Navigation Links
Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood ,,, Mini Kit

Laura Pollock, Jennifer Halcome, and Michele Nelson Hurst
Eppendorf 5 Prime, Inc. Abstract

The Perfect gDNA Blood Mini Kit is an efficient way to purify genomic DNA from 200 l of whole blood as described in the product manual. In addition, it has been shown that the kit can also be used to effectively purify genomic DNA from buffy coat after the whole blood has been separated into its components. Using this method provides obvious benefits to the researcher because the gDNA isolated from buffy coat is higher in concentration and yield than the corresponding whole blood sample. Best results are found when an entire vial of blood is separated into its component parts, but it has also been proven that the buffy coat, from as little as 1.5 ml of whole blood, gives good results.

Introduction

The versatile Perfect gDNA Blood Mini Kit allows the researcher to isolate gDNA from a variety of biological samples, including buffy coat. The purification method is based on Proteinase K lysis followed by collection of the crude high molecular weight gDNA on a membrane. The gDNA is then washed to remove contaminants and eluted in a buffer suitable for common downstream applications such as PCR and restriction digest. The method is spin-column-based and simply requires the use of a standard microcentrifuge. No additional purification is required.

Buffy coat is the component of whole blood that contains leukocytes and platelets and makes up only 1% of the entire whole blood composition. Separating out this particular component enables the researcher to enrich the DNA-containing leukocytes and eliminate the heme-containing red blood cells. The buffy coat layer is difficult to see and pipette. It is viscous and is present as a thin milky layer above the lower red blood cell layer. Although separating the blood into its components requires an additional step, the benefits of higher gDNA concentration and yield out-weigh the extra effort.

Materials
  • Perfect gDNA Blood Mini Kit
Additional items needed:
  • Ethanol (95100%); pipette tips; Eppendorf microcentrifuge; Eppendorf Thermomixer set at 900 rpm and 70C
  • Whole blood samples from three individuals were collected in Vacutainer (Becton Dickinson tubes) containing three different types of preservatives: EDTA, Sodium Heparin and Sodium Citrate
Method

Several experiments were carried out to validate the performance of the kit when using buffy coat. Volumes ranging from 20 l to 200 l of buffy coat were taken from an entire vial (3 ml) of blood and tested for handling, yield, concentration, and purity as well as downstream applications such as PCR1. The method outlined below provides a step-by-step procedure for separation of buffy coat and isolation of gDNA from either a whole vial of blood or an aliquot of blood.

Entire vial of blood:
The term vial refers to the tubes typically used for collection of the blood. Vacutainer (Becton Dickinson, USA) is an example of this type of vial. These vials are usually glass and may hold various amounts of blood with 1.5 ml being the minimum amount required for this procedure.

  1. Centrifuge vial at 1,500 x g for 10 minutes in a clinical centrifuge.
  2. Pipette 200 l of buffy coat for each sample to be processed into a fresh microcentrifuge tube.
    The buffy coat is seen as a milky white layer between the clear upper plasma layer and the lower red blood cell layer. The buffy coat layer will be very viscous. Take care when pipetting. Pipetting the buffy coat may be easier if some of the clear plasma layer is removed from the top first.
  3. Add 20 l of Proteinase K solution to the microcentrifuge tube. Add 350 l Solution G1 to the same tube.
  4. Vortex vigorously for 5 seconds. This step is very important due to the presence of high numbers of white blood cells.
  5. Incubate samples in a Thermomixer at 70C, 900 rpm, for 10 minutes. A water bath may be used with intermittent vortexing of the samples if a Thermomixer is not available.
  6. Add 200 l Solution G2 to the tube. Vortex vigorously for 5 seconds. Place a spin column in a fresh microcentrifuge tube. Transfer the sample to the spin column assembly by pouring or pipetting. Incubate the sample at room temperature for 1 minute.
  7. Centrifuge the sample for 2 minutes at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  8. Add 600 l Diluted Wash Buffer to the spin column. Centrifuge for 1 minute at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  9. Add 400 l Diluted Wash Buffer to the spin column. Centrifuge for 3 minutes at 12,00016,000 x g. Carefully remove the spin column without splashing Wash Buffer onto the bottom of the column. Place the spin column into a fresh microcentrifuge tube.
  10. Observe the filter membrane to make sure it is dry before proceeding. If the filter looks shiny, spin an additional 1 to 2 minutes before placing the spin column into the fresh microcentrifuge tube.
  11. Add 200 l Elution Buffer to the center of the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
1.5 ml of blood:
The following protocol is intended for the researcher who wants to use only an aliquot of a whole blood sample for isolation of gDNA. An aliquot of the whole blood sample may be removed from the vial using a syringe and placed in a microcentrifuge tube. The blood is usually drawn under vacuum conditions into the vial. It is important that the aliquot of blood removed from the vial is used right away to avoid changing the properties of the blood.
  1. Transfer 1.5 ml of whole blood to a microcentrifuge tube.
  2. Centrifuge tube at 3,000 x g for 10 minutes per microcentrifuge.
  3. Continue with step 3 from the protocol outlined above.
Gel Electrophoresis:
200 ng (based on OD reading) was run on a 0.6% agarose gel in 1x TBE. The gel was stained in ethidium bromide. Consistency of bands as well as band size from sample to sample was evaluated.

PCR:
gDNA was isolated from the buffy coat of three individuals. 50 ng of template was used for each individual in 30 l PCR reactions. The following Eppendorf PCR reagents were used in the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:
94C for 5 minutes; initial denaturation
35 cycles:
94C for 1 minute denaturation
69.6C for 20 seconds annealing
72C for 2 minutes extension
72C for 5 minutes final extension
15C hold

Results and Discussion

The Perfect gDNA Blood Mini Kit is an effective method for the isolation of high molecular weight gDNA from buffy coat in higher concentrations than using whole blood samples. With only one additional handling step the researcher can isolate pure, high molecular weight gDNA (see Fig. 1). Even decreasing the buffy coat sample to 100 l leads to an increase in concentration over whole blood. The average concentration observed from 200 l of buffy coat is about 3 times higher than of gDNA isolated from 200 l of whole blood (see Table. 1). Heme-containing red blood cells are removed in the buffy coat application, lowering the risk of heme contamination and increasing the efficiency of downstream applications such as PCR (see Fig. 2).

Preservative Average
A260/280
Average Concentration
(g/ml)
Average Total Yield (g) 200 l Buffy Coat EDTA 1.77 105.9 19.26 Heparin 1.68 87.88 17.35 Sodium Citrate 1.35 46.9 9.38 200 l Whole Blood EDTA 1.68 31.6 6.32 Heparin 1.63 33.5 6.69 Sodium Citrate 1.6 16.3 5.26 Table 1: Yield and purity data comparing buffy coat and whole blood Fig. 1: gDNA isolated from 200 l of Buffy Coat using the Perfect gDNA Blood Mini Kit.
200 ng DNA on 0.6 % agarose gel in 1x TBE

Lane 1: Lambda Hind III Marker (NEB) Lanes 210: gDNA from buffy coat separated from whole blood preserved with EDTA Lanes 1119: gDNA from buffy coat separated from whole blood preserved with Sodium Heparin Fig. 2: PCR of gDNA isolated from buffy coat using the Perfect gDNA Blood Mini Kit.
15 l of the 30 l PCR reaction was loaded on a 1% agarose gel in 1x TBE

Lane 1: Lambda Hind III Marker (NEB) Lanes 24: 50 ng template/EDTA preservative Lanes 57: 50 ng template/Sodium Heparin preservative Lanes 89: 50 ng template/Sodium Citrate preservative Lane 10: no template control Lane 11: no primer control Lane 12: positive human gDNA control Lane 13: negative plasmid DNA control References
  1. Use of the Polymerase Chain Reaction (PCR) process to amplify nucleic acids is covered by U.S. Patent Numbers 4683105 and 4683202 owned by Roche Molecular and requires a license.

'"/>

Source:


Page: All 1 2 3 4 5 6 7 8

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)

Post Your Comments:
(Date:11/24/2009)...and,November24/PRNewswire-FirstCall/--deCODE,genet...allofits,"firstday"motionsbytheU.S.BankruptcyCourt...CODElastweekfiledavoluntarypetitionfor,reliefunder...nkruptcyCourt. , TheordersissuedbytheBankrupt...essduringtheChapter11proceedings.Inparticular,the,...
(Date:11/24/2009)...4/PRNewswire-Asia/--ShanghaiBiolaxyannouncedthe,Ch...ovedthe,investigationalnewdrugapplication(IND)fori...ormulationtotreatdiabetes.ThisIND,approvalallowsBi... Diabetesisadisordercharacteristicofhighbloodgluco...enresultinseveremicro-and,macro-vasculardiseases,l...
(Date:11/24/2009)...yendpointhasbeenmetforpatientswithadvanced-stage,o....24/PRNewswire-FirstCall/-AEternaZentarisInc.(NASD...euticalcompanyfocusedonendocrinetherapyandoncology...ywithitstargetedcytotoxicpeptideconjugate,AEZS-108...endometrialcancer.Inapersonalizedhealthcareapproac...
(Date:11/24/2009)...4,2009/PRNewswire-FirstCall/--ArenaPharmaceuticals...isscheduledtopresentatthePiperJaffray21stAnnualHea...nTime(8:30a.m.PacificTime)attheNewYorkPalaceHoteli...ecutiveOfficer,isscheduledtoprovideanoverviewofthe...yprograms. ,, Aliveaudiowebcastofthepresentatio...
Breaking Biology Technology:deCODE genetics, Inc. Announces Approval of First Day Motions by Bankruptcy Court 2deCODE genetics, Inc. Announces Approval of First Day Motions by Bankruptcy Court 3Biolaxy Secures IND Approval for Oral Insulin 2AEterna Zentaris Announces Positive Results for Phase 2 Study with LHRH-Receptor Targeted Cytotoxic Conjugate AEZS-108 in Endometrial Cancer 2AEterna Zentaris Announces Positive Results for Phase 2 Study with LHRH-Receptor Targeted Cytotoxic Conjugate AEZS-108 in Endometrial Cancer 3AEterna Zentaris Announces Positive Results for Phase 2 Study with LHRH-Receptor Targeted Cytotoxic Conjugate AEZS-108 in Endometrial Cancer 4Arena Pharmaceuticals to Present at the Piper Jaffray 21st Annual Health Care Conference 2
... Micromet, Inc.,(Nasdaq: MITI ), a biopharmaceut...ies for the treatment of cancer, inflammation and ...stian Itin, President and Chief,Executive Officer ...cial,Group,s SIGnificant Investment Options Confer...he W Hotel in New York., Dr. Itin,s presentation ...
...r Group: CNN Expose Highlights Urgent Need for ...ARBARA, Calif., Feb. 29 CNN,s recent expose on,as...g reality that the,deadly carcinogen is virtually ...stos was used heavily in Navy ships and shipyards;...ding drywalls, flooring,roofing materials, and cem...
...endle (Nasdaq: KNDL ), a,leading, global full-ser...ed that Vice President and Chief Marketing Officer...nnual Raymond James,Institutional Investors Confer...ency Grand Cypress in Orlando, March 2-5, 2008. Ke...rch 5 at 1:40 p.m. Eastern Time., (Logo: http://...
Other Biology Technology:Micromet to Present at the Susquehanna Financial Group's SIGnificant Investment Options Conference on March 4, 2008 2Calling for a Cure 2Kendle to Present at the 29th Annual Raymond James Institutional Investors Conference 2
(Date:11/23/2009)... Southern California biomedical engineer and cardi...tool to help clinicians distinguish cardiac emerge...blems manageable with drugs and lifestyle change. ...into the arteries feeding the heart, offer an insi... blood vessels, often revealing deposits of a dang...
(Date:11/23/2009)...stitute of General Medical Sciences (NIGMS), part ...esting $42.3 million for grants in scientific area... developed the GO grant program to stimulate biome...d by the American Recovery and Reinvestment Act (R...t promise to have a significant impact on a field ...
(Date:11/23/2009)...eo Casabona is Director of the Interuniversity Pro...University and the University of the Basque Countr... but also has other experts such as researchers in...n specialists in ethics. , The Interuniversity P...niversities of Deusto and the Basque Country was c...
Breaking Biology News(10 mins):Stable plaque or heart attack plaque? USC researcher builds new sensor to tell which is which 2NIGMS invests in scientific Grand Opportunities with Recovery Act funds 2NIGMS invests in scientific Grand Opportunities with Recovery Act funds 3Research and legislation should go hand in hand, as much as possible 2Southern California Surgical Center 28heart411 com 29 Specializes in Mitral Valve Replacement 52836 1Southern California Surgical Center 28heart411 com 29 Specializes in Mitral Valve Replacement 52836 2Zimmer Launches New Medical Education and BioSkills Training Program 13214 1Zimmer Launches New Medical Education and BioSkills Training Program 13214 2Zimmer Launches New Medical Education and BioSkills Training Program 13214 3Zimmer Launches New Medical Education and BioSkills Training Program 13214 4American Oriental Bioengineering to Report Second Quarter 2009 Financial Results on August 7 2009 13212 1
...N (05-28-09) -- Biomedical engineers at Boston Uni...or James J. Collins and colleagues have wired a ne...nt discrete events, opening the door for a host of...delivery and sensing environmental hazards. , "T... addressed within synthetic biology: Can you count...
...rchers from the Ludwig Institute for Cancer Resear...ol of Medicine have uncovered a remarkable propert...r cell division. Understanding how the contractil...elopment of therapies to prevent uncontrolled cell... even though both cell volume and the length of t...
...is release is available in Spanish . , In the ...e research works that throw light on global warmin...tudies on atmospheric aerosol, a suspension of sol...at can contribute to the warming or cooling of the...oped his doctoral thesis "Lidar Technique for atmo...
Other Biology News:Boston University biomedical engineers teach bacteria to count 2Boston University biomedical engineers teach bacteria to count 3Study may aid efforts to prevent uncontrolled cell division in cancer 2A research work will be the reference to characterize the climatic impact of desert dust 2
...easy-to-use operating environment for simplified i...gration with regulatory compliance requirements. C...e-analysis, custom reports, and data management in...utions assistant bar provides easy navigation betw...
Corning Resuable Pp Vial Rack, Non-Sterile, 50 Positions, Self Locking Design from Sigma-Aldrich
Corning Cryo Vial Rack, PC, Holds 30 Self-Standing Vials, Non-Sterile from Sigma-Aldrich
Benchtop Laminar Hood (Universal Hood) from Terra Universal, Inc.
Biology Products: