Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:8/21/2014)... VIEW, Calif. , Aug. 21, 2014 /PRNewswire/ ... properties and behaviors based on external stimuli such ... poised to have a disruptive effect in multiple ... revolutionize the business landscape by printing objects ranging ... aerospace and automotive sectors. Logo - ...
(Date:8/21/2014)... Louis, MO (PRWEB) August 21, 2014 ... full service biopharmaceutical contract development and manufacturing organization ... by Progenics Pharmaceuticals, Inc., an oncology company focused ... and treating cancer, to manufacture the anti-prostate specific ... PSMA ADC product candidate. Under the agreement ...
(Date:8/20/2014)... N.C. , Aug. 20, 2014 ... research services located in Raleigh, NC ... Bradford Evans as Vice President of Administration. ... Brad will oversee all corporate processes, including their ... joining Clintrax Global, Brad worked as an HR ...
(Date:8/20/2014)... succeeded in measuring vibrational motion of a single molecule ... vibration of a single molecule differs from the behaviour ... performed at the University of California, Irvine, where post-doctoral ... as a visiting fellow under professor Vartkess A. Apkarian, ... was lead by Professor Eric O. Potma. The results ...
Breaking Biology Technology:Frost & Sullivan: 4-D Printing to Usher in Age of Low-Labor, Fast-Paced Product Manufacturing 2Frost & Sullivan: 4-D Printing to Usher in Age of Low-Labor, Fast-Paced Product Manufacturing 3Frost & Sullivan: 4-D Printing to Usher in Age of Low-Labor, Fast-Paced Product Manufacturing 4Gallus Enters Agreement with Progenics Pharmaceuticals, Inc. for Manufacture of Anti-PSMA Monoclonal Antibody 2Gallus Enters Agreement with Progenics Pharmaceuticals, Inc. for Manufacture of Anti-PSMA Monoclonal Antibody 3Clintrax Global, Inc. Announces Addition to Executive Team 2Seeing a molecule breathe 2
... , SEATTLE, Dec. 6 A challenge donation from the ... total to more than $7 million for Fred Hutchinson Cancer Research ... during which guests raise their bid cards for specific contribution levels, ... work to harness the human immune system to battle cancer. ...
... , NEW YORK, Dec. 4 Stemline Therapeutics, Inc. ... agents, SL-401 and SL-501, in both in vitro and ... for poster presentation at the upcoming 51st Annual Meeting of the ... from December 5-8, 2009. The poster will be presented by Stemline,s ...
... Dec. 3 VIA Pharmaceuticals, Inc. (Nasdaq: VIAP ), ... the treatment of cardiovascular and metabolic disease, today announced that ... 2 FDG-PET clinical trial of VIA-2291. , The FDG-PET ... sites in the US and Canada including Massachusetts General Hospital, ...
Cached Biology Technology:34th Annual Hutch Holiday Gala Raises More Than $7 Million For Cancer Research 234th Annual Hutch Holiday Gala Raises More Than $7 Million For Cancer Research 3Stemline Therapeutics Announces Poster Presenting in vivo and Anti-Cancer Stem Cell Activity of SL-401 against Chronic Myeloid Leukemia (CML) at the 51st Annual Meeting of the American Society of Hematology (ASH) 2VIA Pharmaceuticals Completes Patient Visits in Phase 2 Trial of VIA-2291 2VIA Pharmaceuticals Completes Patient Visits in Phase 2 Trial of VIA-2291 3VIA Pharmaceuticals Completes Patient Visits in Phase 2 Trial of VIA-2291 4
(Date:8/22/2014)... to purchase fuel cell cars from Toyota and other ... cars will run on hydrogen made from natural gas, ... Now scientists at Stanford University have developed a low-cost, ... produce hydrogen by water electrolysis. The battery sends ... water into hydrogen and oxygen gas. Unlike other water ...
(Date:8/21/2014)... BLOOMINGTON, Ind. -- A new study of American ... partner, men have the highest orgasm rates. On ... time, with their sexual orientation making little difference. ... On average, women experience orgasm 62.9 percent of ... -- and this pattern varies with women,s sexual ...
(Date:8/21/2014)... to dandruff, eczema and other itchy, flaky maladies in ... reachesincluding Hawaiian coral reefs and the extreme environments of ... in the scientific journal PLOS Pathogens considers ... the genus Malassezia in light of new ... the world. , University of Hawai,i at Mānoa scientist ...
Breaking Biology News(10 mins):Stanford scientists develop a water splitter that runs on an ordinary AAA battery 2Stanford scientists develop a water splitter that runs on an ordinary AAA battery 3Orgasm rates for single women less predictable than men's, vary by sexual orientation 2Orgasm rates for single women less predictable than men's, vary by sexual orientation 3Orgasm rates for single women less predictable than men's, vary by sexual orientation 4From dandruff to deep sea vents, an ecologically hyper-diverse fungus 2
... Athene Donald has won the Science and Technology award ... honor to Professor Donald, Glamour magazine praised her as a ... real path for herself in the male-dominated world of physics." ... Physics at the University of Cambridge in the United Kingdom ...
... CAA researcher at Charles Drew University of Medicine and Science ... a promising, natural therapy for cancer. Dr. Mamdooh Ghoneum ... on "Cell Death Mechanism," sponsored by the American Association for ... San Diego. "The central focus of the meeting ...
... RIVERSIDE, Calif. Stem cell research at the University of ... establishment of a new Stem Cell Core Facility (SCCF) ... doing stem cell research that ordinarily would not be available ... Noel Keen Hall, had its grand opening on Friday, Jan. ...
Cached Biology News:Charles Drew cancer studies with yeast yield excellent results 2UC Riverside's new state-of-the-art technology to accelerate stem cell research 2
... offers a full length insert sequencing service ... cosmids and fosmids. Agencourt utilizes unique ... libraries. There are several features that ... data with rapid turnaround including our patented ...
...
... Cytometry The Guava EasyCyte system is ... multiparameter cytometer with built-in 96-well microplate sampling ... plates of cells and compounds quickly and ... tubes or having the carryover issues found ...
A flexible 24-48 hour DNA sequencing service. Samples may be shipped in standard 1.5mL tubes. Oligo synthesis and DNA preparation available. Read lengths up to 850 Phred 20 bases. Universal primers p...
Biology Products: