Navigation Links
Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood ,,, Mini Kit

fresh microcentrifuge tube.
  • Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
    • PCR:
    Samples were tested in the common buccal swab application, PCR. Each type of swab was tested in amplification of 536 bp and 2 kb fragments. 5 l of the sample eluate was used in each PCR reaction. The following Eppendorf PCR reagents were used, with the concentrations or amounts specified in parenthesis:

    Taq DNA Polymerase (0.05 Units/l)
    10x Taq DNA Polymerase Buffer (1x)
    25 mM MgCl2 (0.5 mM)
    dNTP Mix (0.2 mM)

    Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

    536 bp fragment
    Forward:
    5 GCAGCTACACAGCTACCATTCTGC 3
    Reverse:
    5 GCAGCCTCACCTTCTTTCATGGAGT 3

    2 kb target:
    Forward:
    5 GAAGAGCCAAGGACAGGTAC 3
    Reverse:
    5 CCTCCAAATCAAGCCTCTAC 3

    PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

    536 bp fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45 seconds
    70C for 20 seconds
    72C for 45 seconds
    72C for 5 minutes final extension
    15C hold

    2 kb fragment
    94C for 5 minutes; initial denaturation
    35 cycles:
    94C for 45
    '"/>

    Source:


    Page: All 1 2 3 4 5

    Related biology technology :

    1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
    2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
    3. Easily Amplify Genomic DNA with Long-Distance PCR
    4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    6. Mouse Tail Genomic DNA Isolation Protocol(1)
    7. Genomic DNA Isolation Protocol(1,2,3)
    8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
    9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
    10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
    11. Genomic DNA Isolation Protocol(1,2,3)
    Post Your Comments:
    (Date:11/21/2008)... 21 MichBio, the association for,...00 biosciences professionals,and service provider...ay of,this week at the Rock Financial ShowPlace i...al gathering of Michigan bioscience industry profe...d 56 exhibitors. The 2009 Expo is,planned for Nov...
    (Date:11/21/2008)...ork, Nov. 21 Eli Lilly a...orporated (Nasdaq: IMCL ) today,announced the s...ender offer,by Lilly,s wholly-owned subsidiary, A...g shares of ImClone at a price of $70.00 per share...T, on Thursday, November 20, 2008. , The de...
    (Date:11/21/2008)...RNewswire-FirstCall/ -- LCA-Vision Inc. (Nasdaq:,...ction services under the,LasikPlus(R) brand, toda...ze,to the position of Chief Financial Officer on ...r. Celebrezze, who has served as interim CFO since...tive Management team as Senior Vice,President of ...
    (Date:11/20/2008)...0 BioSpecifics,Technolo...ceutical company,developing first in class collag...cifics, President, Thomas Wegman, will present at ...e Conference on Tuesday, December 2, 2008, at,4:3...Y. , A live webcast of the presentation can...
    Breaking Biology Technology:MichBio Expo Draws Nearly 500 Professionals; Career Day Raises Profile 2MichBio Expo Draws Nearly 500 Professionals; Career Day Raises Profile 3Lilly Completes Cash Tender Offer for ImClone Systems 2Lilly Completes Cash Tender Offer for ImClone Systems 3LCA-Vision Names Michael J. Celebrezze CFO 2LCA-Vision Names Michael J. Celebrezze CFO 3LCA-Vision Names Michael J. Celebrezze CFO 4
    ...consin companies topped $100 million last year, bu...e interesting investment patterns. , ,The figures ...al in Wisconsin: A Progress Report for 2006, which...nsin Technology Council , and the state Departmen...amount of angel investing - $102.9 million - repre...
    ...the full electronic exchange of patient data betwe...oubt that one of the best places to start is the e...e providers took an initial step toward providing ...formation with the formal establishment of the Eme...o the broader adoption of electronic medical recor...
    ...ce Fund (USF) has provided thousands of TDS Tele...ion services. Beginning with traditional wireline ...d Internet service in communities far and wide, th...abled growth. Though much remains to be accomplish...works are updated regularly, the USF has helped bu...
    ...oved for Bruce Mass following his appointment as c...consin-Milwaukee . , ,Rita Hartung Cheng, provost ...d the appointment following a national search. , ,...nagement information systems from UWM. He has serv...siness affairs for the School of Education, the Sc...
    Other Biology Technology:Breaking down Wisconsin's angel capital numbers 2Breaking down Wisconsin's angel capital numbers 3Wireless carriers mislead consumers about USF reform 2Wireless carriers mislead consumers about USF reform 3
    (Date:11/21/2008)...o are exposed to hairspray in the workplace during...g a son with the genital birth defect hypospadias,...ournal Environmental Health Perspectives . , T...etween hairspray and hypospadias, one of the most ...the urinary opening is displaced to the underside ...
    (Date:11/20/2008)...ON, DC Although Americans are becoming increasing...household products like bisphenol A in some baby b... connect typical household products with personal ...ts, according to research from the December issue ..., "People more readily equate pollution with larg...
    (Date:11/20/2008)...TY, Calif., Nov. 19 DigitalPersona...ons, today announced DigitalPersona,Personal 4.0,...viduals, family,members and business users. Digit...ection suite to use biometrics, letting people use...including email, banking, shopping, and other Web,...
    (Date:11/20/2008)...GHResearch from the University of Pittsburgh publi...nally provide evidence of the first stages of the ...hat males and females developed from hermaphroditi... understood because the majority of animal species...rate-sex state too long ago for scientists to obse...
    Breaking Biology News(10 mins):Hairspray is linked to common genital birth defect, says study 2Pollution at home lurks unrecognized, instead attributed to large-scale environmental disasters 2DigitalPersona Places Identity Protection at People's Fingertips 2DigitalPersona Places Identity Protection at People's Fingertips 3Two from one: Pitt research maps out evolution of genders from hermaphroditic ancestors 2Texas Senator Robert Duncan Honored as Champion for Children by The AMERIGROUP Foundation 12062 1Texas Senator Robert Duncan Honored as Champion for Children by The AMERIGROUP Foundation 12062 2Unexplored microbes hold incredible potential for science and industry 2224 1Unexplored microbes hold incredible potential for science and industry 2224 2Unexplored microbes hold incredible potential for science and industry 2224 3Unlike Fine Wine Crabby People Dont Age Well 12058 1Unlike Fine Wine Crabby People Dont Age Well 12058 2Unlike Fine Wine Crabby People Dont Age Well 12058 3Synvista Therapeutics to Present at the Roth 20th Annual OC Growth Stock Conference 12053 1Synvista Therapeutics to Present at the Roth 20th Annual OC Growth Stock Conference 12053 2Synvista Therapeutics to Present at the Roth 20th Annual OC Growth Stock Conference 12053 3
    ...d in a tiny sphere penetrates deeply into ovarian ... and drastically reducing the size of tumors, rese...Cancer Center report in the Aug. 15 edition of Cli...nt, featured on the cover of the journal, demonstr...g RNA (siRNA) to attack cancer, says senior author...
    ...onal Institutes of Health today provided the clear...lation of mutations in two genes associated with a...alled Breast Cancer 1 (BRCA1) and Breast Cancer 2 ...dictors for assessing which women are most likely ...pproximately 200,000 women in the United States ar...
    ...es new understanding of how animals learn--and lea...that bats that use frog acoustic cues to find qual... other bats. While numerous examples are known of ...l learning" to learn new visual and olfactory cues... acoustic cue had not been previously described. T...
    ...nd for the first time in a variety of freshwater f...niversity researchers. , According to experts at ...lege of Veterinary Medicine, the viral hemorrhagic...a and hemorrhaging in many fish species, was disco...umans. , In May 2006, the researchers, in colla...
    Other Biology News:Fatty spheres loaded with siRNA shrink ovarian cancer tumors in preclinical trial 2Fatty spheres loaded with siRNA shrink ovarian cancer tumors in preclinical trial 3New findings offer more complete view of breast cancer gene mutations in US population 2New findings offer more complete view of breast cancer gene mutations in US population 3Cultural transmission in bats: When listening for dinner, bats learn from their neighbors 2Cornell researchers find serious fish virus in Northeast for first time 2
    Cryopreservation Service from AbD Serotec
    Polaroid black & white positive, 3 x 4 inch pack film, ISO 3000/ 36 ASA DIN (20 expsures). For use in the Polaroid Direct Copy Camera (PHC34).
    SHEEP ANTI ECHIS OCCELATUS (VENOM)
    RABBIT ANTI WARFARIN
    Biology Products: