Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:12/22/2014)... 22, 2014 The American ... of original research, reviews and editorials addressing developments ... practice, today published a provocative article exploring the ... progression and potential treatment of prostate cancer. ... and proposes the possibility that there could be ...
(Date:12/19/2014)... OR and Hershey, PA (PRWEB) December 19, 2014 ... Pink: BJCT), a leading developer and manufacturer of ... entered into an agreement with Immunomic Therapeutics, Inc. ... Biojector®-2000 needle-free injection device with its LAMP™ vaccine ... an option for an exclusive Worldwide license to ...
(Date:12/19/2014)... , Dec. 19, 2014 Naurex Inc., ... novel drugs for diseases of the central nervous system, ... and chief executive officer, will present at the 33 ... presentation will take place at 3:00 p.m. PST on ... in San Francisco, Calif. ...
(Date:12/19/2014)... 2014 Decision Resources Group finds that the ... 12 percent compound annual growth rate through 2023. This ... and the increasing adoption of dental implants. Growing aesthetic ... also spur demand for dental biomaterials because they can ... treatments. Other key findings from Decision Resources ...
Breaking Biology Technology:Prostate Cancer Experts Dissect the Role of Follicle-stimulating Hormone in the Development, Progression and Potential Treatment of Prostate Cancer 2Prostate Cancer Experts Dissect the Role of Follicle-stimulating Hormone in the Development, Progression and Potential Treatment of Prostate Cancer 3Prostate Cancer Experts Dissect the Role of Follicle-stimulating Hormone in the Development, Progression and Potential Treatment of Prostate Cancer 4Bioject and Immunomic Therapeutics Enter into an Agreement for License of Needle-Free Technology for LAMP-vax Vaccines 2Bioject and Immunomic Therapeutics Enter into an Agreement for License of Needle-Free Technology for LAMP-vax Vaccines 3Naurex to Present at 33rd Annual J.P. Morgan Healthcare Conference 2Latin American Dental Biomaterial Market Will Expand at a 12 Percent Annual Growth Rate Through 2023 2Latin American Dental Biomaterial Market Will Expand at a 12 Percent Annual Growth Rate Through 2023 3
... Hair loss remains an important distressing side effect for ... critical health issues there is no doubt that loss of ... effects of this concern often cause one to become anxious ... by Coates et al, nausea, hair loss and vomiting were ...
... physicists used the electric fields generated by intersecting laser ... spheres, thereby creating 3-D arrays of optically induced crystals. ... the structure of materials of biological interest, including bacteria, ... Raithel is co-author of a research paper on the ...
... International, LLC, a global leader in distributing laboratory ... the business of BioExpress Corp. ... is a well-respected distributor in the education, biotechnology ... well-known, multi-national brands, including its private label brand, ...
Cached Biology Technology:Expert Offers Solution to Hair Loss Concerns 2Lasers used to form 3-D crystals made of nanoparticles 2VWR International, LLC Acquires BioExpress Corp. 2
(Date:12/10/2014)... , Dec. 9, 2014  Valencell, a leader ... is seeing a staggering demand from its licensees for ... Company revealed, is not solely coming from fitness and ... well. "A wearable is only as useful ... accuracy is the ultimate driver in long-term mass consumer ...
(Date:12/10/2014)... , December 9, 2014 ... ITN,s BCARD Platform   ... enterprise meeting scheduling solutions for business-to-business (B2B) events, ... world leader in mobile near-field communication (NFC), Bluetooth ...      (Logo: http://photos.prnewswire.com/prnh/20140612/691055) , Jifflenow ...
(Date:12/3/2014)... Dec. 2, 2014   Marvin Test Solutions ... test solutions for military, aerospace, and manufacturing organizations, ... its successful TS-900 PXI semiconductor test platform ... of high-end systems to customers at a fraction ... to traditional ATE. "Our semiconductor ...
Breaking Biology News(10 mins):Wearable Technology Products Demand Highly Accurate Biometric Technology 2Jifflenow And ITN International Bring Cutting-Edge Badge Scanning Technology To B2B Events 2Jifflenow And ITN International Bring Cutting-Edge Badge Scanning Technology To B2B Events 3Marvin Test Solutions Brings New Capabilities to PXI-Based Semiconductor Test with TS-960 2Marvin Test Solutions Brings New Capabilities to PXI-Based Semiconductor Test with TS-960 3
... 22 , 2009SRI International, an independent nonprofit research ... for Cancer Research was selected by the National ... the newly-formed "Chemical Biology Consortium" (CBC), a collaborative ... therapeutics active against novel molecular and genetic cancer ...
... at the Johns Hopkins Malaria Research Institute have for ... the proper conformation and quantity to generate a significant ... in a potential transmission-blocking vaccine. Antibodies induced by Pfs48/45 ... malaria-causing parasite, Plasmodium , as it grows within ...
... July 22, 2009 Berry research is currently attracting ... of the need for a rigorously peer-reviewed publication in ... launch of the Journal of Berry Research . ... (Hon), Universit Politecnica della Marche, Department of Biochemistry, Biology ...
Cached Biology News:SRI announces selection by the National Cancer Institute as a Chemical Biology Consortium center 2Vaccine blocks malaria transmission in lab experiments 2IOS Press announces launch of Journal of Berry Research 2IOS Press announces launch of Journal of Berry Research 3
... unit with motorized heated lid and skirted inner ... for microarrays and chips. The four screw-down points ... force of the motorized lid is set with ... results. This interchangeable Moto Alpha unit functions on ...
... These skirted micro test tubes are ... of polypropylene, these tubes have uniform walls ... nonsterile, with separate O-ring screw caps. The ... and have an operating range from -55 ...
... carriers to suit the widest possible range ... science laboratory. Labware carriers can be placed ... is simple for the user, thanks to ... are correctly guided into position. This allows ...
... For affinity chromatography, Affi-Prep protein ... (IgG), selectively remove IgG prior to ... adsorb immune complexes for antigen purification. ... region of immunoglobulins, especially IgG from ...
Biology Products: