Navigation Links
EppendorfPerfect gDNA Blood Mini Kit

Isolation of Coxiella Burnetii Genomic DNA from Goat Placenta, Mouse Spleen, and Bovine MilkUsing the Perfect gDNA Blood Mini Kit

Nathalie Arricau-Bouvery and Armel Souriau
INRA centre of TOURS, Unit de Pathologie Infectieuse et Immunologie, 37380 NOUZILLY FRANCE
Phone: (33) 0247427634, Fax: (33) 0247427779, e-mail: Introduction

Coxiella burnetii, the etiologic agent of Q fever, is an obligate intracellular bacterium. The reservoirs are extensive but partially known, and include mammals, birds and arthropods. Farm animals (i.e., cattle, sheep, goats) are identified as principal sources of human infection 1. Routine diagnosis of Q fever in veterinary medicine is usually performed by Stamp staining of the placenta or serological tests. Isolation and quantitation of C. burnetii are difficult, time consuming and require confined level L3 laboratories. Detection of C. burnetii is possible by using cell culture (shell vial culture system), but essentially it is used in clinical practice 5. Polymerase chain reaction has become a useful tool for the detection of C. burnetii in biological samples 6. However, this necessitates the extraction of the genomic DNA of C. burnetii without purification of bacteria. Thus, the samples contain gDNA of the bacteria and the eukaryotic cells. Different methods are reported in the literature 2, 4, but the sensitivity is very low or the method is not adapted to samples containing blood.

In this article, we report that the Perfect gDNA Blood Mini Kit from Eppendorf is highly adapted to the C. burnetii gDNA extraction when the bacterium is prese nt in goat placenta (blood), mouse spleen or milk.

Materials and Methods


  1. Placenta (goat): the placenta was homogenized in sterile physiological buffer and is constituted essentially of blood.
  2. Spleen (mouse): the spleen was homogenized in sterile physiological buffer.
  3. Milk (bovine)
  4. Blood: the results found with blood provided by animals naturally infected with C. burnetii are the same as those found with placenta, but are not as strong. Indeed, animal blood is deficient in bacterial particles and its difficult to project if and when the bacteria is present in the blood. Thus, only results found with placenta are shown here and represent the results we could have found with blood.
DNA Extraction:

Total DNA was directly extracted from 20 l and 50 l of homogenized goat placenta naturally contaminated by C. burnetii (genome size: 2,103 kb), 10 l, 30 l and 50 l of homogenized mouse spleen (mouse injected intraperitoneally with C. burnetii) and 100 l of bovine milk contaminated by infective suspension of C. burnetii and containing 108 or 107 bacteria/ml). The extraction was carried out using the Eppendorf Perfect gDNA Blood Mini Kit as recommended in the manual with the exception of two steps: the lysis with Proteinase K was performed at 70C in a water bath over a thirty minute period (and could now be frozen at 20C before continuing the DNA extraction), and the final step: gDNA was eluted with 150 l of Elution Buffer.


Two primers, Trans1 and Trans2, derived from a transposon-like repetitive region of the C. burnetii genome, were used to amplify the gDNA of the bacterium (Trans-PCR) 2, 3. The expected product of amplification of the target sequence with these primers was 687 bp in length. Two other primers, O1 (CGGGAAGCTGTGGCGTGATG) and O2 (CTTGGCAGGTTTCTCCAGG), derived from the ovine g3pdh gene, were used to amplify gDNA of the eukaryotic cells. The expected amplification product of the target sequence with these primers was 168 bp in length.

The PCR reaction was performed on 2.5 l of each prepared sample in a total volume of 25 l. The final reaction mixture contained 1 M of each primer, 200 M of each deoxynucleoside triphosphate, 2.5 mM MgCl2 and 0.5 U of Taq DNA Polymerase. The Trans-PCR thermal program6 was modified:

1 cycle at 96C for five minutes, followed by 35 cycles at 96C for thirty seconds, 61C for one minute, 72C for two minutes and 1 final cycle at 96C for thirty seconds, 61C for one minute and 72C for ten minutes. DNA extracted from yolk sacs of chick embryos inoculated with CbO1 strain of C. burnetii was used as a positive control and sterile water as a negative control.

Fig. 1: Amplification of a 168 bp fragment of eukaryotic gDNA. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat), naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water) Fig. 2: Amplification of a 687 bp fragment of genomic DNA from Coxiella burnetii. Genomic DNA was isolated from placenta (goat), spleen (mouse) and milk (bovine) with the Eppendorf Perfect gDNA Blood Mini Kit. Gel electrophoresis (1% agarose gel, x l reaction volume) shows the result of the PCR reaction.
M: Molecular weight marker
Lane 1 and 2: Placenta (goat) naturally contaminated with C. burnetii (20 l and 50 l)
Lane 3, 4 and 5: Spleen (mouse) contaminated with C. burnetii (10 l, 30 l and 50 l)
Lane 6 and 7: Milk (bovine) containing 108 and 107 bacteria/ml (100 l)
Lane 8: Negative control (sterile water)
Lane 9: Positive control (DNA extracted from yolk sacs of chicken embryos inoculated with C. burnetii) Results and Discussion

As expected, the O1-O2 fragment of the eukaryotic cells could be amplified after extraction of the total gDNA of goat placenta, mouse spleen or bovine milk contaminated with C. burnetii (Fig. 1). As the quantity of cells in milk is low and variable, the PCR product obtained with these samples is weak. In addition, the Trans1-Trans2 fragment from C. burnetii could also be amplified successfully in Trans-PCR (Fig. 2).

Thus, this kit can be used for the detection of C. burnetii in different samples such as placenta, spleen, milk or blood (data not shown). Similar results were found with spleens of mice contaminated with Chlamydia and treated with this kit (data not shown).


  1. Baca, O.G. and Paretsky, D. 1983. Q fever and Coxiella burnetii: a model for host-parasite interaction. Microbiol Rev 47: 127-149.
  2. Berri, M., Laroucau, K. and Rodolakis A. 2000. The detection of Coxiella burnetii from ovine genital swabs, milk and fecal samples by the use of a single touchdown polymerase chain reaction. Vet Microbiol 72 (3-4): 285-93.
  3. Hoover, T.A., Vodkin, M.H. and Williams, J.C. 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion sequence. J Bacteriol 174(17): 5540-5548.
  4. Lorenz, H., Jger, C., Willems H. and Balger, G. 1998. PCR detection of C. burnetii from different clinical specimen, especially bovine milk, on the basis of DNA preparation with a silica matrix. Appl Environ Microbiol 64: 4234-4237.
  5. Raoult, D., Vestris, G. and Enea, M. 1990. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation cell culture system and establishment of the strains in HEL cells. J Clin Microbiol 28(11): 2482-2484.
  6. Willems, H., Thiele, D., Frhlich-Ritter, R. and Krauss, H. 1994. Detection of Coxiella burnetii in cow's milk using the polymerase chain reaction (PCR). J Vet Med Ser B 41: 580-587.



Page: All 1 2 3 4 5

Related biology technology :

1. EppendorfPerfect gDNA Blood Mini Kit
2. Fast and Easy Isolation of PCR-Ready Genomic DNA from Whole Blood
3. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
4. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
5. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
6. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
7. Genomic DNA Extraction from Buccal Swabs Using the Perfect gDNA Blood Mini Kit
8. Higher gDNA Concentrations with the Perfect gDNA Blood Mini Kit by Varying the Final Elution Volume
9. Genomic DNA Extraction from Buffy Coat Using the Perfect gDNA Blood Mini Kit
10. Isolation of Genomic DNA from Saliva Using the Perfect gDNA Blood Mini Kit
11. TripleMaster and Perfect gDNA Blood Mini Kit Team Up to Amplify Long gDNA Templates
Post Your Comments:

(Date:2/4/2016)... 2016  Spherix Incorporated (Nasdaq: SPEX ) -- an intellectual ... of intellectual property, today provided an update on the ... District of Texas and announcing ... Inter Partes Re-examination ("IPR") proceedings that VTech and ... was initiated on only certain claims of two of ...
(Date:2/3/2016)... DIEGO , Feb. 3, 2016   ... company with the first pluripotent stem cell-derived islet ... diabetes in clinical-stage development, today announced that ViaCyte ... Pharmaceutical Companies of Johnson & Johnson, have agreed ... group into ViaCyte.  The agreement provides ViaCyte with ...
(Date:2/3/2016)... NEW BRUNSWICK, N.J. , Feb. 3, 2016 ... 30 grants totaling more than $1 million for ... who are working on health-related research that demonstrates ... , this round of funding for the New ... available for faculty members at these educational institutions— ...
(Date:2/3/2016)... Feb. 3, 2016  Silk Therapeutics, Inc., today announced the ... Therapeutics has now raised a total of $10.25 million in ... company. The Series A2 round was led by existing investor ... with participation from new investors Lear Corporation and Highland Consumer ... P. Disney ; Richard Sackler , MD, with Summer ...
Breaking Biology Technology:
(Date:2/2/2016)... , Feb. 2, 2016  Based on ... Frost & Sullivan recognizes US-based Intelligent Retinal Imaging ... & Sullivan Award for New Product Innovation. IRIS, ... North America , is poised ... rapidly growing diabetic retinopathy market. The IRIS technology ...
(Date:2/1/2016)... 2016  Today, the first day of American Heart ... develop a first of its kind workplace health solution ... In the first application of Watson ... ), and Welltok will create a new offering that ... analytics, delivered on Welltok,s health optimization platform. The effort ...
(Date:1/28/2016)... SAN JOSE, Calif., Jan. 28, 2016 Synaptics (NASDAQ: ... financial results for its second quarter ended December 31, 2015. ... the second quarter of fiscal 2016 increased 2 percent compared to ... the second quarter of fiscal 2016 was $35.0 million, or $0.93 ... Non-GAAP net income for the first quarter of fiscal 2016 ...
Breaking Biology News(10 mins):