Navigation Links
Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood ,,, Mini Kit

fresh microcentrifuge tube.
  • Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
  • PCR:
    Samples were tested in the common buccal swab application, PCR. Each type of swab was tested in amplification of 536 bp and 2 kb fragments. 5 l of the sample eluate was used in each PCR reaction. The following Eppendorf PCR reagents were used, with the concentrations or amounts specified in parenthesis:

    Taq DNA Polymerase (0.05 Units/l)
    10x Taq DNA Polymerase Buffer (1x)
    25 mM MgCl2 (0.5 mM)
    dNTP Mix (0.2 mM)

    Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

    536 bp fragment
    Forward:
    5 GCAGCTACACAGCTACCATTCTGC 3
    Reverse:
    5 GCAGCCTCACCTTCTTTCATGGAGT 3

    2 kb target:
    Forward:
    5 GAAGAGCCAAGGACAGGTAC 3
    Reverse:
    5 CCTCCAAATCAAGCCTCTAC 3

    PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

    536 bp fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45 seconds
    70C for 20 seconds
    72C for 45 seconds
    72C for 5 minutes final extension
    15C hold

    2 kb fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45
    '"/>

    Source:


    Page: All 1 2 3 4 5

    Related biology technology :

    1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
    2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
    3. Easily Amplify Genomic DNA with Long-Distance PCR
    4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
    5. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    7. Mouse Tail Genomic DNA Isolation Protocol(1)
    8. Genomic DNA Isolation Protocol(1,2,3)
    9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    11. Genomic DNA Isolation Protocol(1,2,3)
    Post Your Comments:
    (Date:9/30/2014)... . , Electrical ... a new kind of building block for digital integrated ... be based on three-dimensional arrangements of nanometer-scale magnets instead ... semiconductor industry CMOS fabrication of silicon chips ... the University of Notre Dame are exploring "magnetic computing" ...
    (Date:9/30/2014)... NEW YORK , Sept. 30, 2014 /PRNewswire/ ... trends and segments with highest potential revenues Do ... Visiongain,s updated report gives you revenue predictions for ... ahead. For those therapies you find financial data, ... new analysis you get sales forecasts to 2024 ...
    (Date:9/30/2014)... the last decade, the laboratory filtration market is experiencing ... acceptance of new filtration technologies in end users market. ... catalyzing the growth of laboratory filtration market. , The ... a strong CAGR during the forecast period of 2014-2019 ... 2019. The market is mainly driven by the increasing ...
    (Date:9/30/2014)... Md. , Sept. 30, 2014  RegeneRx ... today announced that it has received a Canadian ... by Actin-Sequestering Peptides.  This patent includes claims using ... numerous other actin-sequestering peptides for these purposes.  The ... About RegeneRx Biopharmaceuticals, Inc. ( www.regenerx.com ) ...
    Breaking Biology Technology:A new dimension for integrated circuits: 3-D nanomagnetic logic 2A new dimension for integrated circuits: 3-D nanomagnetic logic 3Biosimilars and Follow-On Biologics: World Industry and Market Prospects 2014-2024 2Biosimilars and Follow-On Biologics: World Industry and Market Prospects 2014-2024 3Biosimilars and Follow-On Biologics: World Industry and Market Prospects 2014-2024 4Biosimilars and Follow-On Biologics: World Industry and Market Prospects 2014-2024 5Global Laboratory Filtration Market To See 7.0% CAGR to 2019 Says a Research Report Available at ReportsnReports.com 2Global Laboratory Filtration Market To See 7.0% CAGR to 2019 Says a Research Report Available at ReportsnReports.com 3Global Laboratory Filtration Market To See 7.0% CAGR to 2019 Says a Research Report Available at ReportsnReports.com 4Global Laboratory Filtration Market To See 7.0% CAGR to 2019 Says a Research Report Available at ReportsnReports.com 5RegeneRx Receives Canadian Patent for Inhibition or Reversal of Skin Aging 2
    ... neurodegeneration , , Rob D. Dickerman a ... McConathy a,b , a Department of Medicine, ... Science Center , , This article describes an innovative ... (hNT Neurons) to imitate the,aging human brain, neurodegeneration, and ...
    ... Seamless insertion and one-step purification from a ... One-Column Purification, and FLAG ,Epitope Tagging in ... John Bauer Peter,Vaillancourt ,Stratagene , Stratagene ... cloning kit,with the new pCAL-n-FLAG vector. This new ...
    ... Retroviral libraries with high-titer efficiency and larger ... Retroviral cDNA Expression Libraries , Katherine Felts ... Jamie,Limjoco ,Anna Waesche Peter Vaillancourt ,Stratagene ... cDNA expression libraries inserted into the,high-titer retroviral ...
    Cached Biology Technology:Sex Steroid Regulation of Vasopressin Levels Secreted by hNT Neurons* 2Sex Steroid Regulation of Vasopressin Levels Secreted by hNT Neurons* 3Sex Steroid Regulation of Vasopressin Levels Secreted by hNT Neurons* 4Sex Steroid Regulation of Vasopressin Levels Secreted by hNT Neurons* 5Sex Steroid Regulation of Vasopressin Levels Secreted by hNT Neurons* 6Sex Steroid Regulation of Vasopressin Levels Secreted by hNT Neurons* 7High-Level Protein Expression, One-Column Purification, and FLAG,Epitope Tagging in E. coli 2High-Level Protein Expression, One-Column Purification, and FLAG,Epitope Tagging in E. coli 3High-Level Protein Expression, One-Column Purification, and FLAG,Epitope Tagging in E. coli 4High-Level Protein Expression, One-Column Purification, and FLAG,Epitope Tagging in E. coli 5High-Level Protein Expression, One-Column Purification, and FLAG,Epitope Tagging in E. coli 6High-Level Protein Expression, One-Column Purification, and FLAG,Epitope Tagging in E. coli 7High-Level Protein Expression, One-Column Purification, and FLAG,Epitope Tagging in E. coli 8Functional Cloning Using,ViraPort Retroviral cDNA Expression Libraries 2Functional Cloning Using,ViraPort Retroviral cDNA Expression Libraries 3Functional Cloning Using,ViraPort Retroviral cDNA Expression Libraries 4Functional Cloning Using,ViraPort Retroviral cDNA Expression Libraries 5Functional Cloning Using,ViraPort Retroviral cDNA Expression Libraries 6Functional Cloning Using,ViraPort Retroviral cDNA Expression Libraries 7Functional Cloning Using,ViraPort Retroviral cDNA Expression Libraries 8Functional Cloning Using,ViraPort Retroviral cDNA Expression Libraries 9Functional Cloning Using,ViraPort Retroviral cDNA Expression Libraries 10Functional Cloning Using,ViraPort Retroviral cDNA Expression Libraries 11
    (Date:9/30/2014)... conducted by the Ocean Health Index rates the ... overall health. In addition, for the first time, ... ocean regions beyond national jurisdiction (high-seas areas) ... safeguarding biodiversity and providing sustainable food sources. , ... a partnership led by scientists from UC Santa ...
    (Date:9/30/2014)... scientists and engineers, led by Clemson University associate ... million grant from the U.S. Department of Energy,s ... a direct positive impact on South Carolina in ... radioactive contaminants. , "Understanding the scientific and engineering ... aspects of nuclear technologies is imperative if South ...
    (Date:9/30/2014)... urban and farm runoff in Hawaii is causing tumors ... , The study, published Tuesday in the peer-reviewed open-access ... runoff ends up in algae that the turtles eat, ... flippers and internal organs. , Scientists at Duke University, ... Atmospheric Administration (NOAA) conducted the study to better understand ...
    Breaking Biology News(10 mins):Rating the planet's oceans 2Rating the planet's oceans 3Researchers get $5.25 million to advance nuclear technologies in South Carolina 2Pollution linked to lethal sea turtle tumors 2Pollution linked to lethal sea turtle tumors 3
    ... (August 27, 2013) When a woman becomes pregnant, ... to ensure both the health of herself and the health ... of Periodontology (AAP) and the Eurpean Federation of Periodontology (EFP) ... has indicated that women with periodontal disease may be at ...
    ... CA August 27, 2013 A recently reported ... injury could enable more timely therapeutic intervention in transplant ... As described by scientists at the University Medical Center ... new method uses Bio-Rad Laboratories, Droplet Digital PCR ...
    ... tend to be slightly smarter is due in roughly equal ... taller people are more likely than average to mate with ... the University of Colorado Boulder. The study did ... being taller and being smarter, both traits that people tend ...
    Cached Biology News:Expectant mothers' periodontal health vital to health of her baby 2Researchers develop rapid, cost-effective early detection method for organ transplant injury 2Researchers develop rapid, cost-effective early detection method for organ transplant injury 3CU study relies on twins and their parents to understand height-IQ connection 2CU study relies on twins and their parents to understand height-IQ connection 3
    ... temperature control for microbiology and cell culture. ... is suitable for DASGIP bioreactors from 150 ... temperature ranges from approximately 10 °C to ... with an individual electrical heating element with ...
    ... gel stain is a sensitive nucleic acid ... to RNA and low background in gels, making ... polyacrylamide gels using laser scanners or standard UV ... mL unit size (S-7568) and a special packaging ...
    ... reports the data from any one of IITC ... recorder. The final data is sent from the ... is automatic for Systolic, Mean, Heart Rate while ... is always in the position to override the ...
    Sirtuin 7 (SIRT7) Rabbit anti-Human Polyclonal Antibody Immunogen: Synthetic peptide - KLH conjugated Family: Other Recommended Storage: Long term: -20C; Short term: +4C...
    Biology Products: