Navigation Links
Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood ,,, Mini Kit

fresh microcentrifuge tube.
  • Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
  • PCR:
    Samples were tested in the common buccal swab application, PCR. Each type of swab was tested in amplification of 536 bp and 2 kb fragments. 5 l of the sample eluate was used in each PCR reaction. The following Eppendorf PCR reagents were used, with the concentrations or amounts specified in parenthesis:

    Taq DNA Polymerase (0.05 Units/l)
    10x Taq DNA Polymerase Buffer (1x)
    25 mM MgCl2 (0.5 mM)
    dNTP Mix (0.2 mM)

    Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

    536 bp fragment
    Forward:
    5 GCAGCTACACAGCTACCATTCTGC 3
    Reverse:
    5 GCAGCCTCACCTTCTTTCATGGAGT 3

    2 kb target:
    Forward:
    5 GAAGAGCCAAGGACAGGTAC 3
    Reverse:
    5 CCTCCAAATCAAGCCTCTAC 3

    PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

    536 bp fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45 seconds
    70C for 20 seconds
    72C for 45 seconds
    72C for 5 minutes final extension
    15C hold

    2 kb fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45
    '"/>

    Source:


    Page: All 1 2 3 4 5

    Related biology technology :

    1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
    2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
    3. Easily Amplify Genomic DNA with Long-Distance PCR
    4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
    5. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    7. Mouse Tail Genomic DNA Isolation Protocol(1)
    8. Genomic DNA Isolation Protocol(1,2,3)
    9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    11. Genomic DNA Isolation Protocol(1,2,3)
    Post Your Comments:
    (Date:7/11/2014)... 2014 , Not for release, publication ... from any jurisdiction where to do so would constitute a ... Shire plc ("Shire" or the "Company") (LSE: SHP, NASDAQ: ... confirms it has held a meeting with representatives of AbbVie. ... the prior agreement or approval of AbbVie. A ...
    (Date:7/11/2014)...  Researchers have pioneered a revolutionary new way ... called Virtual Finger, allows scientists to move through ... synapses using the flat surface of their computer ... studies orders of magnitude more efficient, saving time, ... many areas of experimental biology. The software and ...
    (Date:7/10/2014)... 10, 2014 Understanding the need for ... lines, and the gap that currently exists in this ... its industry-leading portfolio of validated ion channel and GPCR ... cell lines, as ion channels control many critical physiological ... activity creates the potential to treat a variety of ...
    (Date:7/10/2014)... July 10, 2014 EvoDerma ’s NOOME ... This rejuvenating device now comes with a second treatment cup ... time. , The new cup is thinner on the edges ... to target rough, thin and uneven surfaces on the face, ... for a stimulating treatment on areas such as the cheeks ...
    Breaking Biology Technology:Shire plc - Statement re: Media Speculation 2Virtual Finger Enables Scientists To Navigate And Analyze 3D Images Of Complex Biological Structures 2Virtual Finger Enables Scientists To Navigate And Analyze 3D Images Of Complex Biological Structures 3Leader in Ion Channel Research Announces Newly Validated and Re-Engineered Cells 2Leader in Ion Channel Research Announces Newly Validated and Re-Engineered Cells 3Introducing a New Bonus Treatment Cup for EvoDerma’s NOOME Anti-Aging Motion 2
    ... A report on the California biomedical industry published ... success stories from Larta Institute, a consulting firm that ... to market. According to CHI,s 2011 ... growing force in the past few years in the ...
    ... BOSTON, Feb. 11, 2011 Tufts University today announced ... Partnerships Web site/HUB:   www.tuftspharmapartners.org .   ... designed to create and manage a diverse portfolio of ... Institute was developed and is managed by Tufts University ...
    ... LOS ANGELES, Feb. 11, 2011 Genesis Biopharma, ... a biotechnology company developing targeted cancer therapies, today announced ... Chief Executive Officer.  Mr. Cataldo succeeds Robert Brooke, who ...  In addition, the Company named Michael Handelman as Chief ...
    Cached Biology Technology:Larta Institute NIH Success Stories Featured in 2011 California Biomedical Industry Report 2Tufts Launches Institute for Biopharmaceutical Partnerships 2Tufts Launches Institute for Biopharmaceutical Partnerships 3Tufts Launches Institute for Biopharmaceutical Partnerships 4Genesis Biopharma Announces Management and Board Changes 2Genesis Biopharma Announces Management and Board Changes 3
    (Date:7/11/2014)... Conservation Society shows that no-take zones in Belize ... as lobster, conch, and fish recover from overfishing, ... , The reporttitled "Review of the Benefits of ... from no-take areas around the world. The report ... expert in marine protected areas and fisheries management. ...
    (Date:7/11/2014)... The Mills Canyon fire started near the City of ... of local resources, the fire quickly grew to over ... cause of the fire is under investigation by the ... is working with existing local resources in developing fire ... Forest Service (USFS), Washington State Department of Natural Resources, ...
    (Date:7/11/2014)... available in German . ... that uses the refraction of X-rays through a specimen ... with this method are often of much higher quality ... team of Prof. Franz Pfeiffer are particularly interested in ... including X-ray phase-contrast imaging. One main goal is ...
    Breaking Biology News(10 mins):Belize's lobster, conch, and fish populations rebuild in no-take zones 2New simple setup for X-ray phase contrast 2
    ... that tamps down stem cell activity ironically, perhaps, encourages ... researchers report. Understanding how these new brain cells "decide" ... is of special interest because changes in their activity ... illness and aging. "We,ve identified a critical ...
    ... United States has resulted in the discovery of a ... diseases particularly eosinophil-associated disorders. The researchers from ... have discovered how this pathway kills eosinophils before they ... the blood, but when the body produces too many ...
    ... researchers have found that zinc can ,starve, one of ... of an essential metal. The finding, by infectious ... University of Queensland, opens the way for further work ... Streptococcus pneumoniae . Streptococcus pneumoniae is ...
    Cached Biology News:SIGNAL found to enhance survival of new brain cells 2Discovery may lead to new treatments for allergic diseases 2How zinc starves lethal bacteria to stop infection 2
    ...
    Mouse monoclonal [H4B4] to LAMP2 - Lysosome Marker (Phycoerythrin) ( Abpromise for all tested applications). entrezGeneID: 3920 SwissProtID: P13473...
    Mouse monoclonal [IA-C6] to MHC Class II I Ab + Ad (FITC) ( Abpromise for all tested applications). Antigen: Tissue / cell preparation of Purified Mouse lymph node B cells...
    ...
    Biology Products: