Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)

Post Your Comments:
(Date:11/7/2009)...DGE, Mass., Nov. 7, Research proje...cored top marks this evening, as Tim Kunisky of Li...n (Jack) Chen of Audubon, PA received the highest ...ns Competition in Math, Science & Technology, ...on. ,, ( http://www.newscom.com/cgi-bin/prnh/2...
(Date:11/6/2009)...O, Nov. 6 /PRNewswire-FirstCall/ - Microbix Biosys...has re-filed the Form 52-109F1 Certification of An...e Officer and James Long, the Chief Financial Offi...2, 2009 in connection with the annual audited fina...2008. ,, The Company initially filed the annual...
(Date:11/6/2009)...OK, N.Y., Nov. 6 BioSpec...armaceutical company developing first-in-class col...cial results for the third quarter ended September...n September of this year, the FDA,s Arthritis Advi...of 12-0, the approval of XIAFLEX(TM) for the treat...
(Date:11/6/2009)..., Ontario, Nov. 6 Helix ...BPF) today announced that John Docherty, president...iman Curhan Ford,s 6th annual Investor Summit on N...n New York City. Mr. Docherty will provide an ove... programs L-DOS47 and Topical Interferon Alpha-2b....
Breaking Biology Technology:Mathematics and Biochemistry Research Earn Top Prize at Nation's Premier High School Science Competition 2Mathematics and Biochemistry Research Earn Top Prize at Nation's Premier High School Science Competition 3Mathematics and Biochemistry Research Earn Top Prize at Nation's Premier High School Science Competition 4Mathematics and Biochemistry Research Earn Top Prize at Nation's Premier High School Science Competition 5Mathematics and Biochemistry Research Earn Top Prize at Nation's Premier High School Science Competition 6Reissue with Tables: BioSpecifics Technologies Corp. Reports Third Quarter 2009 Financial Results 2Reissue with Tables: BioSpecifics Technologies Corp. Reports Third Quarter 2009 Financial Results 3Reissue with Tables: BioSpecifics Technologies Corp. Reports Third Quarter 2009 Financial Results 4Reissue with Tables: BioSpecifics Technologies Corp. Reports Third Quarter 2009 Financial Results 5Reissue with Tables: BioSpecifics Technologies Corp. Reports Third Quarter 2009 Financial Results 6Helix BioPharma to Present at Merriman Curhan Ford's Investor Summit 2009 on November 10th 2Helix BioPharma to Present at Merriman Curhan Ford's Investor Summit 2009 on November 10th 3
...ution Enables Enhanced Productivity and Decreased ...e global leader,in helping academic, healthcare an...tial of strategic procurement, today announced tha...aceutical research and development,firm, has chose... and,enhance procurement functions for its operati...
... Peggy McKee (Recruiter and Owner of...t all. PHC Consulting is focused on top sales and ...ratory clinical and research, physician call point...2008 is a fantastic year for revenues and Peggy at... Celina, TX (PRWEB) June 24...
... Average Number of Days of Inpatient Therapy per P...sed by 10 Percent, According to New Dat...N, Penn., June 25 Arlington Medical Resources,(AM...the pharmaceutical and,diagnostic imaging industri... an antibiotic associated with a positive culture ...
Other Biology Technology:SciQuest Announces Newest Life Sciences Customer; BioMarin Pharmaceutical Drives Spending Effectiveness with Automated, Intuitive Procurement 2Website and Blog Increase Placement for Medical Sales Recruiter - Providing Sales Winners Calling on the Hospital, Lab and Physician Call Point 2Number of Patients Treated with an Antibiotic for MRSA Within U.S. Acute Care Hospitals Increased 8 Percent from 2006 to 2007 2
(Date:11/3/2009)... 4, 2009) For more than 25 years, all attempts at...gigas ) have been unsuccessfuluntil now. For the f...s to produce beaded (nucleated) and non-beaded cul...ped by scientists from Florida Atlantic University...ith less than two years of research and experiment...
(Date:11/3/2009)...ling of fruit and vegetables is a new, patented te...r beam is used to label, or "etch" information on ...ticker-type labels. The technology has been licens...nd is being used in New Zealand, Australia, and Pa...Asia, South Africa, Central and South America, Can...
(Date:11/3/2009)...ry Samueli School of Engineering and Applied Scien...ted in the laboratory the enzyme responsible for p... lovastatin. , The research, published Oct. 2... to the development of other compounds with simila...hesizing enzyme is one of the most interesting but...
Breaking Biology News(10 mins):Scientists are first to 'unlock' the mystery of creating cultured pearls from the queen conch 2Scientists are first to 'unlock' the mystery of creating cultured pearls from the queen conch 3Laser etching safe alternative for labeling grapefruit 2UCLA researchers reconstitute enzyme that synthesizes cholesterol drug lovastatin 2Patient perception is vital when reporting medical errors 55871 1Patient perception is vital when reporting medical errors 55871 2Why dont brain tumors respond to medication 3F 9755 1Why dont brain tumors respond to medication 3F 9755 2International event brings worlds top cancer doctors to Queens 9750 1International event brings worlds top cancer doctors to Queens 9750 2International event brings worlds top cancer doctors to Queens 9750 3
...broccoli!" Although parents may have good intentio...etables, this approach may backfire the very next ...sity. , "We found that the more controlling the p...ir plate, the more likely the kids, especially the...d cereal at daycare," says lead author Brian Wansi...
... is available in Spanish . , The Amazon is sur...esearch conducted throughout the world,s largest t... in Science , provides the first solid evidence t... forests, mainly through killing trees. , "For ...own climate change. But relying on this subsidy f...
...lobal warming, scientists are exploring ways to pu...away. Trees already do this naturally through phot...mapped large rock formations in the United States ...e artificially harnessed to do the task at a vastl... at Columbia University,s Earth Institute and the ...
Other Biology News:Amazon carbon sink threatened by drought 2Geologists map rocks to soak CO2 from air 2Geologists map rocks to soak CO2 from air 3Geologists map rocks to soak CO2 from air 4
Klenow Enzyme; labeling grade, DNA Polymerase I, large fragment from Roche Applied Science
...5' direction from a blunt end, 5'-overhang or nick...r defined reaction conditions, DNA degradation by ...g predictable and reproducible results. Because th...eotides by Exonuclease III is dependent upon react...
Hexokinase/ Glucose-6-Phosphate Dehydrogenase from Roche Applied Science
...ucing clone of T4 DNA Ligase. Description: T4 DNA ... bond between juxtaposed 5' phosphoryl and 3'-hyd...gle-stranded nicks in duplex DNA, RNA or DNA/RNA h...nd fragments of duplex DNA or RNA (1) . Tested Use...
Biology Products: