumio Inagaki and Y...
Other Biology Technology:Using nanotechnology to create high-performance materials 290 billion tons of microbial organisms live in the deep biosphere 290 billion tons of microbial organisms live in the deep biosphere 3
(Date:11/23/2009)...E, Calif. -- More than 160 participants gathered t... Keck FUTURES INITIATIVE conference. This year,s t...ists, engineers, and medical researchers to explor...urrounding the emerging field of synthetic biology...ology at Princeton University and this year,s conf...
(Date:11/23/2009)...ON, WI, November 16, 2009 -- A USDOE and USDA stud..., idle cropland, and cropland pasture could be con...nnial grasses, such as switchgrass, from which bio...tock. Economically viable production of a perennia...ies of biomass are removed annually is expected to...
(Date:11/23/2009)...LLIS, Ore. A string of recent discoveries about t...ed interest in this multi-purpose nutrient, increa...e deficient in it, spurred research and even led t..., On issues ranging from the health of your immu...vulnerability to influenza, vitamin D is now seen ...
Breaking Biology News(10 mins):Synthetic biology offers new opportunities for interdisciplinary collaboration 2Switchgrass produces biomass efficiently 2Multiple health concerns surface as winter, vitamin D deficiences arrive 2Multiple health concerns surface as winter, vitamin D deficiences arrive 3Dr Philip Katz Elected President of the American College of Gastroenterology 59908 1Dr Philip Katz Elected President of the American College of Gastroenterology 59908 2Dr Philip Katz Elected President of the American College of Gastroenterology 59908 3New Quick and Convenient Emergen C 28R 29 Shot Gives Immune Systems a Fighting Chance This Fall 59904 1New Quick and Convenient Emergen C 28R 29 Shot Gives Immune Systems a Fighting Chance This Fall 59904 2New Quick and Convenient Emergen C 28R 29 Shot Gives Immune Systems a Fighting Chance This Fall 59904 3Red Mango to Award Franchises in Atlanta 59900 1Red Mango to Award Franchises in Atlanta 59900 2
...o borne diseases such as malaria and dengue cause ...ne causes at least one million deaths annually, an...e age of five. In addition to the human toll, the... very communities that can least afford it. Vario...s insecticides, vaccine development, and preventiv...
...N, Ill. --- Driving down a country road at night y..., and the creature doesnt move. Depending on your ...ill hit the deer. And if you do, its because you a...ode, according to a Northwestern University study,...ogy. , The Northwestern researchers are the first...
...release is available in Spanish . , Researchers ... and Psychiatry of the University of Granada ( U...trations in iron and steel industry workers. Conti... of the work-related poisonings which were discuss... Treatment (Tecnologas para el tratamiento de resi...
Other Biology News:Selfish DNA and the Genetic Control of Vector-Borne Diseases 2Selfish DNA and the Genetic Control of Vector-Borne Diseases 3Northwestern study looks at sensing, movement and behavior 2Northwestern study looks at sensing, movement and behavior 3Scientists develop a fast system to detect metal concentrations in iron and steel industry workers 2
... (CMV) pp65 Antigenemia Immunofluorescence Assay (...n of lower matrix protein pp65 of CMV in isolated ...Erythrocyte Lysis Buffer - (Catalog No. 5122) One ...ride. (NH4CL) Fixation Solution (5X) - (Catalog N...
Rabbit Anti-NO-TRYPTOPHAN CONJUGATE Polyclonal Antibody, Unconjugated from AbD Serotec
Sheep Anti-11-DEOXY-CORTICOSTERONE (-OCMO) Polyclonal Antibody, Unconjugated from AbD Serotec
... Osmometer for both 0.2 and 2.0 mL samples for fre...nter, keypad, and software for statistical analysi... with optional scanner. RS-232 port. Microprocess...on. ...
Biology Products: