Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:10/20/2014)... 20, 2014 Earle Martin ... announced today that Ellen Teplitzky, an experienced attorney ... the pharmaceutical industry, has joined the firm as ... legal services practice. NDA Partners provides legal ... and testimony, to top law firms and their ...
(Date:10/19/2014)... October 20, 2014 OCTOBER ... Meeting (ABIM). ABIM will take place ... information about ABIM 2014 is now available ... Delegates representing companies and organizations from all ... obtain information on the latest products and ...
(Date:10/19/2014)... The Asian Automatic patient billing report defines ... forecast of revenue. The Automatic patient billing market in ... by 2018, at a developing CAGR of 7.2% from ... the Asian Automatic patient billing market, to get an ... a glimpse of the segmentation of this market in ...
(Date:10/19/2014)... The Asian Orthopedic braces and support systems report defines ... forecast of revenue. The Orthopedic braces and support systems market ... by 2018, at a developing CAGR of 4.4% from 2013 ... Orthopedic braces and support systems market, to get an idea ... of the segmentation of orthopedic braces and support systems market ...
Breaking Biology Technology:NDA Partners Appoints Ellen Teplitzky, JD as Director of its Legal Services Practice 2The Asian Automatic patient billing market is estimated to grow to around $463.9 million by 2018 - New Report by MicroMarket Monitor 2The Asian Automatic patient billing market is estimated to grow to around $463.9 million by 2018 - New Report by MicroMarket Monitor 3The Asian Orthopedic braces and support systems market is estimated to grow to around $416.5 million by 2018 - New Report by MicroMarket Monitor 2The Asian Orthopedic braces and support systems market is estimated to grow to around $416.5 million by 2018 - New Report by MicroMarket Monitor 3The Asian Orthopedic braces and support systems market is estimated to grow to around $416.5 million by 2018 - New Report by MicroMarket Monitor 4
... DIEGO, July 24 /PRNewswire-FirstCall/ - MIGENIX Inc.,(TSX: MGI; ... infectious,diseases, advises that the directors of MIGENIX Inc. ... to be held at 2:00 p.m. (Vancouver,time) on ... Sciences Mall, Vancouver,British Columbia. Further details with respect ...
... ITMN ) announced today that it will release second ... Thursday, July 31, 2008,at 4:00 p.m. Eastern time. A ... at 4:30 p.m. Eastern time that same day., ... (international), conference ID# 57393097. To access the,webcast, please log ...
... LEXINGTON, Mass., July 24 Instrumentation Laboratory,(IL) today ... services,company, has awarded the Company with a five-year ... based in Dallas, TX, counts,among its clients more ... care facilities and more than 18,000 physician practices., ...
Cached Biology Technology:InterMune to Release Second Quarter 2008 Financial Results and Provide Business Update on July 31 2Instrumentation Laboratory Announces Contract for Multi-Parameter Testing Products with Broadlane 2
(Date:10/18/2014)... suspected genetic conditions, a certain type of exome sequencing ... than traditional molecular diagnostic methods, according to a study ... released to coincide with the American Society of Human ... protein­coding region of the genome (the complete set of ... organism), has been rapidly applied in research settings and ...
(Date:10/17/2014)... release is available in German . ... a very few drugs. When treating overdoses, doctors are often ... especially difficult if there is a combination of drugs involved. ... and accidentally swallows his grandmother,s pills? ETH professor Jean-Christophe Leroux ... to find an answer to this question. "The task was ...
(Date:10/16/2014)... researchers have challenged conventional thinking on how the bowel ... mechanism for how bowel cancer starts. , The researchers ... and regenerating the ,crypts, that are a feature of ... involved in bowel cancer development, a controversial finding as ... , Using 3D imaging technologies, Dr Chin Wee Tan ...
Breaking Biology News(10 mins):Study examines type of exome sequencing and molecular diagnostic yield 2Study examines type of exome sequencing and molecular diagnostic yield 3Emergency aid for overdoses 2Emergency aid for overdoses 3Cryptic clues drive new theory of bowel cancer development 2
... States, smart growth proponents have urged communities to cluster ... and familiar sprawl. Cluster developments create a far ... of the land area than dispersed houses. The ... space, farmland, and rural character. Yet few studies ...
... up to an undergraduate class, being given a dissertation ... improve on it. This was the experience ... London,s) Department of Science and Technology Studies between 2000 ... teaching is a full-blown academic monograph published this month ...
... stories of shepherds and travellers encountering lions, for example ... on flocks and people by these fierce predators. Lions ... but for livestock owners around the Waza National Park, ... loss of human life is rarely reported, lion predation ...
Cached Biology News:Location, location, location 2Location, location, location 3Living with lions 2
NATIVE RAT OSTEOCALCIN...
Form: Ready to use Applications: Immunohistology-frozen, Immunohistology-paraffin, Western Blot, ELISA...
Form: Ready to use Applications: ELISA...
EnzChek Ultra Xylanase Assay Kit *500 assays*...
Biology Products: