Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit

Nathalie Arricau-Bouvery and Armel Souriau
INRA centre of TOURS, Unit de Pathologie Infectieuse et Immunologie, 37380 NOUZILLY FRANCE
Phone: (33) 0247427634, Fax: (33) 0247427779, e-mail: bouvery@tours.inra.fr Introduction

Coxiella burnetii, the etiologic agent of Q fever, is an obligate intracellular bacterium. The reservoirs are extensive but partially known, and include mammals, birds and arthropods. Farm animals (i.e., cattle, sheep, goats) are identified as principal sources of human infection 1. Routine diagnosis of Q fever in veterinary medicine is usually performed by Stamp staining of the placenta or serological tests. Isolation and quantitation of C. burnetii are difficult, time consuming and require confined level L3 laboratories. Detection of C. burnetii is possible by using cell culture (shell vial culture system), but essentially it is used in clinical practice 5. Polymerase chain reaction has become a useful tool for the detection of C. burnetii in biological samples 6. However, this necessitates the extraction of the genomic DNA of C. burnetii without purification of bacteria. Thus, the samples contain gDNA of the bacteria and the eukaryotic cells. Different methods are reported in the literature 2, 4, but the sensitivity is very low or the method is not adapted to samples containing blood.

In this article, we report that the Perfect gDNA Blood Mini Kit from Eppendorf is highly adapted to the C. burnetii gDNA extraction when the bacterium is present in goat placenta (blood), mouse spleen or milk.

Materials and Methods

Samples:

  1. Placenta (goat): the placenta was homogenized in sterile physiological buffer and is constituted essentially of blood.
  2. Spleen (mouse): the spleen was homogenized in sterile physiological buffer.
  3. Milk (bovine)
  4. Blood: the results found with blood provided by animals naturally infected with C. burnetii are the same as those found with placenta, but are not as strong. Indeed, animal blood is deficient in bacterial particles and its difficult to project if and when the bacteria is present in the blood. Thus, only results found with placenta are shown here and represent the results we could have found with blood.
DNA Extraction:

Total DNA was directly extracted from 20 l and 50 l of homogenized goat placenta naturally contaminated by C. burnetii (genome size: 2,103 kb), 10 l, 30 l and 50 l of homogenized mouse spleen (mouse injected intraperitoneally with C. burnetii) and 100 l of bovine milk contaminated by infective suspension of C. burnetii and containing 108 or 107 bacteria/ml). The extraction was carried out using the Eppendorf Perfect gDNA Blood Mini Kit as recommended in the manual with the exception of two steps: the lysis with Proteinase K was performed at 70C in a water bath over a thirty minute period (and could now be frozen at 20C before continuing the DNA extraction), and the final step: gDNA was eluted with 150 l of Elution Buffer.

PCR:

Two primers, Trans1 and Trans2, derived from a transposon-like repetitive region of the C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water) Fig. 2: Amplification of a 687 bp fragment of genomic DNA from Coxiella burnetii. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat) naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water)
Lane 9: Positive control (DNA extracted from yolk sacs of chicken embryos inoculated with C. burnetii) Results and Discussion

As expected, the O1-O2 fragment of the eukaryotic cells could be amplified after extraction of the total gDNA of goat placenta, mouse spleen or bovine milk contaminated with C. burnetii (Fig. 1). As the quantity of cells in milk is low and variable, the PCR product obtained with these samples is weak. In addition, the Trans1-Trans2 fragment from C. burnetii could also be amplified successfully in Trans-PCR (Fig. 2).

Thus, this kit can be used for the detection of C. burnetii in different samples such as placenta, spleen, milk or blood (data not shown). Similar results were found with spleens of mice contaminated with Chlamydia and treated with this kit (data not shown).

References

  1. Baca, O.G. and Paretsky, D. 1983. Q fever and Coxiella burnetii: a model for host-parasite interaction. Microbiol Rev 47: 127-149.
  2. Berri, M., Laroucau, K. and Rodolakis A. 2000. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol 72 (3-4): 285-93.
  3. Hoover, T.A., Vodkin, M.H. and Williams, J.C. 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion sequence. J Bacteriol 174(17): 5540-5548.
  4. Lorenz, H., Jger, C., Willems H. and Balger, G. 1998. PCR detection of C. burnetii from different clinical specimen, especially bovine milk, on the basis of DNA preparation with a silica matrix. Appl Environ Microbiol 64: 4234-4237.
  5. Raoult, D., Vestris, G. and Enea, M. 1990. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation cell culture system and establishment of the strains in HEL cells. J Clin Microbiol 28(11): 2482-2484.
  6. Willems, H., Thiele, D., Frhlich-Ritter, R. and Krauss, H. 1994. Detection of Coxiella burnetii in cow's milk using the polymerase chain reaction (PCR). J Vet Med Ser B 41: 580-587.

'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:9/2/2014)... (PRWEB) September 02, 2014 Myriant ... the signage of a distribution agreement with Azelis ... now distributing Myriant’s bio-succinic acid in the Nordics, ... Ireland, targeting customers in the industrial and base ... powerhouse, Azelis offers a far-reaching chemical portfolio with ...
(Date:9/2/2014)... MONROVIA, Calif. , Sept. 2, 2014 /PRNewswire/ ... clinical-stage biopharmaceutical company developing engineered monoclonal antibodies for ... diseases, and cancer, today announced the appointment of ... clinical development and the appointment of Lloyd ... and general counsel. "Debra,s expertise ...
(Date:9/2/2014)... ON , Sept. 2, 2014 /PRNewswire/ - BIOREM Inc. (TSXV: ... totalling $2.1 million. The orders consist of three large odour ... Canada . "These orders are consistent with ... said Peter Bruijns , President and CEO. "After a ... market, we are now beginning to see sales growth. Our ...
(Date:9/2/2014)... , September 2, 2014 ... BioData,s research and lab management services  BioData, ... service, is pleased to announce the appointment of ... most recently served as VP Marketing and Business Development ... science research and clinical applications. Previously, Culot ...
Breaking Biology Technology:Myriant and Azelis Sign European Distribution Agreement for Bio-Succinic Acid 2Xencor Appoints Debra Zack, M.D., Ph.D., Vice President, Clinical Development and Lloyd Rowland, Senior Vice President, Chief Compliance Officer and General Counsel 2Xencor Appoints Debra Zack, M.D., Ph.D., Vice President, Clinical Development and Lloyd Rowland, Senior Vice President, Chief Compliance Officer and General Counsel 3Louis Culot Appointed as BioData's CEO 2
... 25 /Xinhua-PRNewswire-FirstCall/ -- 3SBio Inc.,(Nasdaq: SSRX ... researching,developing, manufacturing and marketing biopharmaceutical products,primarily in ... with the Chinese,State Food and Drug Administration ... formulation of EPIAO for the treatment of ...
... be Used for Advancement of Cancer Stem Cells and Other ... ... Inc., a privately,held biotechnology company that develops immunotherapeutics to treat,autoimmune disorders, ... in a Series D-2 financing. The round, led by,Nextech Venture, included ...
... COLLINS, Colo., Sept. 24 InVitria,( http://www.InVitria.com ... Annual "Optimizing Cell Culture Development" Conference on,September ... most recent,results optimizing cell culture media using ... ingredients.,( http://www.healthtech.com/ocb/overview.aspx?c=562 ), In a presentation ...
Cached Biology Technology:3SBio Inc. Files for SFDA Approval of High-dose (36,000 IU) EPIAO 23SBio Inc. Files for SFDA Approval of High-dose (36,000 IU) EPIAO 3MacroGenics Raises $25M in Series D-2 Financing 2MacroGenics Raises $25M in Series D-2 Financing 3MacroGenics Raises $25M in Series D-2 Financing 4InVitria Touts Product Advantages at Cambridge's Cell Culture Conference 2
(Date:9/2/2014)... Taiyuan, China, have substantially improved the health of people ... in costs associated with loss of life and disability ... Columbia Center for Children,s Environmental Health (CCCEH) at the ... the Center of Diseases Control and Prevention of Taiyuan ... , The study is the first to document the ...
(Date:9/2/2014)... DURHAM, N.C. -- When you accidentally touch a hot ... know the basic neural circuits involved in sensing and ... out the molecular players. , Duke researchers have made ... molecule involved in pain in worms, and have built ... Sept. 2 in Nature Communications , may help ...
(Date:9/1/2014)... Dietary quality in the U.S. has improved steadily in ... intakebut overall dietary quality remains poor and disparities continue ... a new study from Harvard School of Public Health ... to date that the extensive efforts by many groups ... some payoff, but it also indicates that these efforts ...
Breaking Biology News(10 mins):Clean air halves health costs in Chinese city 2Surprising new role for calcium in sensing pain 2Surprising new role for calcium in sensing pain 3Quality of US diet shows modest improvement, but overall remains poor 2Quality of US diet shows modest improvement, but overall remains poor 3
... what you know often comes at the price of learning ... easy for many, but not for those with conditions such ... simple routines. Using brain scans in monkeys, Duke ... monkeys will switch from exploiting a known resource to exploring ...
... Taylor Chair of Chemistry Barry Dellinger was recently awarded a ... Health Sciences, or NIEHS, to support a Superfund Research Center ... health. It is the only center ever awarded by this ... school of public health. "This grant is the result of ...
... semi-decayed vegetation matter, has been used by commercial growers ... century. Peat is added to potting soil to help ... for peat grew, acres of peat bogs were being ... of extracting peat from wetlands are mounting. And as ...
Cached Biology News:Monkey brains signal the desire to explore 2LSU receives $3.6 million to fund center studying hazardous waste cleanup and health impacts 2For peat's sake: Alternative growing media 2
... sealed isolation chamber provides a safe, ... sterile pharmaceuticals, in accord with USP-797 ... 100 (ISO 5) cleanliness conditions in ... IV rod and tilt-up front panel ...
... Protein determined by Biuret. Physical ... (NH 4 ) 2 SO ... Note: Affinity purified • Physical ... Additives: MgCl 2 1 ...
Ideal for chemical processing that requires downward flow of exhaust fumes. Powderful 1200 CFM blower draws fumes into sub-surface bonded charcoal filter for safe removal of organic vapors (final HEP...
... using mass numbers as a trigger, precisely ... performing investigation and research of natural compounds. ... and preparative operation. Switching between modes is ... This support provides a quick solution for ...
Biology Products: