Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:7/10/2014)... UK (PRWEB) July 10, 2014 ... 21st Century Medicine Forum on ‘Commercialising Longevity Research’ ... and entrepreneurs to the London Bioscience Innovation Center ... Research Foundation and Aging Analytics Ltd. The meeting ... investment in translational research for age-related disease, as ...
(Date:7/10/2014)... Terascala, the industry leader in ... a former vice president of product management for Flexera ... of marketing. Terascala’s software when combined with leading compute ... highest performance and most reliable solutions for processing big ... channel expansion and broaden its product portfolio. His leadership ...
(Date:7/10/2014)... Robert Harman, DVM, Founder and CEO of Vet-Stem, ... announce the relaunch of his highly informative blog, now named ... “ What are Stem Cells ?” Dr. Harman’s purpose ... in the basics of stem cell therapy so that pet ... of treatment when considering regenerative medicine. , A veterinarian by ...
(Date:7/10/2014)... EvoDerma ’s NOOME Anti-Aging Motion has been upgraded ... with a second treatment cup to help prevent and smooth ... is thinner on the edges for a softer contact with ... uneven surfaces on the face, neck and décolleté. Choose to ... areas such as the cheeks and neck, or opt for ...
Breaking Biology Technology:DKV Sponsors Forum on Commercialising Longevity Research; Brings Together Scientists, Investors, Entrepreneurs and Celebrities 2DKV Sponsors Forum on Commercialising Longevity Research; Brings Together Scientists, Investors, Entrepreneurs and Celebrities 3DKV Sponsors Forum on Commercialising Longevity Research; Brings Together Scientists, Investors, Entrepreneurs and Celebrities 4DKV Sponsors Forum on Commercialising Longevity Research; Brings Together Scientists, Investors, Entrepreneurs and Celebrities 5DKV Sponsors Forum on Commercialising Longevity Research; Brings Together Scientists, Investors, Entrepreneurs and Celebrities 6Terascala Expands Executive Team 2Terascala Expands Executive Team 3Robert Harman, DVM Talks About What Stem Cells are in His Latest Blog Series for Vet-Stem, Inc. 2Robert Harman, DVM Talks About What Stem Cells are in His Latest Blog Series for Vet-Stem, Inc. 3Introducing a New Bonus Treatment Cup for EvoDerma’s NOOME Anti-Aging Motion 2
... , , , ... when revenues aren,t growing, many organizations are looking for ways to ... these things by better managing processes and the documents that go ... applications ( http://onbase.com/English/Products ). But here,s the roadblock: budgets ...
... , THE WOODLANDS, Texas, Sept. 9 Lexicon ... focused on discovering and developing breakthrough treatments for human disease, announced today ... and chief executive officer, will present at the Morgan Stanley Global Healthcare ... on Tuesday, September 15, 2009 at 1:35 p.m. Eastern Time. ...
... England, September 9 Clinical Therapeutics,(, http://www.clinicaltherapeutics.com/ ) ... the addition of Michael G. Spigarelli, MD, PhD,to ... As section editor for the Pediatric, Adolescent, ... Research section), Dr. Spigarelli brings a wealth of ...
Cached Biology Technology:Hyland Software Provides Grant Assistance to Kick-Start Technology Projects 2Hyland Software Provides Grant Assistance to Kick-Start Technology Projects 3Hyland Software Provides Grant Assistance to Kick-Start Technology Projects 4Lexicon Pharmaceuticals to Present at the Morgan Stanley Global Healthcare Unplugged Conference 2Clinical Therapeutics Announces the Addition of Michael G. Spigarelli, MD, PhD, as Editor for a Refocused Pediatric, Adolescent, & Maternal Therapeutics Section 2
(Date:7/10/2014)...  Pomerantz LLP has filed a class action ... "Company")(NYSE-MKT: PVCT) and certain of its officers.  The ... Middle District of Tennessee , ... consisting of all persons or entities who purchased ... 2013 and May 22, 2014, both dates inclusive ...
(Date:7/10/2014)... SHELTON, Conn. , July 2, 2014 NXT-ID, Inc., ... market, reports that CEO Mr. Gino Pereira was ... radio show in Tampa Florida . Mr. ... radio host Cedric Harris and how the Wocket™ ... secure alternative.  Cedric Harris tells ...
(Date:7/10/2014)... 8, 2014 Fingerprint Cards, ... design win (DW). An Asian OEM has selected FPC1021 for ... start in August 2014.   FPC is proud ... has a planned date for start of mass production in ... of SEK 5M, for delivery in the first half of ...
Breaking Biology News(10 mins):SHAREHOLDER ALERT: Pomerantz Law Firm Announces the Filing of a Class Action against Provectus Biopharmaceuticals, Inc. and Certain Officers - PVCT 2SHAREHOLDER ALERT: Pomerantz Law Firm Announces the Filing of a Class Action against Provectus Biopharmaceuticals, Inc. and Certain Officers - PVCT 3Security and Your Money: Tampa Bay Radio Host Cedric Harris Talks to NXT-ID CEO Mr. Gino Pereira about the Wocket Smart Wallet 2Security and Your Money: Tampa Bay Radio Host Cedric Harris Talks to NXT-ID CEO Mr. Gino Pereira about the Wocket Smart Wallet 3Security and Your Money: Tampa Bay Radio Host Cedric Harris Talks to NXT-ID CEO Mr. Gino Pereira about the Wocket Smart Wallet 4FPC Wins DW and Initial Ramp Order for FPC1021 Touch Sensor for Flagship Smartphone from Asian OEM 2
... an effective vaccine for hepatitis B and public health officials ... for the infectious liver disease, tens of thousands of people ... to a new study by researchers at Brown University, missed ... why infections persist. "This is a really simple thing ...
... - A comprehensive multi-disciplinary synthesis just published in ... investigation and policy development to address significant environmental, social ... climate change. "Effects of climate change on the ... synthesis of range change prediction in a warming world" ...
... Mass. Geoscientists at the University of Massachusetts Amherst ... first evidence that warm-cold climate oscillations well known in ... also appear as tropical rainfall variations in the Amazon ... expression of these cycles in the Southern Hemisphere. ...
Cached Biology News:Many high-risk Americans don't get hepatitis B vaccine 2Many high-risk Americans don't get hepatitis B vaccine 3Climate change invites alien invaders - Is Canada ready? 2Evidence of past Southern hemisphere rainfall cycles related to Antarctic temperatures 2
... be superior to transfection in some applications. ... PULSin you can study lethal proteins and ... proteins in cells. Likewise, delivery of blocking ... RNA interference experiments. ,With PULSin you ...
... an automated instrument with a thin silicon ... using light or fluorescence microscopy. Biaxial strain ... fibroblast cells can be simulated by mechanical ... Y axis of our strain chamber. Strain ...
... The versatile ST-195 allows real-time observations of ... This instrument has 64 different strain parameters ... incubator. The thin silicon strain chamber used ... microscopes and fluorescence microscopy. ST-195 can be ...
Immunogen GST fusion protein corresponding to full-length rat JNK3/ SAPK1b. Quality Assurance Routinely evaluated by immunoblot. Stability 2 years at -20°C from date of shipment GenBank A...
Biology Products: