Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:1/14/2014)... Carahsoft and CDS Federal Services have scheduled ... 2pm EST (11am PST), “Natural Language Processing: Converting Raw ... technology can turn raw, heterogeneous data into actionable knowledge ... online webinar will last approximately one hour. , Synopsis: ...
(Date:1/14/2014)... The largest international professional organization of scientists ... derivatives thereof has endorsed an educational program that ... challenges of adulterated herb and botanical products. ... The Society for Medicinal Plant and Natural Product ...
(Date:1/14/2014)... 2014 Global Record Systems, LLC, ... technology solutions for patients, physicians, the biopharmaceutical industry, ... today the signing of a three-year Research Collaboration ... Administration (FDA). This initiative is designed to ...
(Date:1/14/2014)... Altadena, CA (PRWEB) January 14, 2014 ... Angeles County), California, and Montreal, Canada, has big ideas ... and non-fiction. The press's goals are to produce high-quality, ... e-books to support local businesses. , The first ...
Breaking Biology Technology:Webcast - Natural Language Processing: Converting Raw Data into Actionable Knowledge – Hosted by Carahsoft and CDS Federal Services 2World's Largest Group of Medicinal Plant Researchers Endorses ABC-AHP-NCNPR Botanical Adulterants Program 2World's Largest Group of Medicinal Plant Researchers Endorses ABC-AHP-NCNPR Botanical Adulterants Program 3World's Largest Group of Medicinal Plant Researchers Endorses ABC-AHP-NCNPR Botanical Adulterants Program 4World's Largest Group of Medicinal Plant Researchers Endorses ABC-AHP-NCNPR Botanical Adulterants Program 5World's Largest Group of Medicinal Plant Researchers Endorses ABC-AHP-NCNPR Botanical Adulterants Program 6World's Largest Group of Medicinal Plant Researchers Endorses ABC-AHP-NCNPR Botanical Adulterants Program 7World's Largest Group of Medicinal Plant Researchers Endorses ABC-AHP-NCNPR Botanical Adulterants Program 8Global Record Systems Announces Research Collaboration Agreement with FDA to Create a Novel “Big Data” Paradigm for Collection of Patient Safety and Outcomes Information 2Bitingduck Press Looks Forward to 2014 With Multimedia E-books 2
... March 7, 2012 Molecular Detection Inc. (MDI), ... the speed and accuracy of infectious disease diagnosis, ... million financing.  The funds are primarily being used ... the detection of sepsis and gastrointestinal (GI) diseases.  ...
... 2012   Proteonomix, Inc. (OTC/BB: PROT) announced today ... institutional investors, pursuant to which the Company has agreed ... stock at an aggregate purchase price of approximately $3.8 ... shares of Proteonomix common stock) and Series A, Series ...
... including Drexel University,s Dr. Yury Gogotsi has given the ... of the electrodes of supercapacitors the low-cost, lightweight ... many other applications. In a piece published in the ... and his collaborators from universities in France and England, ...
Cached Biology Technology:Molecular Detection Inc. Completes $1.5 Million Financing to Advance New Tests for Sepsis and GI Disorders 2Molecular Detection Inc. Completes $1.5 Million Financing to Advance New Tests for Sepsis and GI Disorders 3Molecular Detection Inc. Completes $1.5 Million Financing to Advance New Tests for Sepsis and GI Disorders 4Proteonomix Announces a Private Placement of $3.8 Million 2Proteonomix Announces a Private Placement of $3.8 Million 3Proteonomix Announces a Private Placement of $3.8 Million 4Drexel's Gogotsi and team advance understanding of energy storage mechanisms in Nature Materials 2
(Date:4/17/2014)... One day about eight years ago, Katia Silvera , ... her father were on a field trip in a mountainous ... they had never seen before. , Unable to identify it, ... The orchid turned out to be an unnamed species. So ... . , "Lophiaris" is the genus name, comprising about 40 ...
(Date:4/17/2014)... of forests in the Amazon help create tinderbox ... rapid and widespread forest loss during drought years, ... show that forests in the Amazon could reach ... forest fires lead to large-scale loss of trees, ... professor of geography, Penn State. , "We documented ...
(Date:4/17/2014)... Current Biology on April 17 have discovered little-known ... insects, which represent four distinct but related species in ... of an animal with sex-reversed genitalia. , "Although ... Neotrogla is the only example in which ... from Hokkaido University in Japan. , During copulation, which ...
Breaking Biology News(10 mins):Orchid named after UC Riverside researcher 2Orchid named after UC Riverside researcher 3Drought and fire in the Amazon lead to sharp increases in forest tree mortality 2Drought and fire in the Amazon lead to sharp increases in forest tree mortality 3In sex-reversed cave insects, females have the penises 2
... Mannitol, a sugar alcohol produced by fungi, bacteria, and algae, ... sweetener is also used in the medical field it,s ... excess fluids and used during surgery as a substance that ... drugs. Now Profs. Ehud Gazit and Daniel Segal of ...
... populations are declining worldwide and a major cause is a ... two-year study shows they can also die from this pathogen, ... that just spreads the disease. When researchers raised the ... least one strain of this pathogen, Batrachochytrium dendrobatidis , ...
... SAN FRANCISCO (June 16, 2013)Male mice who were fed a ... offspring who also had higher levels of body fat, a ... primarily in male offspring, despite their consumption of a low-fat ... Endocrine Society in San Francisco, Calif. , "We,ve identified a ...
Cached Biology News:Artificial sweetener a potential treatment for Parkinson's disease 2Bullfrogs may help spread deadly amphibian fungus, but also die from it 2Obese male mice father offspring with higher levels of body fat 2
MultiWash III w/ 12-portStandard Manifold...
... Performance, 5 ml. The same high ... Streptavidin columns for fast, reliable purification ... Tricorn 5/50 GL, XK 16/20, or ... are required.Extremely useful for exploiting either ...
Biology Products: