Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

DNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the e
'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
(Date:5/6/2015)... (PRWEB) May 06, 2015 ... a type of nanomaterial with diameter ranging between ... in the global nanophotonics materials market. The unique ... dots due to quantum confinement effect render the ... wide range of scientific, technological, and commercial applications. ...
(Date:5/6/2015)... May 6, 2015   University of Maryland (UM) ... today the signing of an exclusive option by Biomecite ... (UMB) to develop diagnostics to detect inflammatory bowel diseases ... (CD). Drs. Florian Fricke and James ... with the University of Maryland School of Medicine,s Institute ...
(Date:5/6/2015)... Fla. , May 6, 2015  Oxis Biotech, ... Inc. OTC: OXIS, OXI.PA, announced today that Cassian ... Division of Cancer Medicine at the University of Texas ... Dr. Yee is also Professor, Department of Immunology, Division ... Center for Cancer Immunology Research at the University of ...
(Date:5/6/2015)... , May 6, 2015 ... membrane specialist, announced today that it has signed an ... Ethanol, Inc. (Nasdaq: PEIX ) for the delivery of an industrial ... reduce the consumption of water, energy and ... output. This project is fully ...
Breaking Biology Technology:Expanding Applications & Full-Scale Commercialization to Drive the Global Quantum Dots Market, According to a New Report by Global Industry Analysts, Inc. 2Expanding Applications & Full-Scale Commercialization to Drive the Global Quantum Dots Market, According to a New Report by Global Industry Analysts, Inc. 3Biomecite Diagnostics Signs Option Agreement with UM Baltimore to Develop Tools to Detect Inflammatory Bowel Diseases 2Biomecite Diagnostics Signs Option Agreement with UM Baltimore to Develop Tools to Detect Inflammatory Bowel Diseases 3Oxis Biotech Appoints Cassian Yee, M.D. To Its Scientific Advisory Board 2Oxis Biotech Appoints Cassian Yee, M.D. To Its Scientific Advisory Board 3Whitefox Signs Agreement With Pacific Ethanol Inc. 2
... StentForms Alliance to Jointly Develop Drug Eluting Balloon ... today that that the company entered into a ... subsidiary of Opto Circuits (OCI) Ltd., by which ... Genius MAGIC Cobalt Chromium Coronary Stent System for ...
... based Mayuka Labs,Private Limited has received recognition for its ... and industrial,research (DSIR) under the ministry of science and ... twenty-one scientists working round the clock at its R&D ... milestone in its first year of,operations. The company has ...
... Inc. (OTC: NNLX) a biotechnology company, announces director appointments ... Jeff Long to the Board of Directors. Daniel Barnhizer ... State University College of Law, where he teaches ... and commercial law. In addition to his academic work, ...
Cached Biology Technology:Micell Forges Strategic Agreement to Develop Advanced Drug-Eluting Stents and Balloons 2Micell Forges Strategic Agreement to Develop Advanced Drug-Eluting Stents and Balloons 3Mayuka Labs R&D Centre Gets DSIR Recognition 2NanoLogix Inc. Appoints Two New Directors and Provides Operations Update 2NanoLogix Inc. Appoints Two New Directors and Provides Operations Update 3
(Date:4/2/2015)... April 2, 2015 In ... by far outperforms the strongest competitors, showing outstanding ... accuracy, the system is capable of a throughput ... proves up to be ten times faster than ... runner-up performance.      (Photo: http://photos.prnewswire.com/prnh/20150402/738673-a ...
(Date:4/2/2015)... , April 2, 2015 ... Q1 2015 attributed to somewhat higher than 125 MSEK. ... the year-end report 2014 that revenues for Q1 2015 ... the company reported for Q4 2014. The operating result ... be negative. The complete interim report will as previously ...
(Date:4/1/2015)... -- NXT-ID, Inc. (NASDAQ: NXTD ) ("NXT-ID" or the ... mobile commerce market, announces the second shipment of a ... early access pre-order customers. Feedback from ... including Walmart, Target, AT&T, Dunkin, Donuts, Stop & Shop ... all outlets and very easy to use. Several users ...
Breaking Biology News(10 mins):DERMALOG AFIS Emerges as Performance Winner in NIST Benchmark Test 2DERMALOG AFIS Emerges as Performance Winner in NIST Benchmark Test 3Fingerprint Cards Revises Revenues for Q1 2015 2NXT-ID Reports Second Shipment of Wocket Smart Wallets Underway to Early Access Pre-order Customers and Provides User Feedback 2NXT-ID Reports Second Shipment of Wocket Smart Wallets Underway to Early Access Pre-order Customers and Provides User Feedback 3NXT-ID Reports Second Shipment of Wocket Smart Wallets Underway to Early Access Pre-order Customers and Provides User Feedback 4
... markers are an indispensable tool for researchers working with ... destroy the function and structure of DNA when inserted. ... be detected in the hereditary material. So researchers have ... at the University of Copenhagen has developed a tool ...
... CT scans to measure blood flow in the lungs of ... smokers are most at risk of emphysema before the disease ... a University of Iowa study. The study found that ... have normal lung function, have very different blood flow patterns ...
... biologist Claire Williams boards ferries bound for North Carolina,s Outer ... captains call her the "Pollen Lady." Each spring ... the islands to the mainland, collecting pine pollen blown far ... loblolly pine the most commonly planted tree in the ...
Cached Biology News:New tool developed for DNA research 2New test could identify smokers at risk of emphysema 2Gone with the wind: Far-flung pine pollen still potent miles from the tree 2
karyopherin alpha2 (2G7)...
50 assays. Provides an easy system for rapid separation of cytosol and particulate fractions that are compatiable with downstream studies....
Eliminate electrical interference from any analog signal, without filtering. Ideal for electrophysiology applications like EKG, EMG, and EEGs. Removes 50/60hz noise and harmonics caused by grounding ...
... 10. *SizeSep 400 Spun Columns: For rapid ... in length. - ... distilled water containing 0.15% Kathon CG/IcP Biocide. ... pairs. *Extremely useful in the construction ...
Biology Products: