Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:5/20/2015)... 2015 Agricultural firm H.J. Baker & ... acquisition of Tiger-Sul. Since the purchase of Tiger ... in May 2005, H.J. Baker has leveraged the innovation ... a comprehensive portfolio of product offerings and solutions expertise. ... and the innovation of Tiger-Sul, transforming the company into ...
(Date:5/20/2015)... SAN DIEGO , May 20, 2015 /PRNewswire/ ... today announced a collaboration with Celgene Corporation to ... novel genomic biomarkers that associate with patient response ... collaboration is intended to help accelerate patient access ... increasing efficiencies in clinical research and development and ...
(Date:5/20/2015)... , 20. Mai 2015 /PRNewswire/ ... klinische Logistik (Clinical Logistics Organization/CLO) hat ... 2014, das am 31. Dezember 2014 ... hat die Marktentwicklung übertroffen und sein ... http://photos.prnewswire.com/prnh/20110930/NY78064LOGO ...
(Date:5/20/2015)... DENVER , May 20, 2015 /PRNewswire/ ... today announced that it is an official ... Management Executives (CHIME) Cooperative Members Services Program. ... of compliant, managed cloud services and best ... of healthcare CIOs and service providers, enabling ...
Breaking Biology Technology:Agricultural Firm H.J. Baker & Bro., Inc., Celebrates 10 Years Since Acquisition Of Tiger-Sul 2Agricultural Firm H.J. Baker & Bro., Inc., Celebrates 10 Years Since Acquisition Of Tiger-Sul 3Cypher Genomics Collaborates with Celgene Corporation to Identify Novel Genomic Biomarkers 2Marken schließt Ergebnisse für das Geschäftsjahr 2014 ab 2HOSTING Named Partner of the CHIME Cooperative Member Services Program 2HOSTING Named Partner of the CHIME Cooperative Member Services Program 3
... ... Europe, Canada, and Russia requiring confidential, direct buyer representation for a ... Board Certified real estate attorney and Lic. Real Estate Broker, Christian ... broker and real estate attorney exclusively for premium property buyers, greatly ...
... It is an amazing sight: What looks like a tiny ... barely the size of a fingernail, floating in a Petri ... , Researchers at The University of Arizona,s Sarver Heart ... (SAVAHCS) have come a step closer to repairing hearts damaged ...
... technique to record three-dimensional movies of microscopic systems, such ... is reported in Optics Express , has potential ... technique, developed in the laboratory of NYU Physics Professor ... recording the images of microscopic systems and then analyzing ...
Cached Biology Technology:Miami Beach Real Estate Attorney Opens Miami Real Estate Brokerage for International Luxury Miami Beach Condo Buyers From Distressed Sellers 2Miami Beach Real Estate Attorney Opens Miami Real Estate Brokerage for International Luxury Miami Beach Condo Buyers From Distressed Sellers 3Heart disease: Research off the beating patch 2NYU physicists find way to explore microscopic systems through holographic video 2NYU physicists find way to explore microscopic systems through holographic video 3
(Date:5/7/2015)... Fingerprint Cards (FPC) introduces ... FPC,s smallest touch fingerprint sensors to date.  ... integration on the backside of the phone, and ... to integrate touch fingerprint sensors in the OEMs, ... for module manufacturers to customize the look and ...
(Date:4/27/2015)... , Apr. 27, 2015 NXT-ID, Inc. ... biometric authentication company focused on the growing mobile commerce ... shipping to pre-order customers the first week of May, ... the month of May. Gino ... significant milestone for the company as Wocket® enters the ...
(Date:4/20/2015)... 2015 The announcement comes as ... Records Management (GRM), Ireland,s foremost records ... Having built up an impressive track record of clients within ... within the records management sector in Dubai ... GCC staffbase and employ a further eight staff members at ...
Breaking Biology News(10 mins):FPC Introduces its Smallest Touch Fingerprint Sensors to Date 2Wocket, the Smartest Wallet You Will Ever Own, Announces Shipment to Pre-order Customers 2Wocket, the Smartest Wallet You Will Ever Own, Announces Shipment to Pre-order Customers 3Glenbeigh Records Management Wins Contract With Dubai Islamic Bank 2Glenbeigh Records Management Wins Contract With Dubai Islamic Bank 3
... DNA repair gene may be an early step in the ... basis for this inactivation may ultimately be useful in risk ... the September 21 issue of the Journal of the ... region of cells with a "field defect", cells that appear ...
... Skeletal muscles naturally repair themselves very efficiently after ... following damage from overuse during exercise, surgery or ... muscle repair slows noticeably, and in Duchenne Muscular ... functions can't cope with disease progression. , Researchers ...
... aren't able to swat a fly? The fly's secret in ... jump rather than to fly out of the way. "This ... building autonomously navigating robots", according to Gwyneth Card of the ... on triggered escape response at the Society for Experimental Biology ...
Cached Biology News:Change in gene may be underlying molecular defect in some colorectal cancers 2Muscle repair: Making a good system better, faster; implications for aging, disease 2Muscle repair: Making a good system better, faster; implications for aging, disease 3Muscle repair: Making a good system better, faster; implications for aging, disease 4
...
p21 Ras Immunogen: Recombinant C-H-ras p21(val-12). Storage: 4 C...
Rabbit polyclonal to Myosin VIIa (rating: *****) ( Abpromise for all tested applications). entrezGeneID: 4647 SwissProtID: Q13402...
Rabbit polyclonal to GPCR G2A ( Abpromise for all tested applications). entrezGeneID: 29933 SwissProtID: Q9UNW8...
Biology Products: