Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:9/16/2014)... (PRWEB) September 16, 2014 ... initiatives to position themselves for their 89th ... labeling and encoding, Pharma Packaging Solutions is ... hardware and software and new procedures. Establishing ... Good Manufacturing Practices (cGMP), Pharma Packaging Solutions ...
(Date:9/16/2014)... Convoy Therapeutics, Inc., a specialty ... to treat patients directly at the site of ... Technology Platform announced today that John Muraski, Ph.D., ... the White Hat Life Science Investor Conferenceā„¢ on ... In addition, interested individuals can meet Convoy ...
(Date:9/16/2014)... LOUISVILLE, Ky. , Sept. 16, 2014 /PRNewswire/ ... laboratory technologies and products to hospitals, physician office ... announce that, effective October 1, 2014, it will ... in specified hospital market segments and as a ... in the 48 contiguous United States ...
(Date:9/16/2014)... 2014 /PRNewswire-iReach/ -- Researchers found that ActiveLife Scientific,s ... with bone fragility fracture when today,s standard bone ... are at risk of fracture for reasons that ... test, the DEXA bone density scan.  Study results ... and Mineral Research Annual Conference (ASBMR) in ...
Breaking Biology Technology:Adding Serialization Capabilities and Expanded Capacity, Pharma Packaging Solutions Is Preparing for 89th Year of Business 2Convoy Therapeutics to Present at WhiteHat Investor Conference September 18, 2014 2Convoy Therapeutics to Present at WhiteHat Investor Conference September 18, 2014 3LABSCO Secures Alliance With Siemens Healthcare Diagnostics 2LABSCO Secures Alliance With Siemens Healthcare Diagnostics 3ActiveLife's BMSi Test Provides Hope for 160 Million with Undetectable Risk of Bone Fracture 2ActiveLife's BMSi Test Provides Hope for 160 Million with Undetectable Risk of Bone Fracture 3
... Multiporator / Electroporator 2510 , , , , , , , ... Protocol No. 4308 915.501 04/2002 , , , ... , Microorganism , ... Cell type , Bacteria, gram negative, , ...
... , , , , , Multiporator , , , ... Transfection Protocol , Protocol No. 4308 915.045 11/2001 , ... , , , , , ... positive, , MHC class II DR, DQ negative, , ...
... , , , , Multiporator , , , , , ... Transfection Protocol , Protocol No. 4308 915.029 11/1999 , , ... , , Cell line , ... Transfection with , Plasmid pEGFP-N1 (in bidistilled H 2 O), ...
Cached Biology Technology:Actinomyces viscosus 2721.82 2293 T 2
(Date:9/16/2014)...  Valencell, Inc., a leader in performance biometric data ... "Showcase Companies" representing North Carolina,s ... Venture Conference on September 16-17 th at the ... Raleigh, North Carolina . Valencell,s President Dr. ... the "Digital Health Spotlight Sector" on how the Company,s ...
(Date:9/16/2014)... 16, 2014  Cross Match Technologies, a leading ... today the launch of its Verifier ® ... of an individual using their secure credentials and ... reads credential documents with embedded biometric data and ... biometric to a live scan of their fingerprint. ...
(Date:9/16/2014)... , Sept. 16, 2014 As open enrollment ... important decisions about their 2015 benefits. According to ... solutions business of Aon plc (NYSE: ... a more proactive role in managing their health care ... ever for individuals to understand how they can make ...
Breaking Biology News(10 mins):Valencell, Inc. Selected as 'Showcase Company' at CED Tech Venture Conference 2014 2Cross Match Launches New Identity Management Handheld Solution 2Aon Hewitt Provides Tips to Help Workers Prepare for the Upcoming Open Enrollment Season 2Aon Hewitt Provides Tips to Help Workers Prepare for the Upcoming Open Enrollment Season 3Aon Hewitt Provides Tips to Help Workers Prepare for the Upcoming Open Enrollment Season 4Aon Hewitt Provides Tips to Help Workers Prepare for the Upcoming Open Enrollment Season 5Aon Hewitt Provides Tips to Help Workers Prepare for the Upcoming Open Enrollment Season 6Aon Hewitt Provides Tips to Help Workers Prepare for the Upcoming Open Enrollment Season 7
... TROY, N.Y., Aug. 8 Milliseconds can mean the,difference ... sports,leading more trainers and athletes to look toward technology ... A fluids mechanics professor at Rensselaer Polytechnic Institute ... help,American swimmers sharpen their strokes, shave seconds from their ...
... than a fly buzzing around the house. South Africans have ... bunch of Roridula gorgonias leaves. Attracted to the ... is soon trapped by the natural flypaper. However, this is ... is home to a population of Pameridea roridulae ...
... between triumph and defeat in the world of Olympic ... technology as a tool to get an edge on ... Polytechnic Institute in Troy, N.Y., is using experimental flow ... shave seconds from their lap times, and race toward ...
Cached Biology News:'Top Secret' Technology To Help U.S. Swimmers Trim Times at Beijing Olympics 2'Top Secret' Technology To Help U.S. Swimmers Trim Times at Beijing Olympics 3How nonstick bugs evade natural fly paper 2'Top secret' technology to help US swimmers trim times at Beijing Olympics 2'Top secret' technology to help US swimmers trim times at Beijing Olympics 3
Recalibration of HL-2000-CAL products...
Mature rat whole blood (Sprague-Dawley, averaging 7-8 weeks of age, either sex) is collected at the time of slaughter and processed within 45 minutes. It is then filtered through gauze, pooled in an ...
Several Pichia pastoris strains are available to allow you to optimize expression and recovery of your protein of interest. Table 1 provides information to help you choose the appropriate strain....
...
Biology Products: