Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:5/6/2015)... Dr Jaspreet Singh , Senior Research Officer from ... the 2015 Asian Starch Conference, to be held ... , As an honored ... Starch: A Potential Source for the Creation of Next ... a 528 page text book entitled "Advances in Potato ...
(Date:5/5/2015)... Mass. , May 5, 2015  Blueprint ... closing of its initial public offering of 9,367,708 ... price of $18.00 per share, including shares of ... the underwriters of their option to purchase additional ... offering to Blueprint Medicines were approximately $168.6 million, before ...
(Date:5/5/2015)... 5, 2015  23andMe, Inc., the leading personal genetics ... Research Study in collaboration with Pfizer Inc. The ... erythematosus, more commonly known as lupus, into the study ... effort is also in collaboration with the Lupus Research ... May. Approximately 1.5 million people in the ...
(Date:5/5/2015)... 2015 Research and Markets ... of the "Separation Systems Market in ... Macromolecules which include protein, RNA, DNA ... broken into smaller molecules, during production of ... various advanced systems like centrifugation, liquid chromatography, ...
Breaking Biology Technology:Potato Starch: A Potential Source for the Creation of Next Generation Bulk-ingredients and Smart Foods 2Blueprint Medicines Announces Closing of Initial Public Offering 223andMe Launches the Lupus Research Study in Collaboration with Pfizer Inc. 223andMe Launches the Lupus Research Study in Collaboration with Pfizer Inc. 3Global Separation Systems Market in Biotechnology 2015-2019 - Trends and Forecasts for the $28 Billion Market 2
... /PRNewswire-Asia-FirstCall/ -- China Sky One,Medical, Inc. ("China ... CSKI ), a,leading fully integrated ... Republic of China ("PRC"), today announced that ... Pharmaceutical Company ("Jin,Chuang"), signed an exclusive distribution ...
... PALO ALTO, Calif., Feb. 24 Eiger BioPharmaceuticals, ... it has raised $7.1 million in a Series ... The two firms were instrumental in the formation,of ... are represented on the board of,directors by general ...
... Angiotech Pharmaceuticals, Inc. (NASDAQ: ANPI , TSX: ANP), ... a time change of its fourth quarter and year end ... ET (7:00 AM PT) on Thursday, March 5, 2009., ... 5, 2009 has not changed, and is ...
Cached Biology Technology:China Sky One Medical, Inc. Signs Exclusive Distribution Agreement with Shaanxi Buchang Group for Naftopidil Dispersible Tablets 2China Sky One Medical, Inc. Signs Exclusive Distribution Agreement with Shaanxi Buchang Group for Naftopidil Dispersible Tablets 3Eiger BioPharmaceuticals Raises $7.1 Million 'A' Round 2
(Date:4/1/2015)... 1, 2015  NXT-ID, Inc. (NASDAQ: NXTD ) ... on the growing mobile commerce market, announces the second ... is underway to early access pre-order customers. ... at retail outlets including Walmart, Target, AT&T, Dunkin, Donuts, ... was accepted at all outlets and very easy to ...
(Date:3/26/2015)... , March 26, 2015 The ... social, recreation and athletic club, today announced it has ... allow freedom of movement for members and staff, while ... a comprehensive process, we selected FST,s IMID Access system ... convenience for our members and staff, in addition to ...
(Date:3/23/2015)... , March 23, 2015 SoundView Technology Group ... NXT-ID,s (NASDAQ: NXTD ) Wocket smart wallet. SoundView was one ... feedback on their experience with the Wocket in multiple scenarios ... CVS, Whole Foods and other retailers, making both debit and ... Tuttle also says, "If the company meets their plans ...
Breaking Biology News(10 mins):NXT-ID Reports Second Shipment of Wocket Smart Wallets Underway to Early Access Pre-order Customers and Provides User Feedback 2NXT-ID Reports Second Shipment of Wocket Smart Wallets Underway to Early Access Pre-order Customers and Provides User Feedback 3NXT-ID Reports Second Shipment of Wocket Smart Wallets Underway to Early Access Pre-order Customers and Provides User Feedback 4Granite Club First Private Club in North America to Implement FST Biometrics Secure Access Solution, as Part of Multi-million Dollar Expansion 2Technology Research Note Update from SoundView; Real-World Usage and Feedback of Wocket Smart Wallet at CVS, Whole Foods and other Retailers 2Technology Research Note Update from SoundView; Real-World Usage and Feedback of Wocket Smart Wallet at CVS, Whole Foods and other Retailers 3Technology Research Note Update from SoundView; Real-World Usage and Feedback of Wocket Smart Wallet at CVS, Whole Foods and other Retailers 4
... western Pacific Ocean may be losing their last foothold ... a paper published today in the scientific journal ... Researchers from the State University of Papua Indonesia, ... World Wildlife Fund Indonesia released a report today documenting ...
... articles cover wind erosion and sediment traps in the Qaidam ... Forest, USA; a forearc sliver in Costa Rica; Quebec,s St. ... Ries Crater Lake, Germany; bending and buckling mountain belts; a ... and the evolution of the ancient Montana landscape. ...
... The Association for Research in Vision and Ophthalmology 2013 ... including two Nobel laureates, during the organization,s five-day conference, ... this year, the ARVO/Alcon Keynote Series will include Oliver ... DPhil. Smithies, of the University of North Carolina ...
Cached Biology News:New study shows continued decline in the last remaining stronghold for leatherback sea turtles 2Kauai, the Petrified Forest, Costa Rica, and more: New GSA Bulletin articles now online 2Kauai, the Petrified Forest, Costa Rica, and more: New GSA Bulletin articles now online 3Kauai, the Petrified Forest, Costa Rica, and more: New GSA Bulletin articles now online 4Kauai, the Petrified Forest, Costa Rica, and more: New GSA Bulletin articles now online 5Kauai, the Petrified Forest, Costa Rica, and more: New GSA Bulletin articles now online 6Kauai, the Petrified Forest, Costa Rica, and more: New GSA Bulletin articles now online 7Kauai, the Petrified Forest, Costa Rica, and more: New GSA Bulletin articles now online 8Kauai, the Petrified Forest, Costa Rica, and more: New GSA Bulletin articles now online 93 distinguished keynote speakers to present during ARVO 2013 Annual Meeting 2
Rat polyclonal to acetyl Salicylic Acid ( Abpromise for all tested applications)....
Drugs and NO-drug Rat Anti-conjugated Acetyl Salicylic Acid Polyclonal Antibody...
Rabbit polyclonal to UBC12 (rating: ****) ( Abpromise for all tested applications). Antigen: Synthetic peptide: RGGYIGSTYFER, corresponding to amino acids 169-180 of UBC12 Entrez Gene ID: 90...
GBL Antibody...
Biology Products: