Navigation Links
Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood ,,, Mini Kit

fresh microcentrifuge tube.
  • Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
  • PCR:
    Samples were tested in the common buccal swab application, PCR. Each type of swab was tested in amplification of 536 bp and 2 kb fragments. 5 l of the sample eluate was used in each PCR reaction. The following Eppendorf PCR reagents were used, with the concentrations or amounts specified in parenthesis:

    Taq DNA Polymerase (0.05 Units/l)
    10x Taq DNA Polymerase Buffer (1x)
    25 mM MgCl2 (0.5 mM)
    dNTP Mix (0.2 mM)

    Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

    536 bp fragment
    Forward:
    5 GCAGCTACACAGCTACCATTCTGC 3
    Reverse:
    5 GCAGCCTCACCTTCTTTCATGGAGT 3

    2 kb target:
    Forward:
    5 GAAGAGCCAAGGACAGGTAC 3
    Reverse:
    5 CCTCCAAATCAAGCCTCTAC 3

    PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

    536 bp fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45 seconds
    70C for 20 seconds
    72C for 45 seconds
    72C for 5 minutes final extension
    15C hold

    2 kb fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45
    '"/>

    Source:


    Page: All 1 2 3 4 5

    Related biology technology :

    1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
    2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
    3. Easily Amplify Genomic DNA with Long-Distance PCR
    4. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
    5. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    7. Mouse Tail Genomic DNA Isolation Protocol(1)
    8. Genomic DNA Isolation Protocol(1,2,3)
    9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    11. Genomic DNA Isolation Protocol(1,2,3)
    Post Your Comments:
    (Date:7/30/2015)... ... , ... The 2015 Market Research Report on the Global Propanol Industry ... Propanol market with a focus on the Chinese situation. Major companies included in the ... Chemical, Sanofi, Royal Dutch Shell, LG Chem and Zhejiang Xinhua Chemical. , The report ...
    (Date:7/30/2015)... ISN improves the efficiency and effectiveness of contractor management systems. ISN,s online contractor management ... over 80 countries. ... ... Over 60,000 Worldwide Customers In More Than 80 Countries ... Dallas, TX , ISN has additional offices in Calgary , ...
    (Date:7/30/2015)... ... 30, 2015 , ... GEA's Pony™ NS2006L is ... up to 1500 bar. The sanitary design gauge of the NS2006L is well ... The Pony™ NS2006L homogenizer is an ideal solution for the processing of ...
    (Date:7/29/2015)... +14% CER / 20% of sales) led the regional performance in the second ... well as solid contributions from Korea, India and ... East / Africa (Q2 2015: +3% CER ... Turkey and the United Kingdom . The ... HPV sales, on demand across all customer classes. The top seven emerging markets ...
    Breaking Biology Technology:Global Propanol Market Technical Data and Manufacturing Analysis 2020 2Global Propanol Market Technical Data and Manufacturing Analysis 2020 3ISN Reaches Over 60,000 Worldwide Customers 2ISN Reaches Over 60,000 Worldwide Customers 3GEA Announces the Pony™ NS2006L… a Self-contained, High Pressure Lab Homogenizer for Product Development Ensuring Maximum Efficiency and Safety 2QIAGEN Reports Results for Second Quarter and First Half of 2015 2QIAGEN Reports Results for Second Quarter and First Half of 2015 3QIAGEN Reports Results for Second Quarter and First Half of 2015 4QIAGEN Reports Results for Second Quarter and First Half of 2015 5QIAGEN Reports Results for Second Quarter and First Half of 2015 6QIAGEN Reports Results for Second Quarter and First Half of 2015 7QIAGEN Reports Results for Second Quarter and First Half of 2015 8QIAGEN Reports Results for Second Quarter and First Half of 2015 9QIAGEN Reports Results for Second Quarter and First Half of 2015 10
    ... 4, 2010 Four world-renowned,stem cell experts have recently given their ... Blood Bank" which has,just been established in the US by CORD:USE. , ... Cryo-Save ... pleased with this positive development. "We expect that the merit of,private storage ...
    ... Chinese researchers have successfully built an electromagnetic absorbing device ... cylinder comprising 60 concentric rings of metamaterials, is capable ... an astrophysical black hole (which, in space, soaks up ... Thursday, 3 June, in New Journal of Physics ...
    ... June 3 /PRNewswire-FirstCall/ - YM BioSciences Inc. (NYSE Amex:YMI, TSX:YM), ... the newly created position of President and Chief Operating Officer. Dr. ... responsibility for its operations and infrastructure, in particular the development and ... , , ...
    Cached Biology Technology:Scientists Give the Go-Ahead for Private Storage of Stem Cells From Umbilical Cord Blood 2Scientists Give the Go-Ahead for Private Storage of Stem Cells From Umbilical Cord Blood 3Scientists create artificial mini 'black hole' 2YM BioSciences appoints Dr. Nick Glover as President and Chief Operating Officer 2YM BioSciences appoints Dr. Nick Glover as President and Chief Operating Officer 3YM BioSciences appoints Dr. Nick Glover as President and Chief Operating Officer 4YM BioSciences appoints Dr. Nick Glover as President and Chief Operating Officer 5
    (Date:7/7/2015)... June 30, 2015 ... the addition of the "Capacitive Fingerprint Sensors ... To this date, fingerprint sensing technology is ... fingerprint sensors are well developed. This patent landscape ... The domain of capacitive fingerprint sensors ...
    (Date:7/2/2015)... 25, 2015 Research and ... "Next Generation Biometrics Market by Application, Technology, Function ... to their offering. The next generation biometrics ... at a CAGR of 17.9% between 2015 and 2020 ... for the market. Safran SA ( ...
    (Date:6/29/2015)... 2015 Research and Markets( ... "Latin America Biomedical Sensors Market - Growth, Trends & ... The Latin America Biomedical Sensors market is estimated at ... over the period 2014-2020 The near future ... genetic formulation of each individual. These sensors can be ...
    Breaking Biology News(10 mins):Worldwide Capacitive Fingerprint Sensors Patent Landscape Market Report 2015-2020 - Main IP Holders include Seiko Epson, AuthenTec, Sony and STMicroelectronics 2Next Generation Biometrics Market 2015 - Global Forecast to 2020 with Safran, NEC, 3M Cogent, Fujitsu & Suprema Dominating the $24 Billion Market 2Next Generation Biometrics Market 2015 - Global Forecast to 2020 with Safran, NEC, 3M Cogent, Fujitsu & Suprema Dominating the $24 Billion Market 3Latin America Biomedical Sensors Market Report 2015-2020 2
    ... study to examine motor execution in children with autism, ... new insight into the neurological basis of autism. The ... April 23 Brain Advanced Access, compared the brain activity ... developing peers while performing a simple motor tasktapping their ...
    ... of Oceanography at UC San Diego have been unraveling the ... Lake Tahoe one earthquake at a time. Two new studies ... of earthquake activity in the Lake Tahoe region, which suggest ... the basin, and that the largest fault in the basin, ...
    ... / b3c newswire / - Kinaxo Biotechnologies GmbH has ... identify the protein kinase mTOR as a new ... a non-steroidal, anti-inflammatory Cox-2 inhibitor approved for the ... In addition, celecoxib’s anti-proliferative effect has earned it ...
    Cached Biology News:First neuroimaging study examining motor execution in children with autism reveals new insights 2First neuroimaging study examining motor execution in children with autism reveals new insights 3Scripps studies offer new picture of Lake Tahoe's earthquake potential 2KINAXOs Cellular Target Profiling reveals mTOR as a new target of Celebrex 2
    ... CLS number is a new ... match Cornings product number. If ... order under the old Sigma-Aldrich ... service for assistance. Mfr ...
    ... clear polystyrene with frosted labeling surfaces, ... cell counting. 100% integrity tested. Linkage: ... product number, created to easily match ... availability yet, please order under the ...
    ... T7•Tag ® Ek Adaptor encodes a ... binding site (rbs), ATG translation initation codon, ... T7•Tag is a small epitope tag (11 ... the target protein with T7•Tag Monoclonal Antibody ...
    The LIC Duet™ Mini Adaptor encodes a T7 promoter, lac operator, ribosome binding site (rbs), and an ATG translation initation codon. This adaptor is designed for expression of a target protei...
    Biology Products: