Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit

Nathalie Arricau-Bouvery and Armel Souriau
INRA centre of TOURS, Unit de Pathologie Infectieuse et Immunologie, 37380 NOUZILLY FRANCE
Phone: (33) 0247427634, Fax: (33) 0247427779, e-mail: bouvery@tours.inra.fr Introduction

Coxiella burnetii, the etiologic agent of Q fever, is an obligate intracellular bacterium. The reservoirs are extensive but partially known, and include mammals, birds and arthropods. Farm animals (i.e., cattle, sheep, goats) are identified as principal sources of human infection 1. Routine diagnosis of Q fever in veterinary medicine is usually performed by Stamp staining of the placenta or serological tests. Isolation and quantitation of C. burnetii are difficult, time consuming and require confined level L3 laboratories. Detection of C. burnetii is possible by using cell culture (shell vial culture system), but essentially it is used in clinical practice 5. Polymerase chain reaction has become a useful tool for the detection of C. burnetii in biological samples 6. However, this necessitates the extraction of the genomic DNA of C. burnetii without purification of bacteria. Thus, the samples contain gDNA of the bacteria and the eukaryotic cells. Different methods are reported in the literature 2, 4, but the sensitivity is very low or the method is not adapted to samples containing blood.

In this article, we report that the Perfect gDNA Blood Mini Kit from Eppendorf is highly adapted to the C. burnetii gDNA extraction when the bacterium is present in goat placenta (blood), mouse spleen or milk.

Materials and Methods

Samples:

  1. Placenta (goat): the placenta was homogenized in sterile physiological buffer and is constituted essentially of blood.
  2. Spleen (mouse): the spleen was homogenized in sterile physiological buffer.
  3. Milk (bovine)
  4. Blood: the results found with blood provided by animals naturally infected with C. burnetii are the same as those found with placenta, but are not as strong. Indeed, animal blood is deficient in bacterial particles and its difficult to project if and when the bacteria is present in the blood. Thus, only results found with placenta are shown here and represent the results we could have found with blood.
DNA Extraction:

Total DNA was directly extracted from 20 l and 50 l of homogenized goat placenta naturally contaminated by C. burnetii (genome size: 2,103 kb), 10 l, 30 l and 50 l of homogenized mouse spleen (mouse injected intraperitoneally with C. burnetii) and 100 l of bovine milk contaminated by infective suspension of C. burnetii and containing 108 or 107 bacteria/ml). The extraction was carried out using the Eppendorf Perfect gDNA Blood Mini Kit as recommended in the manual with the exception of two steps: the lysis with Proteinase K was performed at 70C in a water bath over a thirty minute period (and could now be frozen at 20C before continuing the DNA extraction), and the final step: gDNA was eluted with 150 l of Elution Buffer.

PCR:

Two primers, Trans1 and Trans2, derived from a transposon-like repetitive region of the C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water) Fig. 2: Amplification of a 687 bp fragment of genomic DNA from Coxiella burnetii. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat) naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water)
Lane 9: Positive control (DNA extracted from yolk sacs of chicken embryos inoculated with C. burnetii) Results and Discussion

As expected, the O1-O2 fragment of the eukaryotic cells could be amplified after extraction of the total gDNA of goat placenta, mouse spleen or bovine milk contaminated with C. burnetii (Fig. 1). As the quantity of cells in milk is low and variable, the PCR product obtained with these samples is weak. In addition, the Trans1-Trans2 fragment from C. burnetii could also be amplified successfully in Trans-PCR (Fig. 2).

Thus, this kit can be used for the detection of C. burnetii in different samples such as placenta, spleen, milk or blood (data not shown). Similar results were found with spleens of mice contaminated with Chlamydia and treated with this kit (data not shown).

References

  1. Baca, O.G. and Paretsky, D. 1983. Q fever and Coxiella burnetii: a model for host-parasite interaction. Microbiol Rev 47: 127-149.
  2. Berri, M., Laroucau, K. and Rodolakis A. 2000. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol 72 (3-4): 285-93.
  3. Hoover, T.A., Vodkin, M.H. and Williams, J.C. 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion sequence. J Bacteriol 174(17): 5540-5548.
  4. Lorenz, H., Jger, C., Willems H. and Balger, G. 1998. PCR detection of C. burnetii from different clinical specimen, especially bovine milk, on the basis of DNA preparation with a silica matrix. Appl Environ Microbiol 64: 4234-4237.
  5. Raoult, D., Vestris, G. and Enea, M. 1990. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation cell culture system and establishment of the strains in HEL cells. J Clin Microbiol 28(11): 2482-2484.
  6. Willems, H., Thiele, D., Frhlich-Ritter, R. and Krauss, H. 1994. Detection of Coxiella burnetii in cow's milk using the polymerase chain reaction (PCR). J Vet Med Ser B 41: 580-587.

'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:11/22/2014)... 21, 2014 Prominent academics, leaders ... gather on December 3rd at Genetic Rx, a ... GeneticRx will take place at the Joseph B. ... will discuss the present and future of genetic ... and gene editing—as well as the treatment of ...
(Date:11/22/2014)... 22, 2014 The “Chiral Chromatography ... by Material (Metal, Glass, Plastic), by Application [GC, ... - Forecast to 2018” analyses and studies the ... North America, Europe, Asia, and Rest of the ... 15 figures spread through 135 pages and in-depth ...
(Date:11/21/2014)... November 21, 2014 , ...   Mariano Rodríguez es elegid vicepresidente senior ... KLOX está en marcha para comenzar de forma rápida ... heridas de reciente aprobación en Europa   , ... complace al anunciar los siguientes nombramientos: Todd ...
(Date:11/21/2014)... Author Matthew J. Pallamary’s second short ... Side” published as a tribute to his mentor ... Short Story” category of the 2014 USA Best ... of USA Book News, said this year’s contest yielded ... Simon & Schuster, Penguin, John Wiley & Sons, Houghton ...
Breaking Biology Technology:Pioneering Academics and Key Industry Leaders to Discuss Rare Diseases and the Emergence of New Genetic Medicines at Genetic Rx on December 3rd 2Chiral Chromatography Columns Market worth $87.8 Million by 2018 - New Research Report by MarketsandMarkets 2Chiral Chromatography Columns Market worth $87.8 Million by 2018 - New Research Report by MarketsandMarkets 3Chiral Chromatography Columns Market worth $87.8 Million by 2018 - New Research Report by MarketsandMarkets 4Chiral Chromatography Columns Market worth $87.8 Million by 2018 - New Research Report by MarketsandMarkets 5KLOX Technologies anuncia sus nombramientos ejecutivos 2KLOX Technologies anuncia sus nombramientos ejecutivos 3KLOX Technologies anuncia sus nombramientos ejecutivos 4KLOX Technologies anuncia sus nombramientos ejecutivos 5Mystic Ink 's Short Story Collection “A Short Walk to the Other Side” Honoring Ray Bradbury Praised As Award-Winning Finalist In USA Best Book Awards 2Mystic Ink 's Short Story Collection “A Short Walk to the Other Side” Honoring Ray Bradbury Praised As Award-Winning Finalist In USA Best Book Awards 3Mystic Ink 's Short Story Collection “A Short Walk to the Other Side” Honoring Ray Bradbury Praised As Award-Winning Finalist In USA Best Book Awards 4
... 2011 The proposed rule for the Medicare Shared ... the Department of Health and Human Services on March ... sought by the health insurance lobby, a MedeAnalytics analysis ... "The proposed rule positively addresses many of the ...
... understanding the structure of proteins, polymers, minerals, and engineered ... of the journal Nature Materials . The discovery ... type of symmetry in the structure of materials, which ... or designing materials with desired properties. The research is ...
... WHITE PLAINS, N.Y., April 1, 2011 Once again, the ... Cancer shows a continued decline in diagnoses and deaths ... attributed primarily to preventive measures such as cessation of smoking ... http://photos.prnewswire.com/prnh/20110215/NY48642LOGO) But for many cancers, such as the ...
Cached Biology Technology:ACO Proposed Rule: Over 90 Percent of Commercial Payer RFI Suggestions Incorporated 2Search for advanced materials aided by discovery of hidden symmetries in nature 2Search for advanced materials aided by discovery of hidden symmetries in nature 3The Leukemia & Lymphoma Society: Accelerating Cures Must Be a Priority 2
(Date:11/21/2014)... Wash. , Nov. 20, 2014 C-Labs ... for the Internet of Things (IoT), today announced the ... of chief operating officer. Previously a strategic advisor to ... finance, and operations. Mr. Traynor is based out of ... . He reports to Chris Muench , Chief ...
(Date:11/18/2014)... YORK , Nov. 18, 2014   ... identity authentication solutions, and MorphoTrust USA ... and services, today announced a strategic partnership to ... enterprise, motor vehicle administration (MVA), airport screening and ... in identity-related solutions, MorphoTrust serves consumers through a ...
(Date:11/7/2014)... associate professor, biomedical engineering, in the Grove School ... York, have identified a molecule that could lead ... aggressive forms of breast cancer. , Triple negative ... owing to aggressive proliferation and metastasis and a ... team, discovered the overexpression of intercellular adhesion molecule-1 ...
Breaking Biology News(10 mins):C-Labs Names Former Microsoft and Bsquare Executive as Chief Operating Officer 2EyeLock, MorphoTrust Form Strategic Partnership to Pursue Commercial Enterprise Deployments 2EyeLock, MorphoTrust Form Strategic Partnership to Pursue Commercial Enterprise Deployments 3
... A new study by Indiana University-Purdue University Indianapolis (IUPUI) ... fast food outlet increases weight in children and that ... as well as so called junk food, lowers weight. ... and urban planning compared children,s weights over time before ...
... from the University of Cadiz has confirmed that zinc, copper and ... of the Huelva estuary, and have studied how some of these ... cadmium and copper accumulate in the body tissues of sole and ... some metals in the waters of the Huelva estuary and those ...
... of scientists has discovered extensive similarities between a strain ... linked to opportunistic infections in hospital patients. The findings ... for a range of biotech applications. The genetic analysis ... Energy,s (DOE) Brookhaven National Laboratory, and will be published ...
Cached Biology News:IUPUI study finds living near fast food outlet not a weighty problem for kids 2Study shows transfer of heavy metals from water to fish in Huelva estuary 2Plant microbe shares features with drug-resistant pathogen 2Plant microbe shares features with drug-resistant pathogen 3
UGT1A7 (E-15)...
... nucleofection of optimized cell lines in combination ... nucleofection parameters. Nucleofector Kits are only functional ... cell lines can be transfected with this ... given in brackets in percent (Efficiency [%] ...
... Fluorescein 6-Fam, Hex, Tet Cy3, Cy5, ... Tamra Black Hole Quenchers Molecular Beacons* ... Tamra, Joe 3 Dabcyl Dabcyl*Licensed ... York Double labelled probes are purified either ...
... Protein Phosphatase ( l-PPase) ... phosphatase with activity towards ... tyrosine residues. It is ... of the ORF221 open ...
Biology Products: