Navigation Links
Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood ,,, Mini Kit

Laura Pollock and Jennifer Halcome
Eppendorf 5 Prime, Inc. Introduction

Buccal swabs are the least invasive way of collecting gDNA from humans, and also have the added benefit of minimizing the exposure to blood-borne pathogens. Buccal swabs are quickly becoming the method of choice when obtaining specimens for DNA testing. The swabs are easy to use and readily available. Cells collected on buccal swabs do not require special storage conditions and the DNA remains useable after years of storage. The Perfect gDNA Blood Mini Kit provides a fast and consistent method of isolating gDNA from buccal swabs that can subsequently be used in PCR1. The Perfect gDNA kit has been validated for use with several types of swabs, and will most likely work with others. The resulting gDNA is suitable for use in the main downstream applications such as PCR.

Materials
  • Perfect gDNA Blood Mini Kit
Perfect gDNA Blood Mini Kit
  • Ethanol (95100%); pipette tips; microcentrifuge; Eppendorf Thermomixer, water bath or heat block at 70C. Buccal swabs:
  • Cotton (Puritan)
  • Dacron (Fitzco)
  • C.E.P. (Life Technologies)
1x PBS (sufficient amounts are supplied for blood work, but additional amounts may be needed for buccal swab applications)

Method

Preparation of cheek cells and isolation of gDNA:

  1. Collect samples by scraping a buccal swab firmly against the ins ide of a donors cheek 6 times. The donor should not consume food or drink 30 minutes prior to sampling.
  2. Remove the end of the swab by slicing or cutting and place in a 2 ml microcentrifuge tube. Add 400 l of 1x PBS to the tube.
  3. Add 20 l of Proteinase K and 350 l of Solution G1 to the tube containing the swab. Vortex vigorously for 5 seconds.
  4. Incubate at 70C, 900 rpm for 10 minutes in a Thermomixer. A water bath may be used with intermittent vortexing of the sample if a Thermomixer is not available.
  5. Carefully transfer the liquid only to a new tube. Add 200 l Solution G2. Vortex the sample on high for 5 seconds. Place a spin column in a fresh microcentrifuge tube. Transfer the sample to the spin column assembly. Incubate the sample at room temperature for 1 minute.
  6. Centrifuge the sample for 2 minutes at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  7. Add 600 l Diluted Wash Buffer to the spin column. Centrifuge for 1 minute at 12,00016,000 x g. Remove the spin column and decant flow-through. Place the spin column back into the same tube.
  8. Add 400 l Diluted Wash Buffer to the spin column. Centrifuge for 3 minutes at 12,00016,000 x g. Carefully remove the spin column without splashing Wash Buffer onto the bottom of the column. Place the spin column into a fresh microcentrifuge tube.
  9. Observe the filter membrane to make sure it is dry before proceeding. If the filter looks shiny, spin an additional 1 to 2 minutes before placing the spin column into a fresh microcentrifuge tube.
  10. Add 200 l Elution Buffer to the spin column, making sure that the buffer comes into contact with the spin column filter. Incubate the sample at 70C for 3 minutes. Centrifuge for 1 minute at 12,00016,000 x g to elute gDNA. Store purified gDNA at 4C.
PCR:
Samples were tested in the common buccal swab application, PCR. Each type of swab was tested in amplification of 536 bp and 2 kb fragments. 5 l of the sample eluate was used in each PCR reaction. The following Eppendorf PCR reagents were used, with the concentrations or amounts specified in parenthesis:

Taq DNA Polymerase (0.05 Units/l)
10x Taq DNA Polymerase Buffer (1x)
25 mM MgCl2 (0.5 mM)
dNTP Mix (0.2 mM)

Primers (Integrated DNA Technologies) specific to the human beta-globin gene were used for all reactions at a final concentration of 0.1 M.

536 bp fragment
Forward:
5 GCAGCTACACAGCTACCATTCTGC 3
Reverse:
5 GCAGCCTCACCTTCTTTCATGGAGT 3

2 kb target:
Forward:
5 GAAGAGCCAAGGACAGGTAC 3
Reverse:
5 CCTCCAAATCAAGCCTCTAC 3

PCR reactions were performed on the Eppendorf Mastercycler gradient using the following cycling conditions:

536 bp fragment
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 45 seconds
72C for 5 minutes final extension
15C hold

2 kb fragment
94C for 5 minutes; initial denaturation
35 cycles:
94C for 45 seconds
70C for 20 seconds
72C for 1 minute
72C for 5 minutes final extension
15C hold

Results and Discussion

gDNA from all three buccal swabs performed well in amplification of both the 526 bp and 2 kb human beta-globin fragments (see Fig. 1). gDNA isolated from buccal swabs using the Perfect gDNA Blood Mini Kit works well in the downstream application of PCR. Isolation of sufficient amounts of gDNA is critical for PCR. Buccal swabs provide a less invasive method for obtaining DNA-containing samples. The Eppendorf Perfect gDNA Blood Mini Kit enables the researcher to obtain these small but adequate amounts of DNA to be used in PCR. Overall, the Eppendorf Perfect gDNA Blood Mini Kit provides a fast, easy and effective method for purification of gDNA from buccal swabs.
can we delete the word containing above, if not, hyphenate DNA-containing.

References
  1. Use of the Polymerase Chain Reaction (PCR) process to amplify nucleic acids is covered by U.S. Patent Numbers 4683105 and 4683202 owned by Roche Molecular and requires a license.
Fig. 1: PCR of gDNA from buccal swabs isolated using the Perfect gDNA Blood Mini Kit. 1% agarose gel in 1x TAE stained in ethidium bromide 10 l of the 30 l reaction was loaded.

Lane 1: Gene Ruler Ladder Mix (Fermentas) Lane 2: Cotton Buccal Swab, 536 bp human beta-globin fragment Lane 3: Cotton Buccal Swab, 2 kb human beta-globin fragment Lane 4: Dacron Buccal Swab, 536 bp human beta-globin fragment Lane 5: Dacron Buccal Swab, 2 kb human beta-globin fragment Lane 6: C.E.P. Buccal Swab, 536 bp human beta-globin fragment Lane 7: C.E.P. Buccal Swab, 2 kb human beta-globin fragment Lane 8: No template control
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
2. New Protocols for Isolating High- Molecular-Weight Genomic DNA
3. Easily Amplify Genomic DNA with Long-Distance PCR
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
6. Mouse Tail Genomic DNA Isolation Protocol(1)
7. Genomic DNA Isolation Protocol(1,2,3)
8. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. Genomic DNA Isolation Protocol(1,2,3)
Post Your Comments:
*Name:
*Comment:
*Email:


(Date:12/2/2016)... ... December 01, 2016 , ... The Conference Forum has announced ... days and will take place on February 1-3, 2017 at the Roosevelt Hotel in ... (NCI), the program provides a unique 360-degree approach, which addresses the most up-to-date information ...
(Date:12/2/2016)...   SurePure, Inc. (OTCQB: SURP) a global ... has concluded an agreement with Tamarack Biotics under which ... to acquire units of the Company,s patented photopurification technology ... Concurrently with the option, SurePure has ... will seek regulatory approvals in the United ...
(Date:11/30/2016)... November 30, 2016 The global ... players hold a dominant share in the overall market. ... International, Inc., and Merck KGaA, held a lion,s share ... Market Research observes that these companies are expected to ... products that are do not require rabbit pyrogen testing ...
(Date:11/30/2016)... Nov. 30, 2016  Tempus, a technology company ... and Penn,s Abramson Cancer Center have partnered to ... response to immunotherapy treatment based on next generation ... part of a research collaboration, Tempus will provide ... cancer patient data to Penn. Utilizing next-generation sequencing, ...
Breaking Biology Technology:
(Date:6/21/2016)... 21, 2016 NuData Security announced today that ... of principal product architect and that Jon ... customer development. Both will report directly to ... moves reflect NuData,s strategic growth in its product ... customer demand and customer focus values. ...
(Date:6/15/2016)... New York , June 15, 2016 /PRNewswire/ ... a new market report titled "Gesture Recognition Market by ... and Forecast, 2016 - 2024". According to the report, ... USD 11.60 billion in 2015 and is estimated ... reach USD 48.56 billion by 2024.  ...
(Date:6/7/2016)... 7, 2016  Syngrafii Inc. and San Antonio ... that includes integrating Syngrafii,s patented LongPen™ eSignature "Wet" ... collaboration will result in greater convenience for SACU ... while maintaining existing document workflow and compliance requirements. ... Highlights: ...
Breaking Biology News(10 mins):