Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:1/22/2015)... BOSTON , Jan. 22, 2015  Transwestern | RBJ today ... feet of office space for Shire a leading biopharmaceutical company, ... . Transwestern | RBJ,s Robert Richards , president, and ... the lease for the entire five-floor building at 95 Hayden ...
(Date:1/22/2015)... 22, 2015 Pipette.com has added the ... their comprehensive portfolio of Eppendorf products. , The Eppendorf ... a Centrifuge 5424/5424 R and receive the following:, ... Research plus or Eppendorf Reference 2 , ...
(Date:1/22/2015)... 2015 Diagenode, Inc., a leading ... Bioruptor® and complete solutions for epigenetics research, recently ... alleviating the need for manual processing. The new ... ChIP of histones or transcription factors and a ...
(Date:1/22/2015)... , Jan. 22, 2015  Derma Sciences, Inc. ... company focused on advanced wound care, announces that ... tissues, have been added to the Premier, Inc. ... the opportunity for the AMNIOEXCEL® and AMNIOMATRIX® product ...
Breaking Biology Technology:Transwestern?RBJ Advises Shire in 202,000 SF Lease, Creating Boston's Largest Suburban Biotech Campus 2Eppendorf Announces Promotional Bundle Which Includes: Eppendorf Centrifuge 5424, 3-Pack of Pipettes, and Tips - Available Now at Pipette.com 2Diagenode Launches Unique Semi-Automated Solution for Chromatin Immunoprecipitation 2Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 2Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 3Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 4Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 5
... the last week of August, those seven days in which we ... previous three months. For me, this week also signals the ... San Diego for DEMOmobile 2004. (Its a great lineup, so if ... In truth, I should be polishing my opening comments and ...
... will visit Chicago during an eight-day multi-state, multi-agency ... grants. , , SWIFT V Tour brings ... to brief seminar participants on their agency's Small ... Transfer (STTR) programs and to discuss research topics. ...
... expensive, well-designed websites all over the globe. Most have ... illustrations, supportive explanations about their relevant experiences and capabilities ... majority of cases, what is missing is the proof ... the owners, the management the staff and their true ...
Cached Biology Technology:Wrapping up the Summer 2Wrapping up the Summer 3Wrapping up the Summer 4Federal grant seminar coming to Chicago as part of SWIFT V Tour 2Whats Hush-Hush Marketing? 2Whats Hush-Hush Marketing? 3
(Date:1/22/2015)... POINT ROBERTS, Washington , January 20, 2015 ... technology and tech stocks, releases video from the CES 2015 ... security consultant Apollo Robbins . Apollo shows ... Wocket™ biometric smart wallet, a product of NXT-ID, Inc. (NASDAQ: ...
(Date:1/22/2015)... DUBLIN , Jan. 22, 2015 Research and ... the addition of the "Global Wearable Technologies ... Growth, Share, Overview, Trends and Forecast 2014-2020" ... Wearable Technologies are smart devices that can be ...
(Date:12/24/2014)... NEW YORK , Dec. 23, 2014  Since its launch in ... of people to eliminate the pain of trying to remember ... their own biometrics fused to their smartphones. To assist people ... Labs , the company that created 1U and focuses on ...
Breaking Biology News(10 mins):Apollo Robbins Talks about the Illusion of Personal Safety and How Easily Your Wallet is Stolen; If a Wocket Wallet is Stolen the Thief Can't do Anything With it! 2Apollo Robbins Talks about the Illusion of Personal Safety and How Easily Your Wallet is Stolen; If a Wocket Wallet is Stolen the Thief Can't do Anything With it! 3Global Wearable Technologies Market and Applications, Opportunities, Industry Analysis, Segmentation, Size, Growth, Share, Overview, Trends and Forecast 2014-2020 21U Offers Best Solution to the Username / Password Dilemma: For FREE! 21U Offers Best Solution to the Username / Password Dilemma: For FREE! 3
... function of organs slows down. Also on a cellular level more ... which cause defective cells. Now a team of researchers lead by ... in Cologne has shown that ageing is determined not only by ... by damage that we acquire from our mothers. In a study ...
... Biodiversity Conservation , the researchers also suggest that ... low-profile species that are either endangered or require urgent ... to social, intelligent animals, such as chimpanzees, polar bears ... that other species are not worthy of conservation because ...
... teams of UK and USA researchers will begin ... farming methods by giving crops the ability to ... The three highly innovative projects include: searching ... sought-after properties; using synthetic biology to create a ...
Cached Biology News:A mother's genes influence her child's aging 2A mother's genes influence her child's aging 3Relating animals to humans could help conservation projects 2UK & USA scientists collaborate to design crops of the future 2UK & USA scientists collaborate to design crops of the future 3UK & USA scientists collaborate to design crops of the future 4
Autoclavable, variable volumefitted w./ an anti-drip safety valve; borosilicate glass barrelprotected with transparentpolypropylene sleeve; spring-lock cursor design ensuresfine adjustment for exact ...
Disposable tips with floating filter (US Patent 6,702,990) for PDM1.5 OneTouch Plus spotpicker, 10 racks of 96, DNAse and RNAse free...
...
... is aseptically collected via cardiac puncture from 3 ... mixed sex). It is then centrifuged and frozen ... filtered and bottled at 4C then stored at ... HAVE ALWAYS USED PEL-FREEZ COMPLEMENT, YOU CAN NOW ...
Biology Products: