Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:7/10/2014)... -- Kainos Capital, a firm specializing in acquiring and managing ... acquired the Slim-Fast brand from Unilever. Unilever will retain ... transaction were not disclosed. Slim-Fast is a ... ready-to-drink shakes, powders, bars and snacks to retail customers ... the United Kingdom and Ireland.  ...
(Date:7/10/2014)... to the International Atomic Energy Agency (IAEA) the ... acquiring sufficient quantities of plutonium or highly enriched ... device. The IAEA also notes that most cases ... which can be challenging to detect with most ... appearing this week in the Journal of ...
(Date:7/10/2014)... extremely challenging because there are many genetic variants that ... Now investigators reporting in the July 3rd issue of ... describe a strategy that may help reveal how such ... environmental exposures to affect the development of the nervous ... predispose individuals to schizophrenia. , The work takes ...
(Date:7/10/2014)... for crude 3-D glasses, polarized glasses, and shutter ... devices, used to trick the brain into perceiving ... obsolete with the introduction of new holography technology ... doctoral students Yuval Yifat, Michal Eitan, and Zeev ... nanoantennas that could be used for security as ...
Breaking Biology Technology:Kainos Capital Acquires Slim-Fast From Unilever 2Sensitive detection method may help impede illicit nuclear trafficking 2New strategy could uncover genes at the root of psychiatric illnesses 2Projecting a 3-dimensional future 2Projecting a 3-dimensional future 3
... in the late 1970s with the first IPOs taking place in ... than 25 years old. , ,An interesting article in Genetic ... that most industry cycles run about 50 years until they mature. ... 50-year cycle. A new industry of significance usually produces an industrial ...
... In a long-planned departure from its traditional focus, high-end ... the U.S. Army for development of two different products. ... that it has secured $2.2 million in federal contracts ... with the Armys Research, Development and Engineering Command (CERDEC) ...
... Mike Strand has always kept his eye out ... Delta Technology and Cray Research, Strand took a stride forward ... company based out of his home dealing with barcode software. ... had expanded into a worldwide enterprise bringing in close to ...
Cached Biology Technology:Biotech industry reaches midpoint in 50-year maturation cycle 2Biotech industry reaches midpoint in 50-year maturation cycle 3Biotech industry reaches midpoint in 50-year maturation cycle 4Biotech industry reaches midpoint in 50-year maturation cycle 5SLE of Eau Claire lands $2.2 million in federal contracts 2SLE of Eau Claire lands $2.2 million in federal contracts 3Online Kiosks founder Mike Strand uses contest to screen new business plan 2Online Kiosks founder Mike Strand uses contest to screen new business plan 3
(Date:7/11/2014)... the Wildlife Conservation Society shows that no-take zones ... species such as lobster, conch, and fish recover ... reef areas. , The reporttitled "Review of the ... research literature from no-take areas around the world. ... a recognized expert in marine protected areas and ...
(Date:7/11/2014)... 11, 2014--Researchers at the Department of Energy,s Oak ... awards, presented by R&D Magazine in recognition of ... awards recognize the tremendous value of our National ... and development at the National Labs continues to ... pursue the scientific and technological innovations necessary to ...
(Date:7/11/2014)... South Wales, Australia when NASA,s Aqua satellite passed overhead ... 11 (12:35 p.m. local time/11:35 p.m. EDT on July ... (NSW), the Moderate Resolution Imaging Spectroradiometer (MODIS) aboard captured ... smoke (light brown) from various fires. Actively burning areas, ... , The New South Wales, Australia Government website "NSW ...
Breaking Biology News(10 mins):Belize's lobster, conch, and fish populations rebuild in no-take zones 2ORNL wins eight R&D 100s 2ORNL wins eight R&D 100s 3ORNL wins eight R&D 100s 4
... leading provider of,embedded speech solutions today announced the ... AG, according to SVOX CEO Volker Jantzen.,SVOX has ... developed,over 25 years, including the SpeechAdvance(TM) speech recognition ... majority of the Professional,Speech Processing Group,s employees will ...
... MAYWOOD, Ill. -- Most people know that too much sodium ... suggests that people trying to lower their blood pressure should ... effect to sodium. Researchers found that the ratio of ... cardiovascular disease than sodium or potassium alone. "There ...
... officials from the U.S. National Science Foundation and the ... today marked the occasion of the research vessel JOIDES ... and transit to Honolulu, after a complete transformation to ... The JOIDES Resolution is the U.S. research ...
Cached Biology News:SVOX Acquires Speech Processing Unit of Siemens AG, Expands Into Speech Recognition and Speech Dialog 2Cutting salt isn't the only way to reduce blood pressure 2Ocean research officials hail completion of modernization for US scientific ocean drilling vessel 2
Human PLUNC Biotinylated Affinity Purified PAb...
Human RXR beta/NR2B2 MAb (Clone H7341) Keywords: RXRbeta, RXRbeta, Retinoid X Receptor beta...
... polyclonal to GRASP1 ( Abpromise ... Antigen: Synthetic peptide corresponding ... C terminal region of rat GRASP1, ... Entrez GeneID: ...
(3-[125I]iodotyrosyl26)Galanin, porcine, 370 kBq, 10 uCi. Category: IODINE LIGANDS....
Biology Products: