Navigation Links
Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood ,,, Mini Kit

fresh microcentrifuge tube.
  • Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
    • PCR:
    Samples were tested in the common buccal swab application, PCR. Each type of swab was tested in amplification of 536 bp and 2 kb fragments. 5 l of the sample eluate was used in each PCR reaction. The following Eppendorf PCR reagents were used, with the concentrations or amounts specified in parenthesis:

    Taq DNA Polymerase (0.05 Units/l)
    10x Taq DNA Polymerase Buffer (1x)
    25 mM MgCl2 (0.5 mM)
    dNTP Mix (0.2 mM)

    Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

    536 bp fragment
    Forward:
    5 GCAGCTACACAGCTACCATTCTGC 3
    Reverse:
    5 GCAGCCTCACCTTCTTTCATGGAGT 3

    2 kb target:
    Forward:
    5 GAAGAGCCAAGGACAGGTAC 3
    Reverse:
    5 CCTCCAAATCAAGCCTCTAC 3

    PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

    536 bp fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45 seconds
    70C for 20 seconds
    72C for 45 seconds
    72C for 5 minutes final extension
    15C hold

    2 kb fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45
    '"/>

    Source:


    Page: All 1 2 3 4 5

    Related biology technology :

    1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
    2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
    3. Easily Amplify Genomic DNA with Long-Distance PCR
    4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
    5. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    7. Mouse Tail Genomic DNA Isolation Protocol(1)
    8. Genomic DNA Isolation Protocol(1,2,3)
    9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    11. Genomic DNA Isolation Protocol(1,2,3)
    Post Your Comments:
    (Date:10/15/2008)...ference call and webcast to begin after markets cl...:00 p.m. ET), IRVINE, Calif., Oct. 15 /PRNewswire..., the inventor of Pulse CO-Oximetry and,Measure-Th...day announced,it will release third quarter financ...8 after the market closes on Monday, October 27, 2...
    (Date:10/15/2008)...UBLIN, Calif., Oct. 15 /- S...ompany dedicated to the discovery and,development ...pany,s plans,to present five posters at the 20th E...Cancer Therapeutics" on October 23 and 24, 2008., ... non-clinical advances,in the following compounds:...
    (Date:10/15/2008)...AN FRANCISCO, Oct. 15 /- SourceSoluti...ology and pharmaceutical industries,announced tod... next month,which reduces the time and cost of sc...zations (CMOs/CROs). The proprietary technology wi...ice (SaaS) database. The,database will allow users...
    (Date:10/14/2008)...ently, zinc oxide (ZnO) nanowires have drawn major...nd unique optical and piezoelectric properties. Va...ceived, including the next generation of field eff...d resonators. ZnO nanowires are also envisioned as...conducting and piezoelectric properties. , Resea...
    Breaking Biology Technology:Masimo to Report Third Quarter 2008 Financial Results on October 27, 2008 2SuperGen to Present Data at EORTC-NCI-AACR 2SourceSolution Announces the Launch of Its Initiative to Simplify Outsourcing Decisions for Biotechnology and Pharmaceutical Companies 2Strong elasticity size effects in ZnO nanowires 2Strong elasticity size effects in ZnO nanowires 3
    ...on, Wis. - Nearly a week since its first notifica...ers in Wisconsin, including several served by TDS,...y offering significant reductions in long distance... which is similar to online "Phishing" schemes. , ...red a 35 percent discount on their long-distance s...
    ...ee, Wis. - For future generations of Native Ameri...could lead through some high-tech corridors. , ,An... is adopting a more aggressive investment strategy...chnology industry and the state economy. , ,After ...ant and an IT firmthe Forest County Potawatomi Co...
    ..., Wis. - Organizers of Financial Executives Inte... tax executives, academics, and audit committee me...m for networking and community influence. , ,The g...to share information about the ethics, highest sta...ul of us realized that the business dynamics of th...
    ...some municipalities are fighting AT&T about Projec...cations, others are looking at major fiber-optic i...d off in Utah as we mentioned in last week,s colum...in the Midwest. As one CIO in Jacksonville, Fla. ...nd homes worldwide have a broadband connection to ...
    Other Biology Technology:TDS warns of continuing "Vishing" attempts 2Potawatomis to ramp up their investing 2Potawatomis to ramp up their investing 3Fiber-optic infrastructure spurring city economic development 2Fiber-optic infrastructure spurring city economic development 3Fiber-optic infrastructure spurring city economic development 4
    (Date:10/15/2008)... separate are crucial questions in evolutionary bi...animal species are often infertile or die when sti...uce. A sheep-goat hybrid, the result of a cross be...ch hybrids can also be dysfunctional, for example,...nds from both parent species. , Remarkably, the ...
    (Date:10/14/2008)...e, biomedical and research breakthroughs, notably ...the care of children, improving diagnosis and trea...an Stanley Children,s Hospital of NewYork-Presbyte...ost a conference at the Grand Hyatt New York, titl...e the latest advances in genetics, stem cell thera...
    (Date:10/14/2008)...of the Computational Neurobiology Laboratory at th... of Medicine, the IOM has announced. Election to t...the fields of health and medicine and recognizes i...ssional achievement and commitment to service. ...nguished and influential individuals to the Instit...
    (Date:10/14/2008)...astal dead zones, an increasing concern to ecologi...be as devoid of life after all. A Brown scientist ... life, and that at least one commercially valuable...s. , Andrew Altieri, a post-doctoral researcher ...ogy at Brown University, studied dead zones in Nar...
    Breaking Biology News(10 mins):Turtle doves commit adultery 2Turtle doves commit adultery 3Innovations in Pediatric Medicine CME conference brings together national pediatrics experts 2Innovations in Pediatric Medicine CME conference brings together national pediatrics experts 3Innovations in Pediatric Medicine CME conference brings together national pediatrics experts 4Salk researcher Terry Sejnowski elected to Institute of Medicine 2Brown scientist finds coastal dead zones may benefit some species 2Brown scientist finds coastal dead zones may benefit some species 3Study Determines Breast Specific Gamma Imaging Has Higher Specificity Than MRI in Patients With Equivocal Mammograms 2652 1Study Determines Breast Specific Gamma Imaging Has Higher Specificity Than MRI in Patients With Equivocal Mammograms 2652 2Study Determines Breast Specific Gamma Imaging Has Higher Specificity Than MRI in Patients With Equivocal Mammograms 2652 3MedPage Today 28R 29 Continuing Medical Education Activities Now Offer AAPA Credit for Physician Assistants 2648 1MedPage Today 28R 29 Continuing Medical Education Activities Now Offer AAPA Credit for Physician Assistants 2648 2On screen smoking in movies linked to young adult smoking behavior 2646 1On screen smoking in movies linked to young adult smoking behavior 2646 2Low Doses of Red Wine Chemical May Fight Diabetes 2643 1Low Doses of Red Wine Chemical May Fight Diabetes 2643 2
    ...ucture Initiative (PSI) has established efficient ...apes of proteins, it is creating new mechanisms fo...scientific community. , The 10-year PSI effort, w...nal Institutes of Health,s National Institute of G...tory in September. Next year, it will create an in...
    ...where and how some plant seeds store iron, a valua...e iron content of plants. Their research helps add...malnutrition in humans. , The team found that iron...e seed of Arabidopsis, a model plant used in resea... a plant cell,s central storage site. The research...
    ...y mass index before they become pregnant are 72% m...ree months of pregnancy, but can reduce their risk...esh fruit and vegetables, according to study findi...e findings of a new study, which appears today in ...al of Obstetrics and Gynaecology. The study, from ...
    ... have the potential to alleviate food insecurity a...lieve that biotechnology has the potential to impr...cially, resistance to insects and disease. This co... human and animal consumption. Researchers are al...harmaceutical products in plants, with the potenti...
    Other Biology News:Protein structure initiative launches new resources for the scientific community 2Protein structure initiative launches new resources for the scientific community 3Plant studies reveal how, where seeds store iron 2Underweight women at greater risk of miscarriage 2Underweight women at greater risk of miscarriage 3Are genomic technologies the answer to world hunger? 2
    alpha/beta-Tubulin Antibody Ship: Hot Store: -20 C
    Anti-Kusabira Orange Monoclonal Antibody Description: 100 g Research Focus: tag Storage: -20C Shipping Temperature: 4C
    Caspase-3/7 Inhibitor I from Calbiochem
    PURA Immunogen: PURA (NP_005850, 183 a.a. ~ 293 a.a) partial recombinant protein with GST tag. Storage: -20 C, Avoid Freeze/Thaw Cycles *Available for distribution in the US only
    Biology Products: