Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10
'"/>

Source:


Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:
*Name:
*Comment:
*Email:
TAG: EppendorfPerfect gDNA Blood Mini Kit

(Date:8/29/2014)... (PRWEB) August 29, 2014 A major ... the biotech start-up dense realm of Boston-Cambridge, is gaining ... able investors. James Sherley, the Director of Boston’s Adult ... the local and national visibility of his company an ... 2013. , In addition to a social media marketing ...
(Date:8/28/2014)... 28, 2014 “This kit has an improved ... from 0 to 150 ppb,” said Mark Tess, PhD, Mycotoxin ... benefit to plant owners and USDA-GIPSA inspection agencies that have ... Testing can take place in a matter of minutes with ... plant test the feed and grain before accepting it, but ...
(Date:8/28/2014)... 2014  Next month, executives from clinical trial marketing firm ... beginning with Patient-Centered Clinical Trials 2014 , to be ... , September 4-5. Patient recruitment experts Bonnie A. ... will share insights on the benefits of employing an ... – from media to mobile apps – can be used ...
(Date:8/28/2014)... 2014 Scientists, researchers, and technologists will ... Laser Damage 2014 symposium. Marking its 46th year, ... will run 14-17 September. The event is sponsored by ... . , The premier conference for basic and applied ... optical materials will engage researchers and engineers from numerous ...
Breaking Biology Technology:The Adult Stem Cell Technology Center, LLC Participates in Multiple Stem Cell and Regenerative Medicine Conferences Before Year End 2The Adult Stem Cell Technology Center, LLC Participates in Multiple Stem Cell and Regenerative Medicine Conferences Before Year End 3The Adult Stem Cell Technology Center, LLC Participates in Multiple Stem Cell and Regenerative Medicine Conferences Before Year End 4BBK Worldwide Leads Sessions at Key September Events 2Laser Damage to Draw Researchers, Engineers, Scientists to 46th Annual Conference 2Laser Damage to Draw Researchers, Engineers, Scientists to 46th Annual Conference 3
... July 15 Amsterdam,Molecular Therapeutics (Euronext: AMT), a ... announced the start of a collaboration with St. ... the development,of a gene therapy treatment for Hemophilia ... commercial rights to the final product. The,combination of ...
... A report published in the July 8 issue of ... Sciences ( PNAS ) is the first to ... of tiny nanoclusters of metallic gold. The study, which ... the work of researchers at four universities on two ...
... HealthSonix, Inc.,(Pink Sheets: HSXI)(FWB:H7S) today announced that ... purchased two wholly owned,subsidiaries of HealthSonix, Inc. ... "Selling the two operating companies to Innovative ... the companies to,resume full operations and get ...
Cached Biology Technology:AMT Starts Collaboration With St. Jude Children's Research Hospital on Gene Therapy for Hemophilia B. Company Accesses Exclusive Commercial Rights to Final Therapy 2AMT Starts Collaboration With St. Jude Children's Research Hospital on Gene Therapy for Hemophilia B. Company Accesses Exclusive Commercial Rights to Final Therapy 3AMT Starts Collaboration With St. Jude Children's Research Hospital on Gene Therapy for Hemophilia B. Company Accesses Exclusive Commercial Rights to Final Therapy 4Study reveals principles behind stability and electronic properties of gold nanoclusters 2Study reveals principles behind stability and electronic properties of gold nanoclusters 3Study reveals principles behind stability and electronic properties of gold nanoclusters 4HealthSonix Sells Operating Subsidiaries to Innovative Health Sciences 2
(Date:8/28/2014)... MD FASEB MARC (Maximizing Access to Research ... for the American College of Sports Medicine,s Conference ... 2014 in Miami, Florida. These awards are ... doctorates and scientists from underrepresented groups into the ... encourage the participation of young scientists at the ...
(Date:8/28/2014)... PA, August 28, 2014 Dyslexia, the most ... is a neurological reading disability that occurs when ... language don,t function normally. , The use of ... brain activity is disrupted in dyslexia. However, most ... number of brain regions, leaving a gap in ...
(Date:8/28/2014)... and mould in homes could pose a significant health risk ... in the Journal of Allergy and Clinical Immunology . ... eight different countries, the research has found that the presence ... in asthma sufferers, as well as increasing the likelihood of ... a team at the University of Exeter Medical School and ...
Breaking Biology News(10 mins):Dyslexic readers have disrupted network connections in the brain 2Indoor mold poses health risk to asthma sufferers 2
... HOUSTON -- (Aug. 16, 2010) -- A new ... and other human activity has completely obscured the natural ... "The natural factors that influence carbon dioxide cycling ... the radiocarbon signature of the river to reflect those ...
... of some of the most repugnant smells on earth, but ... has a sense of smell of its own. A team ... first time that bacteria have a molecular "nose" that is ... today in Biotechnology Journal , their study shows how ...
... infrared laser can make a heart beat faster. Scientists ... pulsed light can pace contractions in an avian embryonic heart, ... pacing of the embryonic heart," will be published in the ... 15, 2010. According to the scientists, this non-invasive device ...
Cached Biology News:A river flipped: Humans trump nature on Texas river 2A river flipped: Humans trump nature on Texas river 3Bacteria breakthrough is heaven scent 2A heart beats to a different drummer 2
Recognizes the 41 and 43 kDa G-proteins present in liver plasma membranes and Gq/11alpha expressed in the Sf9 insect cell expression system. Negative for recombinant G(I)alpha subtypes....
Pancreatic Cell Cryopreservation Medium (2X) is intended for the cryopreservation of LT2 Immortalized Pancreatic Mesenchymal Cells (SCR013) and VIT1 Primary Pancreatic Mesenchymal Cells (SCR014)....
LAB/Probe Mouse-Rabbit DAB Kit...
Mouse monoclonal [SH-A1] to S100 alpha ( Abpromise for all tested applications). entrezGeneID: 6271 SwissProtID: P23297...
Biology Products: