Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit

Nathalie Arricau-Bouvery and Armel Souriau
INRA centre of TOURS, Unit de Pathologie Infectieuse et Immunologie, 37380 NOUZILLY FRANCE
Phone: (33) 0247427634, Fax: (33) 0247427779, e-mail: bouvery@tours.inra.fr Introduction

Coxiella burnetii, the etiologic agent of Q fever, is an obligate intracellular bacterium. The reservoirs are extensive but partially known, and include mammals, birds and arthropods. Farm animals (i.e., cattle, sheep, goats) are identified as principal sources of human infection 1. Routine diagnosis of Q fever in veterinary medicine is usually performed by Stamp staining of the placenta or serological tests. Isolation and quantitation of C. burnetii are difficult, time consuming and require confined level L3 laboratories. Detection of C. burnetii is possible by using cell culture (shell vial culture system), but essentially it is used in clinical practice 5. Polymerase chain reaction has become a useful tool for the detection of C. burnetii in biological samples 6. However, this necessitates the extraction of the genomic DNA of C. burnetii without purification of bacteria. Thus, the samples contain gDNA of the bacteria and the eukaryotic cells. Different methods are reported in the literature 2, 4, but the sensitivity is very low or the method is not adapted to samples containing blood.

In this article, we report that the Perfect gDNA Blood Mini Kit from Eppendorf is highly adapted to the C. burnetii gDNA extraction when the bacterium is present in goat placenta (blood), mouse spleen or milk.

Materials and Methods

Samples:

  1. Placenta (goat): the placenta was homogenized in sterile physiological buffer and is constituted essentially of blood.
  2. Spleen (mouse): the spleen was homogenized in sterile physiological buffer.
  3. Milk (bovine)
  4. Blood: the results found with blood provided by animals naturally infected with C. burnetii are the same as those found with placenta, but are not as strong. Indeed, animal blood is deficient in bacterial particles and its difficult to project if and when the bacteria is present in the blood. Thus, only results found with placenta are shown here and represent the results we could have found with blood.
DNA Extraction:

Total DNA was directly extracted from 20 l and 50 l of homogenized goat placenta naturally contaminated by C. burnetii (genome size: 2,103 kb), 10 l, 30 l and 50 l of homogenized mouse spleen (mouse injected intraperitoneally with C. burnetii) and 100 l of bovine milk contaminated by infective suspension of C. burnetii and containing 108 or 107 bacteria/ml). The extraction was carried out using the Eppendorf Perfect gDNA Blood Mini Kit as recommended in the manual with the exception of two steps: the lysis with Proteinase K was performed at 70C in a water bath over a thirty minute period (and could now be frozen at 20C before continuing the DNA extraction), and the final step: gDNA was eluted with 150 l of Elution Buffer.

PCR:

Two primers, Trans1 and Trans2, derived from a transposon-like repetitive region of the C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water) Fig. 2: Amplification of a 687 bp fragment of genomic DNA from Coxiella burnetii. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat) naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water)
Lane 9: Positive control (DNA extracted from yolk sacs of chicken embryos inoculated with C. burnetii) Results and Discussion

As expected, the O1-O2 fragment of the eukaryotic cells could be amplified after extraction of the total gDNA of goat placenta, mouse spleen or bovine milk contaminated with C. burnetii (Fig. 1). As the quantity of cells in milk is low and variable, the PCR product obtained with these samples is weak. In addition, the Trans1-Trans2 fragment from C. burnetii could also be amplified successfully in Trans-PCR (Fig. 2).

Thus, this kit can be used for the detection of C. burnetii in different samples such as placenta, spleen, milk or blood (data not shown). Similar results were found with spleens of mice contaminated with Chlamydia and treated with this kit (data not shown).

References

  1. Baca, O.G. and Paretsky, D. 1983. Q fever and Coxiella burnetii: a model for host-parasite interaction. Microbiol Rev 47: 127-149.
  2. Berri, M., Laroucau, K. and Rodolakis A. 2000. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol 72 (3-4): 285-93.
  3. Hoover, T.A., Vodkin, M.H. and Williams, J.C. 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion sequence. J Bacteriol 174(17): 5540-5548.
  4. Lorenz, H., Jger, C., Willems H. and Balger, G. 1998. PCR detection of C. burnetii from different clinical specimen, especially bovine milk, on the basis of DNA preparation with a silica matrix. Appl Environ Microbiol 64: 4234-4237.
  5. Raoult, D., Vestris, G. and Enea, M. 1990. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation cell culture system and establishment of the strains in HEL cells. J Clin Microbiol 28(11): 2482-2484.
  6. Willems, H., Thiele, D., Frhlich-Ritter, R. and Krauss, H. 1994. Detection of Coxiella burnetii in cow's milk using the polymerase chain reaction (PCR). J Vet Med Ser B 41: 580-587.

'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:1/22/2015)... 2015 Selexis SA, a serial innovation ... Banks (RCBs) used for drug discovery to commercial manufacturing, ... include Next-Generation Sequencing (NGS) data packages. The ... manufacturing by ensuring the integrity of the gene, validation ...
(Date:1/22/2015)... , Jan. 22, 2015   Cypher Genomics, Inc., ... Inc. (NASDAQ: SQNM ), the leading ... for next generation noninvasive prenatal tests (NIPT). Through ... technology, called Mantis™, to advance analysis of clinically-relevant ...
(Date:1/22/2015)... 22, 2015  Derma Sciences, Inc. (Nasdaq: ... advanced wound care, announces that AMNIOEXCEL® and AMNIOMATRIX®, ... added to the Premier, Inc. Regenerative Skin Grafting ... the AMNIOEXCEL® and AMNIOMATRIX® product lines, which continue ...
(Date:12/24/2014)... YORK , Dec. 24, 2014 PlasmaTech Biopharmaceuticals, Inc. ... critical areas, announced the closing of an underwritten public offering ... up to an aggregate 3,500,000 shares of common stock, at ... warrant.  The warrants have a per share exercise price of ...
Breaking Biology Technology:Selexis Generated Research Cell Banks Now Fully Sequenced Using Next-Generation Sequencing 2Cypher Genomics and Sequenom Announce Development Agreement 2Cypher Genomics and Sequenom Announce Development Agreement 3Cypher Genomics and Sequenom Announce Development Agreement 4Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 2Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 3Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 4Derma Sciences Expands Access of its AMNIOTIC TISSUE Product Line with New Premier, Inc. Agreement 5PlasmaTech Biopharmaceuticals, Inc. Announces Closing of Public Offering 2PlasmaTech Biopharmaceuticals, Inc. Announces Closing of Public Offering 3
... 2011 Ingenuity® Systems, a leading provider of ... Medical Center, jointly announced a scientific collaboration using ... As part of the collaboration, Erasmus researchers ... the most impactful biological insights from their NGS ...
... 2011 Accuray Incorporated (Nasdaq: ARAY ), a ... it will report results for its second quarter of fiscal ... after the market closes. A conference call to ... ET and will be hosted by Euan S. Thomson, Ph.D., ...
... the world,s leading provider of medical image analysis services ... Dr. Peter Milner has joined SYNARC to expand and ... solutions for the clinical trial setting. Dr. ... brings over 25 years of experience in drug development ...
Cached Biology Technology:Ingenuity Systems and Erasmus University Medical Center Collaborate on Next-Generation Sequencing Project to Accelerate Disease Research 2Accuray Incorporated to Report Financial Results for Second Quarter of Fiscal 2011 2SYNARC Engages Dr. Peter Milner for Cardiac Imaging Services and Solutions 2
(Date:12/19/2014)... LAS VEGAS , Dec. 18, 2014   LaunchKey ... built for the post-password and Internet of Things era, ... seed funding. The venture round was led by Metamorphic ... Capital, Rimrock Venture Partners, VegasTechFund, and others.  LaunchKey has ...
(Date:12/17/2014)... Dec. 16, 2014 Research and Markets ( ... "Global Chemical Sensor Market 2015-2019" report to their ... One major trend upcoming in this market is ... Chemical sensors help in recording of patient data for ...
(Date:12/11/2014)... blood pressure plays a role in human health has been ... for high blood pressure – was first described as a ... used in measuring blood pressure was invented in 1896. ... its triggers and its effects. In fact, recent findings have ...
Breaking Biology News(10 mins):LaunchKey Raises $3 Million in Additional Funding Led by Metamorphic Ventures 2LaunchKey Raises $3 Million in Additional Funding Led by Metamorphic Ventures 3Global Chemical Sensor Market 2015-2019: Key Vendors are Abbott Laboratories, Bayer, Hoffmann La-Roche, Johnson & Johnson, NGK Spark Plugs and Robert Bosch 2Research points to need for new approaches to treatment of high blood pressure 2Research points to need for new approaches to treatment of high blood pressure 3Research points to need for new approaches to treatment of high blood pressure 4
... rise, some species of corals are likely to succeed at ... on April 12 in the Cell Press journal Current ... effects on corals. "The good news is that, rather ... change by changing the mix of coral species as the ...
... fit frogs have faster-changing genomes, says a new study ... Stretches of DNA accumulate changes over time, but the ... between species, said author Juan C. Santos of the ... In the past, biologists trying to explain why some ...
... cause hearing damage to Sailors and Marines on flight ... funding a new project to help reduce jet noise, ... into two categories: noise exposure on the flight deck ... said Dr. Brenda Henderson, deputy manager for the Jet ...
Cached Biology News:Under climate change, winners and losers on the coral reef 2Athletic frogs have faster-changing genomes 2ONR taps research teams to help reduce jet noise 2
... reports the data from any one of IITC ... recorder. The final data is sent from the ... is automatic for Systolic, Mean, Heart Rate while ... is always in the position to override the ...
... Custom DNA microarrays designed for your specific ... powerful Paraflo microfluidic synthesis platform. Thousands of ... and LC Sciences can provide assistance with ... as part of our comprehensive Custom DNA ...
... RNA aptamer screening and binding optimization and ... microfluidic on-chip synthesis platform. These microarrays are ... Aptamer Microarray Service. Probe Content ... contains greater than 1500 known aptamer sequences. ...
... for RNA aptamer screening and binding optimization ... Paraflo microfluidic on-chip synthesis platform. Thousands of ... on-chip and LC Sciences can provide assistance ... available as part of our comprehensive DNA/RNA ...
Biology Products: