Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit

Nathalie Arricau-Bouvery and Armel Souriau
INRA centre of TOURS, Unit de Pathologie Infectieuse et Immunologie, 37380 NOUZILLY FRANCE
Phone: (33) 0247427634, Fax: (33) 0247427779, e-mail: bouvery@tours.inra.fr Introduction

Coxiella burnetii, the etiologic agent of Q fever, is an obligate intracellular bacterium. The reservoirs are extensive but partially known, and include mammals, birds and arthropods. Farm animals (i.e., cattle, sheep, goats) are identified as principal sources of human infection 1. Routine diagnosis of Q fever in veterinary medicine is usually performed by Stamp staining of the placenta or serological tests. Isolation and quantitation of C. burnetii are difficult, time consuming and require confined level L3 laboratories. Detection of C. burnetii is possible by using cell culture (shell vial culture system), but essentially it is used in clinical practice 5. Polymerase chain reaction has become a useful tool for the detection of C. burnetii in biological samples 6. However, this necessitates the extraction of the genomic DNA of C. burnetii without purification of bacteria. Thus, the samples contain gDNA of the bacteria and the eukaryotic cells. Different methods are reported in the literature 2, 4, but the sensitivity is very low or the method is not adapted to samples containing blood.

In this article, we report that the Perfect gDNA Blood Mini Kit from Eppendorf is highly adapted to the C. burnetii gDNA extraction when the bacterium is present in goat placenta (blood), mouse spleen or milk.

Materials and Methods

Samples:

  1. Placenta (goat): the placenta was homogenized in sterile physiological buffer and is constituted essentially of blood.
  2. Spleen (mouse): the spleen was homogenized in sterile physiological buffer.
  3. Milk (bovine)
  4. Blood: the results found with blood provided by animals naturally infected with C. burnetii are the same as those found with placenta, but are not as strong. Indeed, animal blood is deficient in bacterial particles and its difficult to project if and when the bacteria is present in the blood. Thus, only results found with placenta are shown here and represent the results we could have found with blood.
DNA Extraction:

Total DNA was directly extracted from 20 l and 50 l of homogenized goat placenta naturally contaminated by C. burnetii (genome size: 2,103 kb), 10 l, 30 l and 50 l of homogenized mouse spleen (mouse injected intraperitoneally with C. burnetii) and 100 l of bovine milk contaminated by infective suspension of C. burnetii and containing 108 or 107 bacteria/ml). The extraction was carried out using the Eppendorf Perfect gDNA Blood Mini Kit as recommended in the manual with the exception of two steps: the lysis with Proteinase K was performed at 70C in a water bath over a thirty minute period (and could now be frozen at 20C before continuing the DNA extraction), and the final step: gDNA was eluted with 150 l of Elution Buffer.

PCR:

Two primers, Trans1 and Trans2, derived from a transposon-like repetitive region of the C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water) Fig. 2: Amplification of a 687 bp fragment of genomic DNA from Coxiella burnetii. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat) naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water)
Lane 9: Positive control (DNA extracted from yolk sacs of chicken embryos inoculated with C. burnetii) Results and Discussion

As expected, the O1-O2 fragment of the eukaryotic cells could be amplified after extraction of the total gDNA of goat placenta, mouse spleen or bovine milk contaminated with C. burnetii (Fig. 1). As the quantity of cells in milk is low and variable, the PCR product obtained with these samples is weak. In addition, the Trans1-Trans2 fragment from C. burnetii could also be amplified successfully in Trans-PCR (Fig. 2).

Thus, this kit can be used for the detection of C. burnetii in different samples such as placenta, spleen, milk or blood (data not shown). Similar results were found with spleens of mice contaminated with Chlamydia and treated with this kit (data not shown).

References

  1. Baca, O.G. and Paretsky, D. 1983. Q fever and Coxiella burnetii: a model for host-parasite interaction. Microbiol Rev 47: 127-149.
  2. Berri, M., Laroucau, K. and Rodolakis A. 2000. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol 72 (3-4): 285-93.
  3. Hoover, T.A., Vodkin, M.H. and Williams, J.C. 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion sequence. J Bacteriol 174(17): 5540-5548.
  4. Lorenz, H., Jger, C., Willems H. and Balger, G. 1998. PCR detection of C. burnetii from different clinical specimen, especially bovine milk, on the basis of DNA preparation with a silica matrix. Appl Environ Microbiol 64: 4234-4237.
  5. Raoult, D., Vestris, G. and Enea, M. 1990. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation cell culture system and establishment of the strains in HEL cells. J Clin Microbiol 28(11): 2482-2484.
  6. Willems, H., Thiele, D., Frhlich-Ritter, R. and Krauss, H. 1994. Detection of Coxiella burnetii in cow's milk using the polymerase chain reaction (PCR). J Vet Med Ser B 41: 580-587.

'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:8/27/2014)... SEATTLE , Aug. 27, 2014  ARCH ... venture firms investing in the development of seed ... its eighth venture fund closed with more than ... exceeded its $250 million subscription target by more ... Fund VIII shows the strength and potential of ...
(Date:8/27/2014)... 27, 2014 According to the 2013 ... reshape the look and feel of markets for raw ... higher-quality ingredients will push for more branded, science-backed products.” ... experienced strong market growth in the last decade as ... food and cosmetics to fit a more ‘wellness’ lifestyle ...
(Date:8/26/2014)...  NeuroSigma, Inc., a Los Angeles ... today announced that it has filed a registration statement ... Commission relating to a proposed initial public offering of ... offered and the price range for the proposed offering ... will act as the book-running manager for the proposed ...
(Date:8/26/2014)... has just been added to the growing case ... the next big thing in the high-tech world ... An international collaboration of researchers led by a ... Lawrence Berkeley National Laboratory (Berkeley Lab) has reported ... in photo-excited MX2 materials. The recorded charge transfer ...
Breaking Biology Technology:Latest ARCH Venture Partners Fund Closes Above $400 Million 2Latest ARCH Venture Partners Fund Closes Above $400 Million 3Daring to be Different Raw Materials & Ingredient Supply Shortage Fuels Vital Force™ Technology New Ingredient Enhancements 2Daring to be Different Raw Materials & Ingredient Supply Shortage Fuels Vital Force™ Technology New Ingredient Enhancements 3Competition for graphene 2
... StopAfib.org, at, http://www.StopAfib.org, announces that September is Atrial ... called afib or AF., Once considered benign, this ... or stroke. Every five minutes, someone in the,U.S. has ... killer and the #1 cause of,permanent disability, and takes ...
... Signalife, Inc. (Amex:,SGN) announced earlier today that breaking ... the market, regarding the law firm of Vianale ... Inc. is a life sciences company focused on ... biomedical signal,monitoring. Signalife uses its patented signal technology ...
... to InterMune - ... program in Phase 2 -, BRISBANE, Calif., Sept. 2 ... has earned a $15 million,development milestone under its development collaboration ... compound ITMN-191,(referred to as R7227 at Roche), currently in a ...
Cached Biology Technology:Atrial Fibrillation Month - StopAfib.org Announces September Focus on Life-Threatening Irregular Heartbeat 2Signalife to Issue Breaking News Regarding Vianale & Vianale Tomorrow 2InterMune Earns Development Milestone in HCV Protease Inhibitor Collaboration With Roche 2InterMune Earns Development Milestone in HCV Protease Inhibitor Collaboration With Roche 3InterMune Earns Development Milestone in HCV Protease Inhibitor Collaboration With Roche 4
(Date:8/26/2014)... University in St. Louis have developed algorithms to identify ... tearing or breaking. The technology, which needs to be ... may help pinpoint minor strains and tiny injuries in ... The research is available online Aug. 27 in the ... publishes research at the nexus of the physical and ...
(Date:8/26/2014)... a New Zealand endemic tree has for the last 31 ... ,weedy, Australian shrubs and small trees. A New Zealand botanist ... discover astonishing cryptic diversity behind what was long considered a ... access journal PhytoKeys . , Known to ... of the many discoveries made in the north-western South Island ...
(Date:8/26/2014)... Unregulated trash burning around the globe is pumping far ... records. A new study led by the National Center ... of the world,s garbage is burned in such fires, ... health and climate change. , The new study provides ... pollutants such as particulates, carbon monoxide, and mercury that ...
Breaking Biology News(10 mins):New technology may identify tiny strains in body tissues before injuries occur 2New technology may identify tiny strains in body tissues before injuries occur 3And then there were 10 -- unexpected diversity in New Zealand kanuka genus Kunzea 2And then there were 10 -- unexpected diversity in New Zealand kanuka genus Kunzea 3Trash burning worldwide significantly worsens air pollution 2Trash burning worldwide significantly worsens air pollution 3
... Institute of General Medical Sciences, part of the National ... of Infectious Disease Agent Study for a research project ... by Stephen Eubank, professor. Infectious diseases pose one ... The Models of Infectious Disease Agent Study (MIDAS) is ...
... professor John Graves of the Virginia Institute of Marine Science ... threatened and in need of further protection. The team,s ... Policy Forumis the first study of global tuna and billfish ... of Nature (IUCN). ,The IUCN Red List is the worldwide ...
... evidence presented by a team led by Indiana University ... States as the single geographic domestication site of modern ... Proceedings of the National Academy of Sciences include Blackman,s ... and four others from Rieseberg,s lab, as well as ...
Cached Biology News:National Institutes of Health renews successful infectious disease research study 2National Institutes of Health renews successful infectious disease research study 3Study helps assess global status of tuna and billfish stocks 2Study helps assess global status of tuna and billfish stocks 3Team led by IU biologists confirms sunflower domesticated in US, not Mexico 2Team led by IU biologists confirms sunflower domesticated in US, not Mexico 3
Fluorescence Preserving Media, 100 mL...
Antibodies were affinity purified using epitopes specific to XLF immobilized on solid support....
...
... Clone/PAD: 3B8A10. Immunogen: ... the C-terminal region of ... Specific for the human ... Human (positive control: 293 ...
Biology Products: