Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:10/22/2014)... Rock Hill, SC (PRWEB) October 22, 2014 ... the expansion of its cardiovascular pharmacogenetics menu, which ... improved patient outcomes. With PCLS’s evidence-based results, ... individual needs and optimize their therapy, while minimizing ... , In the U.S., according to the FDA ...
(Date:10/22/2014)... ROCKVILLE, Md. , Oct. 22, 2014   ... company developing novel pathogen-specific therapies for serious infections and ... Office has issued a Notice of Allowance for a ... product in its C. difficile program, SYN-004. This ... to SYN-004 in the U.S. and adds to the ...
(Date:10/22/2014)... Oct. 22, 2014 Nuvilex, Inc. (OTCQB: NVLX) ... million people worldwide are living with diabetes, with  that ... 2030.  The global market for diabetes treatments is approximately ... people worldwide died from pancreatic cancer.  Pancreatic cancer is ... cancer in the United States , ...
(Date:10/22/2014)... KONG , Oct. 22, 2014  aTyr Pharma ... that rare disease expert John C. McKew , ... McKew brings more than two decades of expertise in ... Institutes of Health, Wyeth Research and Genetics Institute, Inc. ... aTyr,s efforts to expand and translate its novel Physiocrine ...
Breaking Biology Technology:PCLS Announces Expansion of Cardiovascular Pharmacogenetic Testing Menu 2PCLS Announces Expansion of Cardiovascular Pharmacogenetic Testing Menu 3Synthetic Biologics Announces Allowance of Key U.S. Composition of Matter Patent for C. difficile Program 2Synthetic Biologics Announces Allowance of Key U.S. Composition of Matter Patent for C. difficile Program 3Synthetic Biologics Announces Allowance of Key U.S. Composition of Matter Patent for C. difficile Program 4Nuvilex Brief Analyst Report: Thinking Outside the Box by BrokerBank Securities, Inc. 2aTyr Pharma Appoints John C. McKew, Ph.D., as Vice President, Research 2aTyr Pharma Appoints John C. McKew, Ph.D., as Vice President, Research 3
... EMERYVILLE, Calif., Dec. 2 Bionovo, Inc.,(Nasdaq: BNVI ), ... effective drugs in the areas of women,s health and,cancer, announced that ... of the Company at the 20th Annual Piper Jaffray Health,Care Conference ... will be held at,the New York Palace Hotel in New York ...
... Va., and SAN DIEGO, Dec. 2 The Patient,Advocate ... is,pleased to announce the launch of the Lymphedema CareLine ... toll-free patient/provider,hotline designed to provide information and assistance to ... for post-treatment side effects such as,lymphedema (swelling due to ...
... Corporation (Nasdaq: MATK ) announced that it intends to ... on December 11, 2008, at approximately 4:00 p.m. Eastern Time (ET). ... a conference call to discuss these results with investors. All ... visiting Martek,s web site at http://investors.martek.com . , ...
Cached Biology Technology:Bionovo to Present at the Piper Jaffray Healthcare Conference 2New Program Offers Breast Cancer Clinicians and Patients Support for Pre-Operative Clinical Assessment and Ongoing Surveillance of Lymphedema 2New Program Offers Breast Cancer Clinicians and Patients Support for Pre-Operative Clinical Assessment and Ongoing Surveillance of Lymphedema 3
(Date:10/22/2014)... Oct. 20, 2014 The Nano-Bio Manufacturing Consortium ... Force Research Laboratory (AFRL), has chosen a project proposed ... the University of Arizona College of Medicine – ... AzCIM project,s goal is to assess different sweat collection ... volumes of sweat under a variety of human-body conditions, ...
(Date:10/18/2014)... stress and stress-related psychiatric disorders are associated ... the molecular mechanisms underlying this relation are ... the development of targeted preventive strategies and ... diseases. This work is presented at the ... Now an international group of researchers from ...
(Date:10/17/2014)... in German . ... day in order to reproduce? And why are there two ... the latest issue of the research journal Molecular Human ... Steven Ramm from Bielefeld University Bielefeld has compiled this special ... for a female to copulate with several males in quick ...
Breaking Biology News(10 mins):Nano-Bio Manufacturing Consortium Selects Project Proposed by Arizona Center for Integrative Medicine to Optimize Human Performance Monitoring Techniques 2Nano-Bio Manufacturing Consortium Selects Project Proposed by Arizona Center for Integrative Medicine to Optimize Human Performance Monitoring Techniques 3Researchers find why depression and aging linked to increased disease risk 2Sperm wars 2
... the Welsh national flower, which could offer hope for sufferers ... by Cardiff University's Manufacturing Engineering Centre (MEC). , Alzheimer's disease ... per cent of all cases of dementia. Dementia affects one ... person in five over the age of 80. , Certain ...
... step closer to a technique to easily detect a ... The findings, currently online in the Proceedings of the ... of DNA into cell cultures and observing whether they ... proteins. , The technique could enable doctors to ...
... DNA molecule that is copied almost as efficiently as ... online edition of the Proceedings of the National Academy ... genetic mutations-tiny mistakes that occur during DNA replication-arise. The ... a professor of chemistry at Stanford and co-author of ...
Cached Biology News:Scientists closer to new cancer detection method 2Scientists closer to new cancer detection method 3DNA size a crucial factor in genetic mutations, study finds 2DNA size a crucial factor in genetic mutations, study finds 3
Anti-Mouse IgM Heavy Chain:FITC, Clone LO-MM-9, Monoclonal Antibody...
Mouse anti-IkBa/MAD-3 Class: Antibody Product Group: Signalling molecules and phospho-specific Antibody...
Rabbit polyclonal to FOXJ2 ( Abpromise for all tested applications). entrezGeneID: 55810 SwissProtID: Q9P0K8...
PI/RNase Staining Buffer Solution , 100 ml Consult technical datasheet for details....
Biology Products: