Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:1/22/2015)... | RBJ today announces the firm brokered a long-term lease ... leading biopharmaceutical company, at Two Ledgemont Center in ... , president, and Brian Cohen , senior vice president, ... at 95 Hayden Ave. Photo - http://photos.prnewswire.com/prnh/20150122/170765 ...
(Date:1/22/2015)... BOSTON , Jan. 22, 2015  Transwestern | RBJ today ... feet of office space for Shire a leading biopharmaceutical company, ... . Transwestern | RBJ,s Robert Richards , president, and ... the lease for the entire five-floor building at 95 Hayden ...
(Date:1/22/2015)... 2015 The laboratory information management systems ... a number of technological advancements due to factors such ... need to integrate healthcare systems, and increasing government support ... system integration. Key players in the market focus on ...
(Date:1/22/2015)... Rootstown, OH (PRWEB) January 22, 2015 Crystal ... announced today that it has received AOAC-PTM Certifications for the ... O111, O121, and O145; collectively referred to as STEC or ... at 1 colony forming unit (cfu) per 325 g of ...
Breaking Biology Technology:Transwestern | RBJ Advises Shire in 202,000 SF Lease, Creating Boston's Largest Suburban Biotech Campus 2Transwestern?RBJ Advises Shire in 202,000 SF Lease, Creating Boston's Largest Suburban Biotech Campus 2Laboratory Information Management Systems Market is Expected to Reach $1,323.6 Million by 2019 - New Research Report by MarketsandMarkets 2Laboratory Information Management Systems Market is Expected to Reach $1,323.6 Million by 2019 - New Research Report by MarketsandMarkets 3Laboratory Information Management Systems Market is Expected to Reach $1,323.6 Million by 2019 - New Research Report by MarketsandMarkets 4Crystal Diagnostics Awarded AOAC-PTM Accreditation for the Rapid Detection of “Big 6” E.coli Food Pathogens 2
... Cord Blood America, Inc . ( www.cordblood-america.com ) ... blood stem cell preservation company focused on bringing ... and internationally, today announced that revenues for 2011 increased 37 ... The Company announced a gross profit increase in 2011 of ...
... 2012   HemoShear, LLC , a biotechnology research company ... systems for discovery and assessment of new drug compounds, ... Heart Association,s Arteriosclerosis, Thrombosis and Vascular Biology (ATVB) conference ... at the Hilton Chicago, 720 South Michigan Avenue in ...
... A recent solicitation by the Defense Logistics Agency ... a deluge of orders for emergency radiation products supplier ... tablets provide protection against radioactive iodine in the event ... of nuclear weaponry in Asia and the Middle East ...
Cached Biology Technology:Cord Blood America Revenues Up 37 Percent to $5.67 Million in 2011 2HemoShear to Present at Arteriosclerosis, Thrombosis and Vascular Biology (ATVB) Conference 2Potassium Iodide Sales Surge on Heels of Large Government Order 2
(Date:12/22/2014)... , Dec. 22, 2014  NXT-ID, Inc. (NASDAQ: NXTD ... company focused on the growing mobile commerce market, announces it ... Robbins for the 2015 International CES debut of the ... will be at the NXT-ID booth January 6th and ...
(Date:12/19/2014)... Research and Markets ( http://www.researchandmarkets.com/research/8kmfcn/iphone_5s ) has ... Sensor - Apple/AuthenTec TMDR92 & Sapphire - Technology Report" ... http://photos.prnewswire.com/prnh/20130307/600769 Following the acquisition of ... feature with the iPhone 5S. It is currently the ...
(Date:12/19/2014)... Dec. 18, 2014   LaunchKey , the first decentralized ... and Internet of Things era, today announced the close ... round was led by Metamorphic Ventures with participation from ... VegasTechFund, and others.  LaunchKey has raised $4 million to ...
Breaking Biology News(10 mins):NXT-ID Hires Master Pickpocket and Security Consultant Apollo Robbins for Wocket Smart Wallet CES 2015 Debut 2NXT-ID Hires Master Pickpocket and Security Consultant Apollo Robbins for Wocket Smart Wallet CES 2015 Debut 3NXT-ID Hires Master Pickpocket and Security Consultant Apollo Robbins for Wocket Smart Wallet CES 2015 Debut 4iPhone 5S Fingerprint Sensor - Apple/AuthenTec TMDR92 & Sapphire - Technology Report 2LaunchKey Raises $3 Million in Additional Funding Led by Metamorphic Ventures 2LaunchKey Raises $3 Million in Additional Funding Led by Metamorphic Ventures 3
... diseases such as schizophrenia, major depression and cancer ... of dysfunctional genes. A novel computational biology method ... Abdi, PhD, http://www.njit.edu/news/2008/2008-367.php , associate professor in ... found a way to uncover the critical genes ...
... day Americans elect a new president, one of the nation,s ... Houston and outline the daunting global warming challenges awaiting the ... analysis at the National Center for Atmospheric Research (NCAR) in ... a colloquium Tuesday, Nov. 4. The event is free ...
... granted to the laboratory of William Roush, Ph.D., ... Research Institute. Other participants in the consortium are ... California, San Francisco (UCSF), and University of Washington. ... Translational Research Institute Medical Chemistry division and professor ...
Cached Biology News:NJIT professor finds engineering technique to identify disease-causing genes 2Climate change expert to discuss grim global warming predictions 2Scripps Florida scientists awarded $1.5M to fight major water and food parasites 2
... of mouse embryonic stem cells to dopaminergic ... midbrain, where they are mainly located in ... and the retrorubral field. These dopaminergic (DA) ... innervation ( e.g.projections to the caudate nucleus, ...
... screening and binding optimization and built on ... synthesis platform. Thousands of customer specified RNA ... Sciences can provide assistance with custom sequence ... of our comprehensive DNA/RNA Aptamer Microarray Service. ...
... C-terminal end of the mouse retinoic acid receptor beta (RAR*). The ... RAR*. The sequence of PEP-005 is (amino to carboxy terminus): C ... - S - V - E - N - S - G ... - L - Q (The N-terminal cysteine has been added to ...
... The ELx50 is a fast and versatile ... with our patented Dual-ActionTM 16-channel manifold. This ... the dispense and aspiration manifolds for overfill ... and 384-well formats. The problem of fitting ...
Biology Products: