Navigation Links
Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood ,,, Mini Kit

fresh microcentrifuge tube.
  • Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
  • PCR:
    Samples were tested in the common buccal swab application, PCR. Each type of swab was tested in amplification of 536 bp and 2 kb fragments. 5 l of the sample eluate was used in each PCR reaction. The following Eppendorf PCR reagents were used, with the concentrations or amounts specified in parenthesis:

    Taq DNA Polymerase (0.05 Units/l)
    10x Taq DNA Polymerase Buffer (1x)
    25 mM MgCl2 (0.5 mM)
    dNTP Mix (0.2 mM)

    Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

    536 bp fragment
    Forward:
    5 GCAGCTACACAGCTACCATTCTGC 3
    Reverse:
    5 GCAGCCTCACCTTCTTTCATGGAGT 3

    2 kb target:
    Forward:
    5 GAAGAGCCAAGGACAGGTAC 3
    Reverse:
    5 CCTCCAAATCAAGCCTCTAC 3

    PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

    536 bp fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45 seconds
    70C for 20 seconds
    72C for 45 seconds
    72C for 5 minutes final extension
    15C hold

    2 kb fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45
    '"/>

    Source:


    Page: All 1 2 3 4 5

    Related biology technology :

    1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
    2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
    3. Easily Amplify Genomic DNA with Long-Distance PCR
    4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
    5. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    7. Mouse Tail Genomic DNA Isolation Protocol(1)
    8. Genomic DNA Isolation Protocol(1,2,3)
    9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    11. Genomic DNA Isolation Protocol(1,2,3)
    Post Your Comments:
    (Date:12/19/2014)... 19, 2014 Naurex Inc., a biopharmaceutical company ... diseases of the central nervous system, today announced that ... officer, will present at the 33 rd annual ... place at 3:00 p.m. PST on Tuesday, January 13, ... San Francisco, Calif. About ...
    (Date:12/19/2014)... Mass. , Dec. 19, 2014 Decision ... market will grow at a 12 percent compound annual ... result of the aging population and the increasing adoption ... Latin America will also spur demand for ... of dental implant and periodontal treatments. Other ...
    (Date:12/19/2014)... 18, 2014 Today, TiFiber, ... pilot production facility and future company headquarters in ... innovative new materials that safely and effectively control ... because of its historic, strong support for manufacturing, ... attract leading edge, technology-based companies such as TiFiber. ...
    (Date:12/19/2014)... MA (PRWEB) December 18, 2014 Reports ... in the United States suffer from one or more ... asthma, or cancer. Medication can address some of these ... daily activities that many sufferers face. While implanted nerve ... and stimulate the whole nerve, which can induce side ...
    Breaking Biology Technology:Naurex to Present at 33rd Annual J.P. Morgan Healthcare Conference 2Latin American Dental Biomaterial Market Will Expand at a 12 Percent Annual Growth Rate Through 2023 2Latin American Dental Biomaterial Market Will Expand at a 12 Percent Annual Growth Rate Through 2023 3Technology Company TiFiber™ to Establish Production Facility in Fort Smith, Arkansas with Support from Local Investors 2Technology Company TiFiber™ to Establish Production Facility in Fort Smith, Arkansas with Support from Local Investors 3Technology Company TiFiber™ to Establish Production Facility in Fort Smith, Arkansas with Support from Local Investors 4Draper Wins GSK Funding for Smaller, Smarter Implantable Devices 2
    ... could improve the life of the lithium batteries ... players, and mobile phones. Research to be published ... Nanomanufacturing - demonstrates that carbon nanotubes can prevent ... time. , Researchers at the Shenyang National Laboratory ...
    ... 10 Hologic, Inc.,(Nasdaq: HOLX ) today ... presenting at the Sun Trust Robinson Humphrey,s 37th ... Ritz-Carlton Hotel in,Buckhead, GA., Interested parties are ... of,Hologic,s investor presentation on Wednesday, April 16, 2008, ...
    ... are 14 prescription drugs that,exceeded $20 billion in sales in ... in four years. Prescription to OTC switches,were frequent in 2006 ... of the Rx to OTC Switch: Market Analysis and Product ... Rx to OTC are forecast to reach $5 billion in ...
    Cached Biology Technology:Sweet nanotech batteries 2Hologic to Present at the Sun Trust Robinson Humphrey's 37th Annual Institutional Conference 2Use of Rx to OTC Switch as Product Management Tactic Enjoys Comeback 2
    (Date:12/3/2014)... 2, 2014 As part of our commitment ... is pleased to announce the release of a new ... collect the workforce data that they need. ... left by existing readers. Many such devices have serious ... modern technology. Older models force users to navigate numerous ...
    (Date:11/21/2014)... Nov. 20, 2014 C-Labs LLC, a leading ... of Things (IoT), today announced the appointment of ... officer. Previously a strategic advisor to the firm, Mr. ... Mr. Traynor is based out of the C-Labs office ... to Chris Muench , Chief Executive Officer. ...
    (Date:11/18/2014)... -- The Parenteral Drug Association (PDA) today confirmed that seven ... at least seven more will participate in the upcoming 2014 ... in Washington D.C. , Dec. 2-4. ... from the regulatory agencies in the United States ... effort to help advance the use of metrics in the ...
    Breaking Biology News(10 mins):Inception Technologies to Release New Biometric Reader 2C-Labs Names Former Microsoft and Bsquare Executive as Chief Operating Officer 2FDA's Janet Woodcock, EMA's Emer Cooke Headline PDA Quality Metrics Conference 2
    ... ahead of a deadly disease that has wiped out more ... continue to discover new frog species in Panama: Pristimantis ... adnus from Darien Province near the Colombian border. , ... world. Then they identified the cause: a fungal disease called ...
    ... Irvine scientists have created an eight-layer, early-stage retina from ... to be made from stem cells. It also ... retinas to treat eye disorders such as retinitis pigmentosa ... a complex structure consisting of many cell types," said ...
    ... Medicine have identified in mice a previously unknown protective ... clots and other blockages from the brain. The findings ... age-related cognitive decline, Alzheimer,s disease and recovery from stroke. ... May 27 issue of Nature by Jaime ...
    Cached Biology News:2 new frog species discovered in Panama's fungal war zone 2UCI researchers create retina from human embryonic stem cells 2Researchers discover new mechanism for clearing blockages from smallest blood vessels 2
    ... and ES1301 mutS are mismatch repair minus ... strains prevents repair of the newly synthesized ... efficiencies and making them helpful in such ... II Mutagenesis Systems. Both ES1301 and BMH ...
    Request Info...
    ... ExcelGel DNA Analysis Kit, 1. ... polymorphisms and high resolution DNA typing. ... set-up and clean-up. *Precast, plastic-backed gels ... handling convenience and detection sensitivity. ...
    For the quantitative determination of canine Interferon gamma,(IFN-γ) concentrations in cell culture supernates, serum and,plasma....
    Biology Products: