Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:12/17/2014)... (PRWEB) December 17, 2014 Gene ... that it has entered into a technology access ... (ADM) to apply DNA2.0’s proprietary protein engineering technology, ... process. , “We are extremely excited that the ... platform. This proprietary bioengineering technology has now ...
(Date:12/17/2014)... SOUTH SAN FRANCISCO, Calif. , Dec. 17, ... positive results of a Phase 2 study evaluating ... for the treatment of patients with severe, chronic ... the current standard of care, including topical steroids ... endpoint was percent change in Visual Analog Scale ...
(Date:12/15/2014)...  GlassesOff Inc. (OTCBB: GLSO) announced today the appointment ... director of the Company,s Board of Directors. ... its CEO until its acquisition by Stanley Black ... Recognized as the inventor of the first Wi-Fi-based Active ... -based RFID solutions focused on improving operational efficiency, safety ...
(Date:12/13/2014)... (PRWEB) December 12, 2014 Clarassance, a ... announced its new name: Therabron Therapeutics , Inc. ... and bronchioles (a type of structure in the lungs ... company’s mission to develop novel protein therapeutics for the ... directors decided to change the name to mark the ...
Breaking Biology Technology:ADM and DNA2.0 Enter Into Protein Engineering Technology Access and Service Agreement 2Velocity Pharmaceutical Development, LLC and Tigercat Pharma, Inc. Announce Phase 2 Results for VPD-737 in Patients With Chronic Pruritus 2Velocity Pharmaceutical Development, LLC and Tigercat Pharma, Inc. Announce Phase 2 Results for VPD-737 in Patients With Chronic Pruritus 3Velocity Pharmaceutical Development, LLC and Tigercat Pharma, Inc. Announce Phase 2 Results for VPD-737 in Patients With Chronic Pruritus 4AeroScout Founder Joins GlassesOff's Board of Directors 2AeroScout Founder Joins GlassesOff's Board of Directors 3Maryland-based Biotech Company's Path Forward in Treating Respiratory Diseases Sparks Name Change 2
... Health-focused social networks,blogs, wikis and community sites ... can be their biggest opportunities. A marketing,executive ... increasing,importance of reputation monitoring and management in ... Generated Content and Enhancing its Impact,on Your ...
... EASTON, Mass., Dec. 11 Pressure BioSciences, Inc. (Nasdaq: ... Omni International ("Omni") today announced that they have entered ... Under the terms of the Agreement, the companies will: ... competitive information; (2) co-promote certain products at industry trade ...
... adults may be familiar with the,tetanus and diphtheria booster ... a booster shot that protects adolescents and adults from,whooping ... Listen to this report from ... Registered journalists can access video, audio, text, ...
Cached Biology Technology:Exclusive Conference on Managing Your Online Brand: Shaping the Noise from the Blogosphere 2Pressure BioSciences, Inc. and Omni International Announce Marketing, Distribution, and Technology Development Agreement 2Pressure BioSciences, Inc. and Omni International Announce Marketing, Distribution, and Technology Development Agreement 3Pressure BioSciences, Inc. and Omni International Announce Marketing, Distribution, and Technology Development Agreement 4Pressure BioSciences, Inc. and Omni International Announce Marketing, Distribution, and Technology Development Agreement 5
(Date:12/17/2014)... 2014  Automation is fundamentally transforming the travel ... at international borders. Over the past decade, ePassports, ... veteran travelers to self process through border control ... at an increasing number of airports, seaports, and ... According to Maxine Most , Principal at ...
(Date:12/11/2014)... WINSTON SALEM, N.C. , Dec. 10, 2014  That ... known for quite a while. Hypertension – the medical term ... disease in the early 1800s, and the inflatable cuff that,s ... That doesn,t, however, mean there,s nothing new about hypertension, ... punctured some long-held beliefs about the condition and the best ...
(Date:12/10/2014)... N.C. , Dec. 9, 2014  Wake Forest Baptist ... education building for its School of Medicine. Funding for ... larger capital campaign that will be publicly launched next ... be located in the former 60 series R.J. Reynolds ... Innovation Quarter. Construction will begin immediately with plans to ...
Breaking Biology News(10 mins):Automated Border Control (ABC) Transforms the Global Travel Experience With More Than 2500 ABC eGates and APC Kiosks Deployed In Airports, Seaports, and Land Borders Worldwide 2Research points to need for new approaches to treatment of high blood pressure 2Research points to need for new approaches to treatment of high blood pressure 3Research points to need for new approaches to treatment of high blood pressure 4Wake Forest Baptist to Build New Medical Education Facility In Wake Forest Innovation Quarter 2Wake Forest Baptist to Build New Medical Education Facility In Wake Forest Innovation Quarter 3Wake Forest Baptist to Build New Medical Education Facility In Wake Forest Innovation Quarter 4
... children with cerebral palsy is crucial to improve ... in sitting balance between children with cerebral palsy ... balance between children with diplegic and hemiplegic cerebral ... Laboratory of Human Motor Control, Faculty of Health ...
... batteries to flat-screen televisions, rely on materials known as rare ... are reporting development of a new method to recycle them ... in the journal ACS Applied Materials & Interfaces , ... industry. Zhang Lin and colleagues point out that ...
... the change of the seasons. After a winter pause, plants ... a new correlation to light: The colder the winter, the ... can be expected as the climate changes, the spring development ... giving an advantage to shrubs and invasive trees that ...
Cached Biology News:Recycling valuable materials used in TVs, car batteries, cell phones 2Warm winters let trees sleep longer 2
... Microarrays designed for DNA aptamer screening and ... and powerful Paraflo microfluidic on-chip synthesis platform. ... our comprehensive DNA/RNA Aptamer Microarray Service. ... Aptamer Microarray contains greater than 1500 known ...
... Microarrays designed for DNA aptamer screening and ... and powerful Paraflo microfluidic on-chip synthesis platform. ... synthesized on-chip and LC Sciences can provide ... are available as part of our comprehensive ...
... glutathione-S-transferase (GST) is commonly used as a ... coli (1). The GSTTag sequence has been ... some cases the solubility of its fusion ... folded form, GSTTag fusion proteins can be ...
... for the use of small interfering RNA ... the RNA interference (RNAi) pathway have generated ... biology fields. siRNA for experimental use can ... enzymatically, and then transfected into the target ...
Biology Products: